Review Bioscience Microflora Vol. 25 (3), 67–79, 2006 Molecular Characterization and Benefits of the Intestinal Ecosystem

Michael BLAUT*

German Institute of Human Nutrition Potsdam-Rehbruecke and University of Potsdam, 14558 Nuthetal, Germany Received for publication, March 5, 2006

The microbial community resident in the human gastrointestinal tract has a major impact on host physiology. Manipulating this complex ecosystem by dietary intervention requires knowledge of the parameters that influence its composition and the activity. More recent developments have taken advantage of culture-independent molecular methods for bacterial identification on the basis of the highly discriminatory sequence database of 16S rRNA. This culture-independent approach was applied to asses the fecal microbiota of human subjects from different European countries in relation to nutrition. In one of two human studies, a positive correlation was observed between the intake of fruits and vegetables and the proportion of bacteria belonging to the Clostridium leptum group. In the second study, the relative proportion of bifidobacteria was much higher in the Italian study group than in any other study group. This finding correlated positively with a consumption of water-soluble fiber. Intestinal bacteria also play a role in the activation and inactivation of plant-derived polyphenolic substances such as lignans and flavonoids. To assess the influence of bacterial metabolism on the bioavailability of flavonoids in the human intestinal tract, two model organisms were used to characterize the transformation of flavones in comparison to that of flavonols. Lignans require activation by intestinal bacteria to exert estrogenic and antioxidant activities. Several bacterial species involved in lignan activation were isolated and the catalytic steps involved were characterized. The results indicate that the activation of dietary lignans involves phylogenetically diverse bacteria, most of which are common members of the dominant human intestinal microbiota. Key words: intestinal microbiota; gut anaerobes; culture-independent detection; polyphenol conversion

improved to be able to do this in a targeted way. INTRODUCTION Molecular biological techniques offer the potential to The human intestinal tract is populated by a complex revolutionize the identification and routine monitoring of community of over 1013 microorganisms. This the human gut microbiota (4). Whilst molecular methods community of mostly anaerobic bacteria influences have been introduced in the field of gut microbiology human gut physiology and health by exerting a number (19, 41), a number of limitations prevented the broad of activities including the fermentation of dietary application of these culture independent approaches to components, the production of the short-chain fatty the analysis of intestinal microbiota. One of the acids, the modulation of the immune system, the limitations included the insufficient coverage of the transformation of bile acids, the production of vitamins dominant gut microbiota. One of the primary objectives and health protective substances and the provision of a of our work was therefore the establishment of a more barrier against pathogenic bacteria. While the majority comprehensive comparative 16S rRNA database, and of these activities are beneficial to the host, some based on this, the design of a wider range of diagnostic activities may lead to the formation of toxic, mutagenic probes for age, geographic, disease and dietary based and carcinogenic substances and, thereby, have negative studies. Our work also aimed to investigate in more effects on human health. It has been proposed that detail the role of intestinal bacteria in the activation or modulation of the intestinal microbiota by dietary inactivation of non-nutritive bioactive food components. intervention opens up the possibility to influence human health and well-being in a beneficial way. However, our MATERIALS AND METHODS knowledge of the intestinal ecosystem needs to be greatly Culture-independent retrieval of 16 S rRNA gene sequences Sequencing of the 16S rRNA gene sequences was *Corresponding author. Mailing address: Department of done on DNA isolated directly from human feces (16). Gastrointestinal Microbiology, German Institute of Human Nutrition Utilizing oligonucleotide primers directed at conserved Potsdam-Rehbruecke, Arthur-Scheunert-Allee 114-116, 14458 Nuthetal, Germany. Phone: +49-33200-88470. Fax: +49-33200- sites, 16S rRNA genes were amplified from DNA using 88407. E-mail: [email protected] the polymerase chain reaction (PCR) (45). Amplified

67 68 M.BLAUT rDNA products were sequenced directly using automated (FISH) with up to over 100 intestinal reference species cycle sequencing. The quality of the sequences was (40, 41). For each probe the optimal hybridization assessed by examination for chimera artifacts. The conditions were determined experimentally by gradually obtained sequences together with sequences already increasing the hybridization temperature until the probe available in public databases were used to improve the hybridized only with the target cells. As a positive phylogenetic framework of gut microorganisms. This control, the probe Eub 338 alone or an equimolar mixture work included the generation of phylogenetic trees using of five bacteria-specific probes (Eub338, Eub785, various analytical methods such as neighbor joining, Eub927, Eub1055, Eub1088) was used (4). The parsimony and bootstrap re-sampling (18, 36). Based on oligonucleotides were 5’-labeled with various these analyses, the organisms underlying the analyzed fluorochromes including fluorescein isothiocyanate sequences were phylogenetically assigned. (FITC), and the carbocyanine fluorophores Cy3 and Cy5.

Isolation and description of previously un-described Analysis of the gut microbiota composition by culture- human intestinal bacteria independent methods For the isolation from human fecal samples of strictly Fecal sample collection and fixation: Fecal samples anaerobic and facultatively anaerobic bacteria exhibiting were collected in sterile plastic boxes and kept under catalytic activities relevant to human physiology, various anaerobic conditions as described (34) and stored at 4°C enrichment conditions and media were used. Both rich for a maximum of 4 h before processing. The fixation of media and more defined media containing specific food the cells was done as described previously (40). One ingredients such as certain oligo- and polysaccharides or gram (wet weight) of a fresh fecal sample was suspended secondary plant metabolites were used to enrich different in 9 ml PBS (150 mM NaCl, 10 mM Na2HPO4, 20 mM types of bacteria (22, 23, 42). Isolation was usually NaH2PO4, pH 7.4) and vortexed with glass beads for 3 accomplished after picking single colonies obtained after min. The fecal suspension was subsequently centrifuged serial dilutions of enrichment cultures and repeated at 300 × g for 1 min at 4°C and a volume of 0.2 ml of the plating. Each isolate was checked for purity before it was supernatant was taken and added to 0.6 ml of 4% characterized. The isolates were characterized paraformaldehyde. After 4 h at 4°C, the fecal suspension phenotypically and their phylogenetic position and was centrifuged at 8000 × g for 5 min at 4°C. The cells identity determined based on their 16S rRNA sequence were washed with 1 ml PBS, re-suspended in 0.3 ml PBS as described above. Phenotypic tests were performed to and mixed with 0.3 ml ice-cold ethanol for storage at enable the description of new species. New organisms –20°C until analysis. were formally described taxonomically and Cell preparation for microscopy-based enumeration of representative strains deposited in various European fluorescently labeled cells: For the microscopic sample Culture Collections. preparation, adhesive, teflon coated 8-well-slides were used. The fixed frozen samples were 100-fold diluted Design of new oligonucleotide probes and homogenized. Ten microliters of 0.01% Tween20 For the design of oligonucleotide probes the sequences was applied to each well and 10 μl of the cell suspension of the target organism and the most closely related was added and mixed. The suspension was allowed to bacteria were aligned. Using the Arb software package air-dry and dehydrated for 3 min each in 60%, 80% and (44) the hyper-variable regions of the 16S rRNA gene 96% ethanol. Subsequently, the cells were treated with were inspected for diagnostic stretches of the 16S rRNA. lysozyme (12.5 μl of 0.1% lysozyme in 100 mM TrisHCl Following the identification of a suitable target region, an pH 8.0 with 50 mM EDTA) for 10 min at 4°C. The slides oligonucleotide probe complementary to this region was were air-dried and dehydrated in ethanol as described defined. The G+C content of the oligonucleotide probes above. Each well was covered 10 μl of hybridization was at least 50%. The probe sequence was checked by buffer (900 mM NaCl, 10 mM Tris-HCl pH 7.4, 0.01% using the Check-Probe function of the Ribosomal SDS) and 2 μl of probe solution (Eub338: 10 pM in Database Project (RDP) software package (30) and the hybridization buffer, EubMix: 2 pM for each probe). The alignment function of the EMBL database. The slides were kept in a moist chamber for 3 h at 46°C and theoretical dissociation temperature of the designed subsequently washed in hybridization buffer for 30 min probe was determined according to (2). To ensure the at 48°C. Finally, the slides were immersed in a DAPI specificity toward the target organism, the designed solution (200 ng / ml in PBS buffer) for 10 min at room probes were checked by fluorescent-in situ-hybridization temperature, washed in PBS for 10 min, air-dried, HUMAN INTESTINAL ECOSYSTEM 69 mounted with a drop of Vectashield (Vector Labs, Oligonucleotide probes: A set of 18 phylogenetic Peterborough, UK) and covered with a cover slip. probes (Table 1) was used for the analysis of the During the hybridization and afterwards, the samples microbial composition of 91 fixed fecal samples were protected from light as well as possible to avoid collected from human subjects in five European photo-bleaching. countries. For enumeration of fluorescent cells by flow Bacterial enumeration by microscopy-based image cytometry the specificity of the probes Clep 866, Rcal analysis: A fully motorized Axioplan2 imaging 733, Cvir 1414, Rbro 730, Rfla 729 and Strc 493 was microscope (Carl Zeiss, Oberkochen, Germany), optimized by using unlabeled mismatched equipped with a servo-controlled microscope stage, a oligonucleotides as competitors (25). The EUB 338 Plan-Neofluar 40× dry- and a 100× oil immersion probe, conserved within the domain bacteria, was used as objective (both Carl Zeiss), the fluorescence filter sets 02 a positive control of hybridization in flow cytometry. (excitation: 365 nm; emission: 420 nm) and 15 The NON 338 oligonucleotide (47) was used as the (excitation: 546 nm; emission: 590 nm; both Carl Zeiss) negative control probe. for DAPI and Cy3 excitation, respectively, and an Axiocam black and white CCD camera (Carl Zeiss Bacterial enumeration by flow cytometry Vision, Hallbergmoos, Germany), was used. Image Enumeration of bacteria was performed with a FACS acquisition and image analysis were driven by the Calibur flow cytometer (Becton Dickinson) as described software KS400 (Carl Zeiss Vision) as specified by the previously (33), equipped with an air-cooled argon ion macros developed for the analysis of fecal samples. In up laser providing 15 mW at 488 nm combined with 635 nm to 61 positions of a well two 8-bit grey scale microscopic red-diode laser. All the parameters were collected as images were captured, one in the DAPI channel and the logarithmic signals. The 488-nm laser was used to other in the Cy3 channel. These images were measure the forward angle light scatter (FSC, in the 488 subsequently analyzed by a series of image analysis tools nm band pass filter), the side angle light scatter (SSC, in as described (46). the 488 nm band pass) and the green fluorescence Cell preparation for flow cytometry-based intensity conferred by FITC labeled probes (FL1, in the enumeration of fluorescently labeled cells: Cell 530 nm band pass filter). The red-diode laser was used to preparation and hybridization were done as described detect the red fluorescence conferred by Cy5 labeled (24). An aliquot of 300 μl fixed fecal cells (2.4.1.) were probes (FL4 in a 660 nm band pass filter). mixed with 700 μl PBS. Cells were spun down and re- suspended in a volume of 1 ml PBS. After washing in Human studies on gut microbiota composition Tris-EDTA buffer (100 mM Tris-HCl, pH 8.0, 50 mM Two human studies were performed on the fecal EDTA), pellets were re-suspended in Tris-EDTA buffer microbiota composition of human healthy subjects. The containing 1 mg ml–1 lysozyme and incubated for 10 min participants of the study, who consumed a non-restricted at room temperature. After washing with PBS the cells Western European diet, were recruited at different were re-suspended in hybridization solution (900 mM locations in Europe. None had history of digestive NaCl, 20 mM Tris-HCl, pH 8.0, 0.01% SDS, 30% pathology nor had received antibiotic treatment within 6 formamide). A 50-μl aliquot was used for FISH. months prior to the study. All study participants filled in Protected from light, hybridization was performed in a 1- a food diary with information on food and beverage ml 96-well micro-titer plate overnight at 35°C in 50μl intake on three consecutive days prior to sampling. They hybridization solution with 4 μl labeled probe added at all provided fecal samples for microbial analysis as 50 ng μl–1 and competitor oligonucleotides when described above (2.4). The analyses focused on finding required (24). Following hybridization, 150 μl of possible correlations between the food intake of hybridization solution was added to each well, the cells individuals and their microbiota composition. were spun down, re-suspended in 200 μl washing solution (65 mM NaCl, 20 mM Tris-HCl, pH 8.0, 5 mM Studies on the conversion of dietary polyphenols by EDTA, pH 8.0, 0.01% SDS), and incubated at 37°C for intestinal bacteria 20 min to remove non specific binding of the probe. Whether a given dietary phenolic compound is Cells were pelleted and re-suspended in 150 to 200 μl converted by intestinal bacteria was first investigated in PBS depending on pellet size. Aliquots of 100 μl were fecal slurries. Bacteria catalyzing steps involved in the added to 500 μl of FACS Flow (Becton Dickinson) for conversion of polyphenolic substances were enriched data acquisition by flow cytometry. from human feces and subsequently isolated as described 70 M.BLAUT

Table 1. List of oligonucleotide probes used for the analysis of collected fecal samples Target group Probe sequence (5’-3’) OPD-name or synonym Reference Bifidobacterium genus CATCCGGCATTACCACCC S-G-Bif-0164-a-A-18 (Bif164) (49) Atopobium group GGTCGGTCTCTCAACCC S-*-Ato-0291-a-A-17 (Ato291) (50) Bacteroides/Prevotella CCAATGTGGGGGACTT Bac303 (51) Bacteroides fragilis GTTTCCACATCATTCCACTG S-S-Bfra-0998-a-A-20 (Bfra998) (20) Bacteroides vulgatus AGATGCCTTGCGGCTTACGGC S-S-Bvul-1017-a-A-21 (Bvul1017) (20) Escherichia coli CACCGUAGUGCCUCGUCAUCA EC1531 Lactobacillus/Enterococcus group GGTATTAGCA(C/T)CTGTTTCCA S-G-Lab-0158-a-A20 (52) Eubacterium cylindroides group CGCGGCATTGCTCGTTCA S-*-Ecyl-0386-a-A-18 (53) Veilonella subgroup AGACGCAATCCCCTCCTT S-G-Veil-0223-a-A-18 (53) Lactococcus-Streptococcus group GTTAGCCGTCCCTTTCTGG S-*-Strc-0493-a-A-19 (2) Clostridium leptum subgroup GTTTT(A/G)TCAACGGCAGTC S-G-Clptm-1189-a-A-18 (54) Fusobacterium prausnitzii CCTCTGCACTACTCAAGAAAAAC S-S-Fprau-0645-a-A-23 (55) Ruminococcus flavefaciens subcluster AAAGCCCAGTAAGCCGCC S-*-Rfla-0729-a-A-18 (53) Ruminococcus bromii subcluster TAAAGCCCAGYAGGCCGC S-*-Rbro-0730-a-A-18 (53) Ruminococcus callidus subcluster CAGUAAAGGCCCAGUAAGCC S-*-Rcal-0733-a-A-20 (18) Clostridium viride subcluster CTTGCGTAGCAACTAACAAT S-*-Cvir-1116-a-A-18 (53) Eubacterium desmolans subcluster AGACCARCAGTTTTGAAA S-*-Edes-0635-a-A-18 (18) Eubacterium rectale/Clostridiumcoccoides group GCTTCTTAGTCA(C/T)GTACCG S-*-Erec-0482-a-A-19 (2)

above (2.2). The reactions catalyzed by isolates were (250 μl per well) in an anaerobic chamber. Fecal investigated with growing or resting cells. dilutions (100 μl) were each inoculated in triplicate into Conversion of polyphenols by fecal slurries, growing wells. Controls consisted of fecal bacteria in medium cells, or resting cells: Degradation experiments were without the polyphenolic substrate and the polyphenol- carried out essentially as described previously (10, 39). containing medium without bacteria. These controls Glass tubes fitted with a butyl rubber septum contained were done in triplicates. Plates were incubated at 37°C growth medium or buffer under a gas phase of N2-CO2 under N2-CO2 (80:20, v/v) in an anaerobic jar (80:20, v/v). Aliquots from stock solutions of the pressurized at 1.5 × 105 Pa and placed on a rotary shaker polyphenolic compounds to be tested were added to the (150 rpm). After 48 h of growth, plates were centrifuged medium under anoxic conditions. Media or buffers were at 4,000 × g for 15 min and the supernatants were inoculated with fecal slurries or exponentially growing analyzed by HPLC. A well was considered positive if cells and incubated at 37°C. Samples were taken at the the corresponding dilution of the given fecal sample times indicated in the experiments. Cells and debris were produced the expected degradation product. MPN removed by centrifugation and the supernatant was results were calculated using the table based on three subjected to HPLC analysis. replicates (15). Identification of polyphenols and their degradation products: Polyphenols and their aromatic degradation RESULTS AND REVIEWS products were determined by HPLC analysis essentially Characterization of the human intestinal microbiota as described previously (11). The composition of the Until recently, the analysis of the microbial gut mobile phase and of the applied gradients depended on ecosystem consisted essentially of enumerating fecal the polyphenolic substances to be separated. The bacteria after plating on selective media. Owing to the intermediates and products observed in the flavonoid- limitations of the traditional counting techniques, degradation experiments were identified by their powerful alternative methods based on nucleic acid retention times and their UV-spectra in comparison to probes have been devised for the identification and reference substances in HPLC using an UV/diode array quantification of microorganisms (29). These are based detector. Whenever necessary, compounds were on the highly discriminatory sequence database of 16S identified by mass spectrometry or 1H and 13C nuclear rRNA. The 16S rRNA molecule contains diagnostic magnetic resonance analysis (11). stretches that can be targeted by oligonucleotide probes Most probable number (MPN) experiments: The at different levels of the taxonomic hierarchy. Analysis sterile polyphenol-containing growth medium was of the 16S rRNA sequence facilitates the recognition of dispensed into the 1.2 ml-deep wells of a 96-well plate unknown bacterial species and may be used to design HUMAN INTESTINAL ECOSYSTEM 71

16S rRNA-targeted oligonucleotide probes for efforts were made to isolate new bacteria from human identifying bacteria at the cellular level. Recent feces. Several enrichment strategies were used to isolate investigations indicated that approximately 70% of the new bacterial species from the human gut ecosystem. bacterial species found in the human gut ecosystem have Isolates representing new diversity were subjected to not yet been described (45). To reach a more complete phenotypic and phylogenetic characterization to enable coverage of the microbial in the human intestinal tract, the description of new species. New species were two independent but complementary approaches were formally described taxonomically and deposited in chosen: (i) 16S rRNA sequencing on PCR amplicons culture collections. A collection of new validly obtained directly from human feces and (ii) Enrichment described human intestinal bacteria is listed in Table 2. and isolation of new bacteria. Improvement of culture-independent detection Culture-independent detection of new diversity: techniques: The probe technology facilitates the Sequencing of the 16S rRNA genes was done on fecal recognition of single cells in samples of complex DNA isolated directly from human feces. Using composition such as feces (8). The principle of oligonucleotide primers that hybridize with conserved fluorescence in situ hybridization (FISH) is the detection sites, 16S rRNA genes were amplified from DNA using of a target DNA or RNA site by a fluorescently labeled the polymerase chain reaction (PCR). Clones from the oligonucleotide (4). Based on the knowledge of the 16S feces of human subjects belonging to different age rRNA sequence information it is possible to design an groups were sequenced. The majority of the novel lines oligonucleotide probe that specifically targets a given of 16S rRNA genes fell into one of three major organism or group of organisms. Since each bacterial phylogenetic supra-generic clusters: Clostridium cell contains 103 to 105 ribosomes, the rRNA probes find coccoides group, Clostridium leptum group, and the a sufficiently high number of targets to result in the Bacteroides group. Within the C. coccoides cluster, 54 fluorescence of the target cell. Fluorescence in situ phylogenetically distinct lines of 16S rRNA genes, hybridization is a powerful method for the enumeration which corresponded to new taxa, were identified. This of bacteria in complex habitats such as the human gut. phylogenetic cluster harbors a great diversity of Most notably, it does not require cultivation of the target organisms, and many of the unidentified lines of 16S organisms. The number of probes available for the rRNA genes correspond not only to new species but also detection of intestinal bacteria has steadily increased. represent the nuclei of as yet undefined genera. Within (1) Detection of fluorescently labeled cells by the C. leptum cluster, 57 lines of 16S rRNA genes were microscopy-based image analysis: We established a fully identified which did not equate to any validly described automated and easy to use high resolution microscopic species. Many of the delineated lines were very deep in detection system for fluorescently labeled cells (46). The phylogenetic terms, indicating the presence of a plethora accuracy of this system was investigated by comparing of potentially unrecognized genera from human feces. the resulting data with those obtained by manual Similarly, within the Bacteroides rRNA super-cluster, 44 counting. The quality of the optimized procedure for the lines of 16S rRNA genes were delineated which did not automated enumeration of total bacterial cells was correspond to established species. Most of the clones fell checked by comparing the data of the automated analyses within the established genera Bacteroides, Prevotella or with those obtained by manual counting. Four different Porphyromonas, but some lines were identified which human fecal samples were analyzed in duplicate. The were relatively deep and clearly represent centers of calculated correlation coefficient of 0.984 indicated that variation that could correspond to previously unknown the manually and the automatically obtained data were in genera. Trees illustrating the phylogenetic positions of good agreement. the unidentified rDNA lines within the aforementioned 3 (2) Detection of fluorescently labeled cells by major phylogenetic super-clusters are shown in Figs. 1– microscopy-based image analysis: Flow cytometry 3. (FCM) is a commonly used method in medical diagnostic Isolation of new fecal bacteria: While the culture- and immunology and the enumeration of blood and other independent retrieval of 16S rRNA gene sequences is a cells is a predominant application. This high-throughput good way to describe the diversity of a microbial method has also been used in environmental ecosystem, this information is not sufficient to draw any microbiology. In 1990, Amann and coworkers (3) conclusion on the possible role of these organisms in the presented a combination of FISH with FCM for the ecosystem. In order to gain information on the metabolic analysis of defined mixtures of bacteria for the first time. capabilities of as yet un-described bacterial species, Since then, FCM has been applied to the analysis of 72 M.BLAUT

Fig. 1. Tree of part of the Clostridium coccoides rRNA complex showing the phylogenetic affinities of new lines 16S rRNA genes from intestinal bacteria.

various microbial ecosystems (33, 47, 49). One of the samples, mean proportion of 3.9 +/– 2.2%). The cells first studies using FISH-FCM for the detection of fecal detected with the probe specific for B. vulgatus were bacteria was performed by Rigottier-Gois and colleagues observed in 85% of individuals (17/20 samples) (32). The study aimed to investigate the species accounting for a mean proportion of 4.2 +/– 6.1% and composition of Bacteroides in human fecal samples. being the most abundant Bacteroides species in the feces Five species-specific probes targeting the 16S rRNA of of the study participants. Cells labeled with probes for B. Bacteroides distasonis, B. fragilis, B. ovatus, B. vulgatus ovatus, B. distasonis and B. putredinis were less and B. putredinis were applied to feces collected from 20 frequently detected. This work demonstrated that FISH- healthy adults. All five species were detected in the fecal FCM is an excellent tool for the culture-independent samples. Cells detected with the B. fragilis-specific detection of fecal bacteria. probe were observed in 90% of the study subjects (18/20 HUMAN INTESTINAL ECOSYSTEM 73

Fig. 2. Tree of part of the Clostridium leptum rRNA complex showing the phylogenetic affinities of new lines of 16S rRNA genes of intestinal bacteria.

Application of molecular methods to studying the The results showed that on average more than 75% intestinal microbiota in human populations (75.7% ± 18.6%) of the bacterial cells were detected with Human baseline study: The developed methods were the set of 18 group and species-specific probes (Table 1). applied to fecal samples of healthy volunteers in order to The Clostridium coccoides group and Clostridium gain baseline information on the gut microbiota leptum subgroup were the predominant groups with composition and its possible dependency on diet and 28.0% ± 11.3% and 25.2% ± 7.2%, respectively: The other lifestyle factors. The samples were collected at five third predominant group was represented by the different European locations, namely in Hørsholm Bacteroides group with 8.5% ± 7.1%. On average 75% (Denmark), Jouy-en-Josas, (France), Potsdam of the bacteria could be identified with this set of 18 (Germany), Reading (United Kingdom) and Wageningen probes. Clostridium coccoides and Clostridium leptum (The Netherlands). Every volunteer participating in this were the dominant groups (28.0% and 25.2%), followed trial provided a dietary record covering the three days by the Bacteroides (8.5%). The inter-individual prior to the collection of the fecal sample. One of the variations were high. According to principal component objectives was to explore whether the composition of the analysis, no significant grouping with respect to fecal microbiota in healthy individuals varies with geographic origin, age, or gender was observed (24). To respect to the geographic location of the participants. examine the possible influence of food intake on the fecal 74 M.BLAUT

Fig. 3. Tree of part of the Bacteroides super-cluster rRNA complex showing the phylogenetic affinities of new lines of 16S rRNA genes of intestinal bacteria.

microbiota composition, food questionnaires filled in by correlation was observed between the intake of fruits and 56 adults including 21 French, 19 Germans and 16 vegetables and the proportion of bacteria belonging to Danish were analyzed. The individuals were distributed the Clostridium leptum group. On the contrary, a in nutrition groups according to their intake in milk and negative correlation was observed between the intake of dairy products, fruits and vegetables, meat, foods rich in fruits and vegetables and the proportion of Atopobium. starch (pasta, potatoes and cereal), sugar and alcohol. These results show that food intake may indeed have an Multivariate data analyses were performed to relate food effect on the composition of the fecal microbiota in intake and the microbiota composition. A positive humans. HUMAN INTESTINAL ECOSYSTEM 75

Table 2. Examples of new validly described bacteria isolated from human feces Species Gram stain RRNA complex characteristics Reference Anaerostipes caccae + C. coccoides cluster Utilises acetate and produces butyrate producing (49) Ruminococcus luti + C. coccoides cluster Forms succinate, acetate and hydrogen from glucose (9) Subdoligranulum variabile – C. leptum subgroup Characteristic but variable morphology (10) Clostridium asparagiforme + C. coccoides cluster Asparagus-like shape Mohan et al. submitted Clostridium hathewayi variable C. coccoides cluster From phytic acid enrichments, saccharolytic (50) Clostridium bolteae + C. coccoides cluster Isolated from autistic children (51) Bryantella formatexigens + C. coccoides cluster Acetogen that requires formate for growth (52) Cetobacterium somerae – Fusobacterium cluster Microaerophilic species from autistic children (53) Alistipes finegoldii – Bacteroides cluster Bile-resistant and pigment producing (54) Anaerotruncus colihominis + C. leptum subgroup Produces acetic acid and butyric acid (8) Anaerofustis stercorihominis + Clostridium subphylum Produces acetic acid and butyric acid (55)

Cross-sectional study on different age groups: In independent of age. another human study conducted in cooperation with other European partners 230 human subjects were Role and benefits of the intestinal ecosystem recruited for a cross-sectional study in four European Knowledge of the intestinal microbiota composition study centers, which were located in France, Germany, combined with knowledge of the physiology of key Italy and Sweden. This study was part of the species may give indications of the specific role of these “Crownalife” project, which was funded by the European species in the intestinal ecosystem. However, the Union and coordinated by Joel Doré, Institut National de specific synergistic and antagonistic interactions la Recherche Agronomique, Jouy en Josas, France. between the intestinal microbiota and the host are usually Following the assignment of the study participants to two difficult to study in the human situation owing to the age groups (1: 20–50 years, mean age: 35, n=85; 2: >60 complexity of the intestinal ecosystem and the difficulty years, mean age: 75, n=145) their fecal microbiota to dissect the overall activity of the intestinal microbiota composition was determined and data on their dietary into pieces and to experimentally unravel the specific habits were collected. The analysis of the contribution of a given microbial population group to the microbiological data was based on 14 group- and overall process. In spite of these difficulties, there is no species-specific probes. Clostridium coccoides and doubt that the intestinal ecosystem has a profound impact Bacteroides groups were predominant in all age groups. on host physiology. As largely deduced from work on Marked differences were observed for the German and animal models, important functions of the gut microbiota Italian study groups with respect to the impact of age on include the contribution to colonization resistance (6), three predominant bacterial population groups. In the the regulation of intestinal epithelial cell growth and German study group, the elderly (>60 years) harbored differentiation (12, 17), protection against gut injury higher concentrations of fecal bacteria belonging to the (31), stimulation of angiogenesis (43), and increased Eubacterium rectale-Clostridium coccoides cluster than body-fat storage (5). the 20 to 50 year olds (23.5% versus 14.5% of total Metabolic diversity: The ability of the intestinal bacteria), while the situation was inversed for the Italian microbiota to process otherwise indigestible food study subjects, namely 17.2% in the elderly versus 25.9% ingredients as well as host-derived substances is one of in the 20–50 year olds. An analogous age-country the most fundamentally important roles played by this relationship was observed for the proportions of fecal microbial community. Principal substrates are dietary Bacteroides, with higher proportions in the German components that have escaped digestion in the small elderly than in the German 20–50 year olds (8.7% versus intestine. These include resistant starch, plant cell wall 3.9% of total bacteria) and lower proportions in the polysaccharides, and soluble non-digestible Italian elderly than in the Italian 20–50 year olds (13.6% carbohydrates (14) as well as undigested dietary proteins versus 5.3% of total bacteria). The proportions of and proteins derived from digestive enzymes and bifidobacteria were approximately 3-fold higher in the sloughed epithelial cells (27). The wide variety of Italian study groups than in any other study group. In substrates available to the intestinal ecosystem may be a contrast to the other two bacterial groups, this effect was major reason for its complexity, so that phylogenetic 76 M.BLAUT diversity of the intestinal microbiota is a reflection of this dihydrochalcone glycosides, a subclass of flavonoids, metabolic diversity. The bacterial conversion in the using neohesperidin dihydrochalcone (NHDC) as a colon of carbohydrates leads to the formation of short model compound (10). Human fecal slurries converted chain fatty acids (SCFA), carbon dioxide and molecular NHDC to 3-(3-hydroxy-4-methoxyphenyl)propionic hydrogen. The SCFAs provide additional energy to the acid or 3-(3, 4-dihydroxyphenyl)propionic acid. Pure host. Butyrate is the preferred energy source of the cultures of E. ramulus and C. orbiscindens were not colonocytes (35) and a major controlling factor for their capable of converting NHDC, but they converted growth and differentiation (26). Butyrate has been intermediates resulting from NHDC transformation by associated with lowering the risk of colon cancer: it was fecal slurries: Hesperetin dihydrochalcone-4’-β-D- shown to inhibit the genotoxic activity of nitrosamides glucoside was deglycosylated by E. ramulus, but not by and hydrogen peroxide in human colon cells (48) and to C. orbiscindens, while the resulting aglycone was induce apoptosis in human colonic tumor cell lines in a cleaved by both E. ramulus and C. orbiscindens giving p53-independent pathway (20). Protein fermentation rise to 3-(3-hydroxy-4-methoxyphenyl)propionic acid results in the formation of ammonia, phenols, indoles and and probably phloroglucinol. This reaction was shown to secondary amines, some of which at higher be catalyzed by the phloretin hydrolase from E. ramulus concentrations have been proposed to act as co- indicating that this enzyme also recognizes substrates carcinogens (28). other than phloretin. These investigations included the Conversion of non-nutritive food components by study of key enzymes involved in transformation intestinal bacteria and consequences for their reactions. We isolated and characterized the chalcone bioavailability: Fruit and vegetables not only contain isomerase from E. ramulus, which catalyzes the nutrients but also a wide variety of non-nutritive isomerization of naringenin chalcone, isoliquiritigenin, secondary plant constituents such as polyphenols, which and butein, three chalcones that differ in their include flavonoids and lignans. Flavonoids have been hydroxylation pattern (21). Cloning of the phloretin proposed to have anti-inflammatory, antibacterial, hydrolase gene from E. ramulus and its expression in E. antiviral, anti-allergic and vasodilatory activity (13) and coli enabled us to purify and characterize the to act as dietary agents in the protection against cancer recombinant enzyme (38). (7). Isoflavones and lignans, which belong to the so- (2) Lignan activation by intestinal bacteria: Lignans called phytoestrogens have been implicated in the occur in a number of plants relevant for human nutrition prevention of hormone-related cancers, atherosclerosis, including rye, flaxseed, berries and cereals. Lignans osteoporosis and the alleviation of menopausal require activation by intestinal bacteria to exert symptoms (1). Since polyphenols may undergo estrogenic and antioxidant activities on the host. transformation by intestinal bacteria, the microbial Secoisolariciresionol diglucoside (SDG) is one of the ecosystem has a major impact on their bioavailability and most abundant dietary lignans. SDG is of interest thereby on their potential health effects (9). because of its proposed preventive effects against breast (1) Conversion of flavonoids by intestinal bacteria: To and colon cancer, atherosclerosis, and diabetes. We used assess the influence of bacterial metabolism on the SDG as a model compound to identify intestinal bacteria bioavailability of flavonoids in the human intestinal tract, that are involved in lignan activation in the human we previously isolated the fecal organism Eubacterium intestinal tract. Our work aimed to characterize the ramulus (37), determined its numerical importance in the catalytic steps leading from the plant lignan human intestinal tract (41), and elucidated the secoisolariciresinol diglucoside (SDG) to the so-called degradation pathway for the flavonol quercetin (11). mammalian lignans enterodiol (ED) and enterolacton This species together with Clostridium orbiscindens (EL). This conversion involves deglycosylation, were subsequently used as model organisms to demethylation, dehydroxylation, and dehydrogenation characterize the transformation of flavones in reactions. Four bacterial strains capable of comparison to that of flavonols (39). Although both dedeglycosylating SDG to the aglycone organisms used the same degradation pathways, no secoisolariciresinol (SECO) were isolated from human intermediates could be detected during flavonoid feces and identified by 16S rRNA gene sequencing as breakdown by E. ramulus, while several intermediates three Bacteroides and one Clostridium species. accumulated under similar conditions with C. Subsequent screening of fecal bacteria from strain orbiscindens. collections and enrichments of fecal bacteria on SECO More recently, we studied the bacterial degradation of resulted in the isolation and identification of five HUMAN INTESTINAL ECOSYSTEM 77 different strains capable of catalyzing the demethylation David Collins, Willem de Vos, Kim Holmstrøm, Elaine of SECO and of two strains capable of dehydroxylating Vaughan, Gjalt Welling, and to all their coworkers. Last the resulting demethylation products. The first isolate but not least, I would like to thank my own coworkers for obtained from the enrichments, identified as their valuable contributions: Annett Braune, Lilian Peptostreptococcus productus, was shown to O- Schoefer, Andreas Schwiertz, Rainer Simmering, demethylate SECO, while the second isolate, identified Thomas Clavel, Claudia Herles, Ruchika Mohan, Pawel as Eggerthella lenta, dehydroxylated the product formed Namsolleck, and Ralph Thiel. by P. productus. Co-cultivation of the two organisms resulted in the conversion of SECO to ED. The newly REFERENCES isolated strain ED-Mt61/PYG-s6 catalyzed the (1) Adlercreutz H, Mazur W. 1997. Phyto-oestrogens and dehydrogenation of ED to EL, completing the conversion Western diseases. Ann Med 29: 95–120. of SDG to EL. The new isolate showed little similarity (2) Alm EW, Oerther DB, Larsen N, Stahl DA, Raskin L. with previously described species and therefore most 1996. The oligonucleotide probe database. Appl Environ Microbiol 62: 3557–3559. likely represents a new species. (3) Amann RI, Binder BJ, Olson RJ, Chisholm SW, The ability of fecal bacteria to convert SDG to the Devereux R, Stahl DA. 1990. Combination of 16S estrogen-like metabolites ED and EL was found to be rRNA-targeted oligonucleotide probes with flow widely distributed among humans, the prevalence being cytometry for analyzing mixed microbial populations. 100% in the 24 healthy adults analyzed. The number of Appl Environ Microbiol 56: 1919–1925. ED- and EL-producing bacteria was determined for 24 (4) Amann RI, Ludwig W, Schleifer KH. 1995. healthy test persons. On average, one gram of feces Phylogenetic identification and in situ detection of individual microbial cells without cultivation. contained approximately 6 × 108 ED and 3 × 105 EL Microbiol Rev 59: 143–169. producers for each person, corresponding to a fraction of (5) Backhed F, Ding H, Wang T, Hooper LV, Koh GY, approximately 0.5% and 0.00025% of total bacteria, Nagy A, Semenkovich CF, Gordon JI. 2004. The gut respectively. Women tended to show higher microbiota as an environmental factor that regulates fat concentrations of both ED- and EL-producing storage. Proc Natl Acad Sci U S A 101: 15718–15723. organisms. The results indicate that the activation of (6) Berg RD. 1996. The indigenous gastrointestinal SDG involves phylogenetically diverse bacteria, most of microflora. Trends Microbiol 4: 430–435. (7) Birt DF, Hendrich S, Wang W. 2001. Dietary agents in which are common members of the dominant human cancer prevention: flavonoids and isoflavonoids. intestinal microbiota. Pharmacol Ther 90: 157–177. (8) Blaut M, Collins MD,Welling GW, Dore J, van Loo J, CONCLUSIONS de Vos W. 2002. Molecular biological methods for Recent findings indicate that understanding the studying the gut microbiota: the EU human gut flora relationship between the human host and his resident project. Br J Nutr 87 Suppl 2: S203–211. intestinal microbiota is of considerable importance. The (9) Blaut M, Schoefer L, Braune A. 2003. Transformation mechanisms underlying these complex interactions are of flavonoids by intestinal microorganisms. Int J Vitam Nutr Res 73: 79–87. only beginning to be understood. In view of the progress (10) Braune A, Engst W, Blaut M. 2005. Degradation of that has been made in all life sciences by the application neohesperidin dihydrochalcone by human intestinal of molecular methods and in the field of gut bacteria. J Agric Food Chem 53: 1782–1790. microbiology by the use of gnotobiotic animal models, it (11) Braune A, Gutschow M, Engst W, Blaut M. 2001. is hoped that the expected increase in knowledge can be Degradation of quercetin and luteolin by Eubacterium exploited in support of human health and well-being. ramulus. Appl Environ Microbiol 67: 5558–5567. (12) Bry L, Falk PG, Midtvedt T, Gordon JI. 1996. A model of host-microbial interactions in an open mammalian Acknowledgements. A large proportion of the work ecosystem. Science 273: 1380–1383. reported herein has been done in close cooperation with (13) Cook NC, Samman S. 1996. Flavonoids- Chemistry, other laboratories as part of three joint European projects metabolism, cardioprotective effects, and dietary (FAIR-CT97-3035, QLK1-CT2000-00108, and QLK1- sources. Nutr Biochem 7: 66–76. CT2000-00067) within the 4th and 6th framework (14) Cummings JH, Macfarlane GT. 1991. The control and program of the European Union. As the coordinator of consequences of bacterial fermentation in the human the former two projects I am indebted to all scientists colon. J Appl Bacteriol 70: 443–459. (15) de Man JC. 1985. MPN tables, Corrected. Eur J Appl who contributed to the outcome of the projects. I am Microbiol 17. particular grateful to Joel Doré, Lionel Rigottier Gois, (16) Dore J, Sghir A, Hannequart-Gramet G, Corthier G, 78 M.BLAUT

Pochart P. 1998. Design and evaluation of a 16S de Vos WM, Blaut M. 2004. Molecular methods for rRNA-targeted oligonucleotide probe for specific the analysis of gut microbiota. Microbial Ecol Health detection and quantitation of human faecal Dis 16: 71–85. Bacteroides populations. Syst Appl Microbiol 21: 65– (30) Olsen GJ, Overbeek R, Larsen N, Marsh TL, 71. McCaughey MJ, Maciukenas MA, Kuan WM, Macke (17) Falk PG, Hooper LV, Midtvedt T, Gordon JI. 1998. TJ, Xing Y, Woese CR. 1992. The ribosomal database Creating and maintaining the gastrointestinal project. Nucleic Acids Res 20 Suppl: 2199–2200. ecosystem: what we know and need to know from (31) Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, gnotobiology. Microbiol Mol Biol Rev 62: 1157-1170. Edberg S, Medzhitov R. 2004. Recognition of (18) Fitch WM, Margoliash E. 1967. Construction of commensal microflora by toll-like receptors is phylogenetic trees. Science 155: 279–284. required for intestinal homeostasis. Cell 118: 229–241. (19) Franks AH, Harmsen HJ, Raangs GC, Jansen GJ, (32) Rigottier-Gois L, Le Bourhis AG, Gramet G, Rochet Schut F, Welling GW 1998. Variations of bacterial V, Dore J. 200. Fluorescent hybridisation combined populations in human feces measured by fluorescent in with flow cytometry and hybridisation of total RNA to situ hybridization with group-specific 16S rRNA- analyse the composition of microbial communities in targeted oligonucleotide probes. Appl Environ human faeces using 16S rRNA probes. FEMS Microbiol 64: 3336–3345. Microbiol Ecol 43: 237–245. (20) Hague A, Manning AM, Hanlon KA, Huschtscha LI, (33) Rigottier-Gois L, Rochet V, Garrec N, Suau A, Dore J. Hart D, Paraskeva C. 1993. Sodium butyrate induces 2003. Enumeration of Bacteroides species in human apoptosis in human colonic tumour cell lines in a p53- faeces by fluorescent in situ hybridisation combined independent pathway: implications for the possible with flow cytometry using 16S rRNA probes Syst role of dietary fibre in the prevention of large-bowel Appl Microbiol 26: 110–118. cancer. Int J Cancer 55: 498–505. (34) Rochet V, Rigottier-Gois L, Beguet F, Dore J. 2001. (21) Herles C, Braune A, Blaut M. 2004. First bacterial Composition of human intestinal flora analysed by chalcone isomerase isolated from Eubacterium fluorescent in situ hybridisation using group-specific ramulus. Arch Microbiol 181: 428–434. 16S rRNA-targeted oligonucleotide probes. Genet (22) Holmstrom K, Collins MD, Moller T, Falsen E, Select Evol 33: S339–S352. Lawson PA. 2004 Subdoligranulum variabile gen. (35) Roediger WE. 1980. Role of anaerobic bacteria in the nov., sp. nov. from human feces. Anaerobe 10: 197– metabolic welfare of the colonic mucosa in man. Gut 203. 21: 793–798. (23) Lawson PA, Song Y, Liu C, Molitoris DR, Vaisanen (36) Saitou N, Nei M. 1987. The neighbor-joining method: ML, Collins MD, Finegold SM. 2004. Anaerotruncus a new method for reconstructing phylogenetic trees. colihominis gen nov., sp. nov., from human faeces. Int Mol Biol Evol 4: 406–425. J Syst Evol Microbiol 54: 413–417. (37) Schneider H, Schwiertz A, Collins MD, Blaut M. (24) Lay C, Rigottier-Gois L, Holmstrom K, Rajilic M, 1999. Anaerobic transformation of quercetin-3- Vaughan EE, de Vos WM, Collins MD, Thiel R, glucoside by bacteria from the human intestinal tract. Namsolleck P, Blaut M, Dore J. 2005. Colonic Arch Microbiol 171: 81–91. microbiota signatures across five northern European (38) Schoefer L, Braune A, Blaut M. 2004 Cloning and countries. Appl Environ Microbiol 71: 4153–4155. expression of a phloretin hydrolase gene from (25) Lay C, Sutren M, Rochet V, Saunier K, Dore J, Eubacterium ramulus and characterization of the Rigottier-Gois L. 2005 Design and validation of 16S recombinant enzyme. Appl Environ Microbiol 70: rRNA probes to enumerate members of the 6131–6137. Clostridium leptum subgroup in human faecal (39) Schoefer L, Mohan R, Schwiertz A, Braune A, Blaut microbiota. Environ Microbiol 7: 933–946. M. 2003. Anaerobic degradation of flavonoids by (26) Litvak DA, Evers BM, Hwang KO, Hellmich MR, Ko Clostridium orbiscindens. Appl Environ Microbiol 69: TC, Townsend, Jr CM. 1998. Butyrate-induced 5849–5854. differentiation of Caco-2 cells is associated with (40) Schwiertz A, Le Blay G, Blaut M. 2000. apoptosis and early induction of p21Waf1/Cip1 and Quantification of different Eubacterium spp in human p27Kip1 Surgery 124: 161-169; discussion 169–170. fecal samples with species-specific 16S rRNA- (27) Macfarlane GT, Cummings JH, Allison C. 1986. targeted oligonucleotide probes. Appl Environ Protein degradation by human intestinal bacteria. J Microbiol 66: 375–382. Gen Microbiol 132: 1647–1656. (41) Simmering R, Kleessen B, Blaut M. 1999. (28) Macfarlane GT, Macfarlane S. 1997. Human colonic Quantification of the flavonoid-degrading bacterium microbiota: ecology, physiology and metabolic Eubacterium ramulus in human fecal samples with a potential of intestinal bacteria. Scand J Gastroenterol species-specific oligonucleotide hybridization probe. Suppl 222: 3–9. Appl Environ Microbiol 65: 3705–3709. (29) Namsolleck P, Thiel R, Lawson P, Holmstrom K, (42) Simmering R, Taras D, Schwiertz A, Le Blay G, Gruhl Rajilic M, Vaughan EE, Rigottier-Gois L, Collins MD, B, Lawson PA, Collins MD, Blaut M. 2002. HUMAN INTESTINAL ECOSYSTEM 79

Ruminococcus luti sp. nov., isolated from a human 369–379. faecal sample. Syst Appl Microbiol 25: 189–193. (47) Wallner G, Amann R, Beisker W. 1993. Optimizing (43) Stappenbeck TS, Hooper LV, Gordon JI. 2002. fluorescent in situ hybridization with rRNA-targeted Developmental regulation of intestinal angiogenesis oligonucleotide probes for flow cytometric by indigenous microbes via Paneth cells. Proc Natl identification of microorganisms. Cytometry 14: 136– Acad Sci U S A 99: 15451–15455. 143. (44) Strunk O, Ludwig W. 1996. A sofware environment (48) Wollowski I, Rechkemmer G, Pool-Zobel BL. 2001. for sequence data. In Technische Universitat Protective role of probiotics and prebiotics in colon Munchen, Munic, Germany. cancer. Am J Clin Nutr 73: 451S–455S. (45) Suau A, Bonnet R, Sutren M, Godon JJ, Gibson GR, (49) Zoetendal EG, Ben-Amor K, Harmsen HJ, Schut F, Collins MD, Dore J. 1999. Direct analysis of genes Akkermans AD, de Vos WM. 2002. Quantification of encoding 16S rRNA from complex communities uncultured Ruminococcus obeum-like bacteria in reveals many novel molecular species within the human fecal samples by fluorescent in situ human gut. Appl Environ Microbiol 65: 4799–4807. hybridization and flow cytometry using 16S rRNA- (46) Thiel R, Blaut M. 2005 An improved method for the targeted probes. Appl Environ Microbiol 68: 4225– automated enumeration of fluorescently labelled 4232. bacteria in human faeces. J Microbiol Methods 61: