%N VUE DE LOBTENTION DU %0$503"5%&-6/*7&34*5² %&506-064& $ÏLIVRÏ PAR Université Toulouse III Paul Sabatier (UT3 Paul Sabatier) $ISCIPLINE OU SPÏCIALITÏ Pharmacologie 0RÏSENTÏE ET SOUTENUE PAR Zeina SOAYFANE LE vendredi 4 novembre 2011 4ITRE Implication des transporteurs SR-B1, NPC1L1 et la P-glycoprotéine dans l'absorption intestinale des composés lipophiles %COLE DOCTORALE Biologie, Santé, Biotechnologies (BSB) 5NITÏ DE RECHERCHE UMR 1331 TOXALIM $IRECTEURS DE 4HÒSE Dr. Anne LESPINE Dr. Xavier COLLET 2APPORTEURS Dr. Philippe COSTET Pr. Philippe CARDOT MEMBRES DU JURY :
Pr. Philippe VALET (président) Dr. Xavier COUMOUL (examinateur) Dr. Stéphane ORLOWSKI (membre invité) Remerciements
Je tiens tout d’abord à exprimer ma gratitude et mon respect aux membres du jury. A Monsieur Philippe VALET, professeur à l’université de Toulouse III, pour avoir accepté de présider mon jury de thèse. A Monsieur Philippe CARDOT, professeur à l’université de Paris Pierre et Marie Curie, et à Monsieur Philippe COSTET, chargé de recherche à l’INSERM U915 pour m’avoir fait l’honneur d’être les rapporteurs de cette thèse. A Monsieur Xavier COUMOUL, Maître de Conférences à l’Université de Paris Descartes, qui a accepté d’examiner ce travail. A Monsieur Stéphane ORLOWSKI pour l’honneur qu’il m’a fait en participant à mon jury de thèse, en plus de ses conseils qui m’ont beaucoup aidé et de sa gentillesse.
Je remercie tout particulièrement Madame le docteur Anne LESPINE, directeur de recherche à l’INRA, TOXALIM UMR1331, et directrice de cette thèse et Monsieur le docteur Xavier COLLET, directeur de recherche à l’INSERM et co-directeur de cette thèse, de m’avoir confié un sujet si passionnant, avoir su répondre à mes inquiétudes et m’avoir encadrée de manière si impliquée.
Je suis très reconnaissante à Madame le docteur Christine COMERA, chargée de recherche à l’INRA, TOXALIM UMR1331, pour son encadrement la première année de thèse, sa présence et ses conseils.
Je tiens à remercier Monsieur Bernard SALLES, professeur à l’université de Toulouse III et directeur de l’UMR1331 TOXALIM et à Monsieur Thierry Pineau, directeur du département de Santé Animale de m’avoir accueillie au sein du laboratoire.
Tous mes remerciements s’adressent également aux membres actuels et passés de l’équipe TMR ‘Transporteurs Membranaires et Résistance’ pour m’avoir formé, aidé et soutenu. A Magalie Foucaud VIGNAULT qui a initié et réalisé une grande partie de ce travail lors de son passage en post-doc et qui a permis sa valorisation. A Laurence PEYRASTRE, Cécile MENEZ, Hela CHALWATI, Edwin FOUCHE, Mélanie ALBERICH pour leurs conseils et leur gentillesse. A Chantal LEBRUN pour avoir su m’écouter et me conseiller A Jean François SUTRA, merci de m’avoir aidé sur les manips de prélèvement sanguin sur les souris et réalisé tous les dosages HPLC de notre médicament d’intérêt A Cécile SOTTO, « ma copine », avec qui j’ai partagé de bons moments d’amitiés sur le plan personnel et professionnel. Merci à toi Cécile pour m’avoir servi de guide depuis mon arrivée dans l’équipe. Et maintenant je pars mais j’attends ta visite aux USA. Tu vas me manquer !!! A Monsieur Michel ALVINERIE, pour vos encouragements et conseils
Je tiens à exprimer mes remerciements à tous ceux qui ont participé et aidé à la réalisation de ce travail. A Hervé GUILLOU et Pascal MARTIN pour avoir partagé leur expertise en biologie moléculaire, et en métabolisme des lipides et ouvert leurs congélateurs pleins de primers, ce qui m’a permis de gagner un temps inestimable. A Arnaud POLIZZI, pour m’avoir formé sur le « design » des primers et pour sa gentillesse et son aide à chaque fois que je l’ai sollicité. A Mattéo SERINO et à Philippe COSTET qui se sont intéressés au modèle et qui vont permettre de l’explorer dans des domaines plus larges (microflore intestinale, métabolisme du cholestérol,…).
Je tiens à remercier Madame le Docteur Afifa Ait-Belgnaoui, pour tout son soutien moral, son aide, ses encouragements, son écoute et ses conseils à chaque fois que je l’ai sollicitée.
Tout ce travail de thèse n’aurait pas été possible sans l’aide du personnel de l’équipe de l’animalerie, Colette BETOULIERE et Caroline. Je les remercie pour leur gentillesse, leur bonne humeur et leur aide précieuse pour la gestion de mes souris et mes expériences.
Mes remerciements vont également vers Isabelle OSWALD, Nicolas LOISEAU, Laurence GUZYLACK pour leurs conseils sur mon oral.
Merci aussi à tous les gestionnaires et secrétaires de TOXALIM pour m’avoir aidé dans toutes mes démarches. Je pense à Marie José, Cathy, Sarah, Joëlle.
Un merci aux collègues du laboratoire : Alice, Viorica, Simon, Laila, Alexandra, Julie, Souria, Patricia, Imourane, Frédéric, Jean-Luc, Nabila, Christiane, Olivier, Philippe, Joëlle, Jacques, Régine. Et j’espère n’avoir oublié personne et ceux qui ne se retrouvent pas dans cette liste qu’ils veuillent bien m’en excusez, je les remercie également.
Je remercie également mon amie libanaise, Lara MOUSSA, pour son soutien, son écoute et son aide permanents qui m’ont été très précieux.
Je remercie également le personnel de l’INSERM U563, entre autre, Michella CANTIELLO d’avoir travaillé avec elle, Justine Bertrand MICHEL pour m’avoir réalisé tous les dosages en chromatographie gazeuse, François TERCE, Michel NAUZE, Véronique PONS, Aurélie pour leur aide et conseils.
Un grand merci au professeur Mahmood Hussain, mon futur chef aux USA, avec qui je vais réaliser un post-doctorat et qui a su me faire confiance et attendre que je passe ma thèse.
Merci à tous mes amis libanais et syriens, toulousains et autres pour leur soutien et leur amitié, je pense plus particulièrement à Nadine, Amanie, Ranim, Dima, Hanane, Alia, Sanaa, Marcelle,…
Un grand merci à Madame GIL de m’avoir soutenue pendant les trois ans de thèse et qui a été ma mère de substitution en France. Je lui dis que je ne l’oublierai jamais et je resterai en contact avec elle.
Enfin, ces remerciements ne seraient pas complets sans mentionner toutes les personnes qui m’ont accompagnée et soutenue tout au long de ses trois années, je pense plus particulièrement à mes parents : A ma chère maman qui m’a beaucoup supporté et toujours encouragé malgré la distance qui nous sépare actuellement. A mon père qui m’a toujours soutenu et qui ne cessera jamais de le faire. A ma sœur et mon frère, très présents avec moi. Je vous aime tous !!!
Résumé
L’absorption intestinale des lipides et des micronutriments à caractère lipophile fait intervenir des transporteurs de la membrane apicale de l’entérocyte tels que NPC1L1, SR-B1 et CD36. Pour les xénobiotiques incluant les médicaments lipophiles, les transporteurs ABC multidrogues, comme la P-glycoprotéine (Pgp) ou MRP ou BCRP, interviennent en effluant et en limitant la biodisponibilité de ces composés dans l’organisme. Ils sont aussi capables de transporter des lipides comme le cholestérol et les phospholipides. De plus, un rôle dans l’homéostasie des lipides a été évoqué pour la Pgp. Les objectifs de cette thèse ont été (i) de caractériser la contribution de NPC1L1 et SR-B1 dans l’absorption du cholestérol et d’une vitamine liposoluble, la vitamine E ou tocophérol, tout au long de l’intestin grêle, (ii) d’identifier le rôle de la Pgp dans l’homéostasie des lipides dans l’organisme et enfin (iii) d’évaluer le rôle de la Pgp dans la biodisponibilité de l’ivermectine, un médicament anthelmintique lipophile, lorsqu’elle est administrée dans des formulations lipidiques. Nous avons montré que les cellules Caco-2 sont capables d’absorber le cholestérol et le tocophérol incorporés dans des micelles contenant de l’acide oléique, selon une voie commune, faisant intervenir NPC1L1 et SR-B1. Chez la souris, nous avons montré que le tocophérol est majoritairement absorbé au niveau du jéjunum médial et distal. Nous avons également mis en évidence un rôle spécifique de ces transporteurs en fonction de leur localisation intestinale : NPC1L1 intervient tout au long de l’intestin dans l’absorption du cholestérol et seulement au niveau distal pour le tocophérol. SR-B1 intervient dans l’absorption du cholestérol au niveau distal et dans celle du tocophérol au niveau proximal de l’intestin (Publication 1: Soayfane et al., 2011). Par ailleurs, nous avons mis en évidence un rôle important de la P-glycoprotéine (Pgp) dans le maintien de l’homéostasie des lipides. Les souris déficientes en Pgp développent une obésité associée à des troubles métaboliques (stéatose hépatique, hyperinsulinémie) (Publication 2: Foucaud-Vignault et al., 2011) mais ont aussi une triglycéridémie postprandiale augmentée par rapport aux souris sauvages. Parmi les mécanismes explorés, nous avons montré que les souris déficientes en Pgp avaient une diminution de l’absorption intestinale des lipides et une captation plus importante des lipides par le tissu adipeux (Publication 3: Soayfane et al., en préparation). Enfin, la biodisponibilité de l’ivermectine formulée dans de l’huile ou avec un émulsifiant, le polysorbate 80, a été évaluée. Nous avons montré chez la souris que le polysorbate augmente de façon marquée la biodisponibilité de l’ivermectine via l’inhibition de la Pgp (Publication 4: Soayfane et al., en préparation). En conclusion, nous avons contribué à élucider certains mécanismes qui sous-tendent l’absorption intestinale de différents composés lipidiques. Différents rôles de NPC1L1 et SR-B1 dans l’absorption du cholestérol et du tocophérol ont été établis tout au long de l’intestin. De plus, d’autres transporteurs semblent intervenir dans l’absorption du tocophérol au niveau médial et distal de l’intestin. D’autre part, l’homéostasie des lipides est profondément affectée chez la souris déficiente en Pgp révélant une nouvelle fonction physiologique possible pour la Pgp en relation avec le développement de l’obésité. Enfin, des formulations à base de composés capables d’inhiber la Pgp augmentent la biodisponibilité des médicaments lipophiles dans l’organisme et pourraient contribuer ainsi à améliorer l’efficacité. Ces travaux devraient contribuer à potentialiser l’absorption de composés lipophiles clé de notre alimentation comme les vitamines liposolubles mais aussi certains médicaments lipophiles.
Mots clés : transporteurs, absorption intestinale, NPC1L1, SR-B1, Pgp, cholestérol, triglycéride, vitamine E, ivermectine Abstract
Intestinal absorption of lipids and lipophilic micronutrients involves apical membrane transporters of the enterocyte such as NPC1L1, SR-B1 and CD36. In addition, multidrug ABC transporters such as P-glycoprotein (Pgp) or MRP or BCRP, are involved in effluxing and in limiting the bioavailability of lipophilic xenobiotics including drugs in the body. They can also transport lipids such as cholesterol or phospholipids, suggesting a role of these transporters in the lipid turn-over. The objectives of the thesis were (i) to characterize the contribution of NPC1L1 and SR- B1 in the cholesterol and vitamin E (tocopherol) absorption throughout the small intestine, (ii) to identify the role of Pgp in the lipid homeostasis in the body and (iii) to evaluate the influence of lipid formulations on the Pgp-mediated transport of ivermectin, a lipophilic drug from anthelmintic macrocyclic lactone family. In Caco-2 cells, in the presence of oleic acid, the cholesterol and tocopherol share common uptake pathways through NPC1L1 and SR-B1. In mice, we showed that the absorption of tocopherol occurred in the medial and distal jejunum. Specific roles in the absorption of cholesterol and tocopherol were envisaged for these transporters based on their intestinal localization. NPC1L1-mediated intestinal absorption of cholesterol occurs throughout the small intestine while it takes place in the distal part for tocopherol. SR-B1 is involved in the in distal intestinal absorption of cholesterol and in the proximal intestine for tocopherol (Publication 1: Soayfane et al., 2011). In addition, Pgp-deficient mice developed metabolic disorders and obesity suggesting an important role of this transporter in the maintenance of lipid homeostasis (Publication 2: Foucaud- Vignault et al., 2011). Moreover, a significant decrease in postprandial triglyceride levels was observed in these mice. Indeed, we have shown that Pgp deficiency is associated with a decrease in intestinal fat absorption and increased uptake of lipids by adipose tissue (Publication 3: Soayfane et al., in preparation). Finally, the bioavailability of ivermectin, formulated in oil or in excipient such as polysorbate 80, was determined. We showed that a polysorbate based-formulation enhanced the bioavailability of ivermectin in mice by inhibiting the Pgp (Publication 4: Soayfane et al., in preparation). In conclusion, we have contributed to the understanding of some mechanisms underlying the intestinal absorption of several lipophilic compounds. Specific roles of NPC1L1 and SR-B1 were determined along the intestine in the absorption of cholesterol and tocopherol. In addition, other transporters may be involved in tocopherol absorption in the medial and distal intestine. Moreover, lipid homeostasis is disturbed in the absence of Pgp. An obesity and a decrease in the postprandial triglyceridemia occurred in Pgp-deficient mice. These results could reveal new physiological functions of Pgp. Finally, vehicule-based formulations which are able to inhibit Pgp, should improve the bioavailability and certainly the efficacy of lipophilic drugs. This work should contribute to better understand the mechanisms underlying lipid absorption and will allow to propose strategy to enhance the absorption of key lipophilic compounds such as those contained in our diet or therapeutical agents.
Keywords : Transporters, intestinal absorption, NPC1L1, SR-B1, Pgp, cholesterol, triglyceride, vitamin E, ivermectin Sommaire
Sommaire ...... 1 Liste des figures ...... 5 Liste des Tableaux ...... 7 Liste des abréviations ...... 8 Avant-propos ...... 12 Introduction bibliographique ...... 15 Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles ...... 16 A. L’intestin grêle : organe clé de l’absorption des lipides alimentaires ...... 17 A.1. Morphologie de l’intestin grêle ...... 17 B. Des lipides alimentaires aux micelles ...... 19 B.1. Les lipides alimentaires ...... 20 B.1.1. Les triglycérides ...... 20 B.1.2. Les phospholipides ...... 21 B.1.3. Le cholestérol ...... 22 B.2. Les vitamines liposolubles ...... 23 B.2.1. La vitamine A ...... 23 B.2.2. La vitamine D ...... 24 B.2.3. La vitamine E ...... 24 B.2.4. La vitamine K ...... 25 B.3. Formation des micelles ...... 25 C. Protéines impliquées dans le transport entérocytaire des lipides et des vitamines liposolubles ...... 26 C.1. Captage entérocytaire des acides gras ...... 27 C.1.1. FAT/CD36 ...... 29 C.1.2. FATP4 ...... 30 C.1.3. FABPpm ...... 31 C.1.4. Cavéoline1 ...... 32 C.1.5. FABPs ...... 32 C.2. Transporteurs du cholestérol ...... 34 C.2.1. NPC1L1 ...... 34 C.2.2. SR-B1 ...... 35 1
C.2.3. CD36 ...... 37 C.2.4. SCP2 ...... 37 C.2.5. Transporteurs ABC ...... 38 C.3. Transporteurs des phospholipides ...... 40 C.4. Transporteurs des vitamines liposolubles ...... 41 C.4.1. Transport de la vitamine A ...... 41 C.4.2. Transport de la vitamine D ...... 42 C.4.3. Transport de la vitamine E ...... 42 D. Assemblage des chylomicrons intestinaux ...... 44 D.1. Généralités ...... 44 D.2. Estérification des lipides dans l’entérocyte ...... 44 D.2.1. Estérification des acides gras ...... 45 D.2.2. Estérification du cholestérol ...... 47 D.3. Mécanisme d’assemblage des pré-chylomicrons ...... 48 D.4. Acteurs intervenant dans l’assemblage des chylomicrons ...... 49 D.4.1. ApoB48 ...... 49 D.4.2. MTTP ...... 51 D.4.3. ApoA4 ...... 51 D.5. Sécrétion des chylomicrons par l’entérocyte ...... 52 D.6. Métabolisme des chylomicrons ...... 53 E. Assemblage des HDL intestinales ...... 54 F. Métabolisme hépatique des lipoprotéines ...... 55 F.1. Captation des remnants de chylomicrons ...... 55 F.2. Sécrétion des VLDL ...... 56 F.3. Voie de retour du cholestérol : « Reverse Cholesterol Transport » (RCT) ...... 56 G. Voie d’excrétion du cholestérol : « TransIntestinal Cholesterol Excretion » (TICE)… ...... 57 Chapitre 2 : Absorption intestinale des médicaments lipophiles : exemples des lactones macrocycliques ...... 59 A. Absorption des médicaments lipophiles ...... 59 A.1. Dans la lumière intestinale ...... 59 A.2. Au niveau de l’entérocyte ...... 60
2
B. Interactions des médicaments lipophiles avec les lipoprotéines plasmatiques : exemple des lactones macrocycliques ...... 62 C. Transport intestinal lymphatique des médicaments lipophiles ...... 65 D. Stratégies d’amélioration de l’absorption des médicaments lipophiles ...... 67 D.1. Véhicules lipidiques ...... 67 D.1.1. En postprandial ...... 67 D.1.2. Formulation lipidique ...... 67 D.2. Inhibition des enzymes de métabolisation et des transporteurs d’efflux : rôle des lipides ...... 68 D.2.1. Inhibition des CYP450 ...... 68 D.2.2. Inhibition des transporteurs d’efflux ...... 69 Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des lactones macrocycliques…...... 70 A. P-glycoprotéine ...... 70 A.1. Généralités ...... 70 A.2. Structure de la P-glycoprotéine ...... 71 A.3. Fonctions de la P-glycoprotéine ...... 73 A.4. Substrats de la P-glycoprotéine ...... 73 B. Transporteurs ABC multidrogues et médicaments lipophiles ...... 74 B.1. P-glycoprotéine et lactones macrocycliques ...... 74 B.2. Lactones macrocycliques et autres transporteurs MDR ...... 78 C. P-glycoprotéine et lipides ...... 79 C.1. Pgp et cholestérol ...... 79 C.2. Pgp et sphingolipides ...... 80 D. P-glycoprotéine et désordres métaboliques ...... 80 Objectifs de la thèse ...... 82 Modèles et outils utilisés ...... 85 A. Modèles utilisés ...... 86 A.1. Les souris surexprimant le gène sr-b1 ...... 86 A.2. Les souris invalidées pour les gènes mdr1a et mdr1b ...... 86 A.3. Les cellules Caco-2/TC7 ...... 88 B. Outils utilisés ...... 89 B.1. Les micelles biliaires ...... 89
3
B.2. Les formulations ...... 90 Résultats ...... 92 Publication 1: Contribution de NPC1L1 et SR-B1 dans l’absorption intestinale du cholestérol et du tocophérol : études in vivo versus in vitro ...... 93 Publication 2: La déficience en Pgp contribute à la stéatose hépatique et l’obésité chez la souris ...... 95 Publication 3: La déficience en Pgp diminue la triglycéridémie postprandiale chez la souris ...... 97 Publication 4: Le polysorbate augmente la biodisponibilité de l’ivermectine dans le plasma en inhibant la P-glycoprotéine ...... 98 Discussion générale ...... 100 Perspectives et Conclusions ...... 114 Références ...... 119
4
Liste des figures
Figure 1 : Les différentes étapes d’absorption des lipides alimentaires ...... 17 Figure 2 : Structure de l’épithélium intestinal ...... 19 Figure 3 : Structure shématique d’une molécule de triglycéride, de phospholipide et de cholestérol ...... 20 Figure 4 : Structures chimiques des vitamines liposolubles ...... 23 Figure 5 : Structure schématique d’une micelle mixte ...... 26 Figure 6 : Principales protéines impliquées dans le transport des lipides au niveau du pôle apical de l’entérocyte ...... 27 Figure 7 : Captage entérocytaire des acides gras ...... 29 Figure 8 : Captage entérocytaire du cholestérol ...... 34 Figure 9 : Structure d’un chylomicron ...... 44 Figure 10 : Estérification des acides gras et du cholestérol et acylation des phospholipides .. 45 Figure 11 : Les deux voies métaboliques de synthèse des triacyglycérols ...... 46 Figure 12 : Assemblage intracellulaire des chylomicrons ...... 48 Figure 13 : Représentation schématique de l’apoB100 humaine ...... 50 Figure 14 : Métabolisme des chylomicrons ...... 53 Figure 15 : Formation des HDL intestinales ...... 55 Figure 16 : Solubilisation intestinale des médicaments lipophiles ...... 60 Figure 17 : Localisation entérocytaire des principaux transporteurs d’efflux...... 62 Figure 18 : Distribution de la moxidectine (A) et la nystatine (B) dans les fractions plasmatiques des différentes espèces ...... 65 Figure 19 : Transport des lipides et des médicaments par la lymphe mésentérique ou par le sang portal après une administration orale...... 66 Figure 20 : Représentation schématique de l’efflux des xénobiotiques par les transporteurs ABC ...... 70 Figure 21 : Modèle structural de la Pgp humaine ...... 72 Figure 22 : Fonctions de la P-glycoprotéine ...... 73 Figure 23 : Structure chimique de l’avermectine et la mylbémycine ...... 76 Figure 24 : Inactivation ciblée du gène mdr1a ...... 87 Figure 25 : Inactivation du gène mdr1b dans un chromosome déjà inactivé pour mdr1a ...... 88 Figure 26 : Diminution de la sécrétion intestinale des triglycérides en absence de la Pgp .... 108 5
Figure 27 : Augmentation de la clairance plasmatique des triglycérides en absence de la Pgp ...... 110
6
Liste des Tableaux
Tableau 1 : Distribution des médicaments lipophiles dans les différentes classes de lipoprotéines plasmatiques chez l’Homme ...... 63 Tableau 2 : Transporteurs ABC multidrogues, gènes et protéines ...... 71 Tableau 3 : Quelques substrats transportés par la Pgp ...... 74 Tableau 4 : Relation entre structure, lipophilie et interaction des lactones ...... 77 Tableau 5 : Composition lipidique des micelles utilisées lors de notre étude ...... 89 Tableau 6 : Composition de différentes formulations d’ivermectine utilisées ...... 91 Tableau 7 : Quelques exemples de dyslipémies postprandiales décrites dans la littérature ... 111
7
Liste des abréviations
ABC ATP-Binding Casette ACAT Acyl-CoA Cholesterol Acyl-Transferase ACBP Acyl CoA-Binding Protein ADN Acide désoxyribonucléique ADNc ADN complémentaire AGCC Acide gras à courtes chaînes AGL Acide gras libre AGLC Acide gras à longues chaînes ATGL Adipose triglyceride lipase AMPK AMP-activated protein kinase AGPAT Acyltransférase 1-acyl-glycérol-3-phosphate ApoA4 Apolipoprotéine A4 ApoB Apolipoprotéine B APOBEC ApoB Editing Complex ApoC Apolipoprotéine C ARAT Acyl-coA Retinol Acyl Transferase ASBT Apical Sodium dependant Bile acid Transporter ATP Adénosine triphosphate BBM Brush Border Membrane BCRP Breast Cancer Resistance Protein BLT1 Block Lipid Transport 1 CAR Constitutive Androstane Receptor CERP Cholesterol Efflux Regulatory Protein CETP Cholesteryl Ester Transfer Protein CL Cholestérol libre CM Chylomicrons COPII Protéine d’enveloppe complexe II CRBP Cellular Retinol Binding Protein CT Cholestérol total CYP Cytochromes
8
Cyp7α1 Cholesterol 7α hydrolase DAG Diacylglycérol DGAT DiacylGlycérol Acyl Transférase FABPpm plasma membrane Fatty Acid-Binding Protein FASn Fatty Acid Synthase FAT/CD36 Fatty Acid Transporter/Cluster of Differentiation 36 FATP4 Fatty Acid Transfer Protein Fiaf Fasting-induced adipose factor FVB Friend Virus B-Type GPAT Glycérol-3-Phosphate AcylTransférase GTP Guanosine triphosphate HDL High Density Lipoprotein HDL-C HDL-cholestérol HFD High Fat Diet HL Hepatic lipase HNF4α Hepatic nuclear factor 4α HPLC Chromatographie liquid haute performance HSL Hormone-sensitive lipase IC50 Inhibitory Concentration IDL Intermediate Density Lipoprotein I-FABP Intestinal Fatty Acid Binding Protein IP3 Inositol 1,4,5 triphosphate IVM Ivermectine Ki Constante d’inhibition KO Knock-out LCAT Lecithin Cholesterol Acyl Transferase LDL Low Density Lipoprotein LDL-C LDL-cholestérol LDL-R LDL-Receptor related Protein L-FABP Liver Fatty Acid Binding Protein LMs Lactones macrocycliques LPAAT Acide lysophosphatidique acyltransférase LPDF Fraction déficiente en lipoprotéines
9
L-PL Lysophospholipides LPL Lipoprotéine lipase LRAT Lecithin Retinol Acyl Transferase LRP LDL-Related Protein LXR Liver X Receptor MβCD Methyl-β-cyclodextrine MDR MultiDrug Resistance MG Monoglycérides MGAT MonoacylGlycérol Acyl Tranferase MRP Multidrug Resistance-associated Protein MTTP Microsomal Triglyceride Transfer Protein MXR Mitoxanthrine NBD Nucleotide Binding Protein NBD 22-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-23,24-bisnor-5-cholen-3-ol NP-C Niemann-Pick type C NPC1L1 Niemann-Pick C1 Like1 OATP Organic Anion-Transporting Polypeptide OCT Organic Cation Transporter PA Acide phosphatidique PAP Acide phosphatidique phosphohydrolase PC Phosphatidylcholine PCTV Pre-Chylomicron Transport Vesicles PE Phosphatidyléthanolamine PepT1 Di/tri-Peptide Transporter Pgc-1α PPARγ co-activator 1α Pgp P-glycoprotéine PL Phospholipides PLRP Pancreatic Lipase-Related Protein PLTP Phospholipid Transfer Protein PPAR Peroxisome Proliferator-Activated Receptor pPLA2 Phospholipase A2, Pancreas PS Phosphatidylsérine PTL Pancreatic Triglyceride Lipase
10
PXR Pregnane X Receptor RE Réticulum endoplasmique REG Réticulum endoplasmique granuleux REL Réticulum endoplasmique lisse Scd-1 Stearoyl-CoA desaturase SCP2 Sterol Carrier Protein 2 SNP Single Nucleotide Polymorphism SR-B1 Scavanger Receptor class B type 1 SRE Sterol Response Element SSD Sterol Sensing Domain TG Triglycérides TICE TransIntestinal Cholesterol Excretion TMD Transmembrane domain TNF-α Tumor Necrosis facteur-α VDR Vitamin D nuclear Receptor VLDL Very Low Density Lipoprotein
11
Avant-propos
12
Avant-propos 2011
Le régime alimentaire apporte les nutriments essentiels au fonctionnement énergétique de l’organisme. Il comprend des protéines, glucides, lipides, vitamines, minéraux et des électrolytes.
Les lipides alimentaires tels que le cholestérol, les triglycérides et les phospholipides constituent 35% de la consommation d'énergie quotidienne dont 95% sont constitués de triglycérides. Les lipides ont un rendement énergétique plus important que les glucides (37 joules/g versus 17 joules/g). Ils servent d’élément de base aux synthèses hormonales (cholestérol), de messagers intracellulaires (phospholipides), d’activateurs de la transcription génique (stéroïdes, acides gras) et de cofacteurs enzymatiques. Un excès en lipides peut engendrer des perturbations d’ordre métabolique (obésité, maladies cardiovasculaires, hypercholestérolémie).
Les vitamines sont des nutriments qui n’apportent pas d’énergie mais qui interviennent en faible concentration dans de nombreux processus vitaux. Elles se répartissent en deux groupes : les vitamines liposolubles (A, D, E et K) et les vitamines hydrosolubles. Elles sont apportées par l’alimentation sauf pour la vitamine D qui pourra être synthétisée par l’organisme. Une carence ou en excès de vitamines sont susceptibles de provoquer de graves problèmes de santé.
Comme tous les autres nutriments, les lipides et les vitamines doivent être digérés et absorbés avant de pouvoir être utilisés par l’organisme. La digestion des lipides est sous la dépendance des lipases pancréatiques et des sels biliaires. L’absorption de ces composés nécessite le passage par des structures complexes appelées micelles qui solubilisent les lipides et permettent aussi l’action optimale des enzymes. Ces micelles contiennent des acides gras, des monoglycérides et du cholestérol et peuvent également contenir des vitamines liposolubles. Ces composés lipophiles sont absorbés à partir de leur forme micellaire par les entérocytes et acheminés vers la voie de synthèse des lipoprotéines riches en triglycérides, les chylomicrons dans le réticulum endoplasmique (RE) de la cellule intestinale. Ces chylomicrons jouent un rôle important dans le transport des lipides vers le compartiment sanguin et les tissus tels que le foie, le tissu adipeux et le muscle. Une perturbation de chacune des étapes qui sous tendent l’absorption de ces composés conduit à un taux anormal de lipides et aux des maladies cardiovasculaires et autres désordres métaboliques. 13
Avant-propos 2011
Différentes protéines interviennent lors de l’absorption de ces composés lipidiques au travers de l’entérocyte, qui est un passage actif et non plus seulement un mécanisme passif comme cela était encore décrit il y a une dizaine d’années. Parmi ces protéines, nous citons les transporteurs d’influx des lipides sur la membrane apicale de l’entérocyte tels que NPC1L1, SR-B1, CD36 et FATP4 et les transporteurs d’efflux de la famille « ATP-Binding Cassette » (ABC) apical tels que les P-glycoprotéines et ABCG5/G8 et basal tel que ABCA1. Toute modification dans l’expression de ces transporteurs provoque des perturbations au niveau du processus d’absorption des lipides. Par exemple, la déficience en NPC1L1 ou la surexpression de SR-B1 provoque une altération au niveau de l’absorption du cholestérol (Altmann et al., 2004; Bietrix et al., 2006). Des mutations dans les gènes qui codent pour ABCG5/G8 provoquent une sitostérolémie (Berge et al., 2000). De nombreuses maladies métaboliques sont associées à une perturbation de l’absorption des lipides. La compréhension des mécanismes régulant le métabolisme des lipides permettra de d’appréhender les dysfonctionnements qui leur sont associés et d’améliorer l’absorption de ces composés.
Comme les lipides, les médicaments lipophiles sont également absorbés par l’intestin par des mécanismes impliquant la P-glycoprotéine (Pgp). Les transporteurs de lipides pourraient être aussi impliqués. L’absorption des médicaments lipophiles est aussi augmentée en présence des lipides (Porter et al., 2007). Ainsi, la Pgp et peut-être certains transporteurs de lipides représentent des cibles stratégiques pour améliorer la biodisponibilité et l’efficacité de ces médicaments.
La compréhension du rôle de NPC1L1 et SR-B1 dans l’absorption intestinale des composés lipidiques (cholestérol, vitamine E) tout au long de l’intestin et le rôle de la Pgp dans l’homéostasie des lipides au niveau de l’organisme restent des enjeux majeurs. Le rôle de la Pgp dans l’absorption des lipides et des médicaments lipophiles est encore loin d’être élucidé. C’est à la base de ces constats que cette thèse a été envisagée.
14
Introduction bibliographique
15
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles
Les lipides constituent une source énergétique importante dans l’alimentation occidentale. La plupart des lipides alimentaires ingérés (95%) sont des triglycérides (TG) formés d’acides gras à longues chaînes (AGLC). L’essentiel des autres lipides comprend les phospholipides (PL), le cholestérol (CL), les esters de cholestérol (CE) et les vitamines liposolubles (A, D, K, E). Le cholestérol estérifié et les triglycérides sont des lipides neutres hydrophobes alors que les autres (PL, AGL, CL) sont des lipides amphiphiles qui ont une tête polaire hydrophile et une queue apolaire hydrophobe. L’absorption des lipides alimentaires débute dans la lumière de l’intestin grêle où ils sont hydrolysés par des enzymes digestives pour pouvoir entrer dans la cellule intestinale. Les produits d’hydrolyse des lipides sont ensuite associés aux sels biliaires pour former des micelles mixtes. Sous cette forme micellaire, les lipides pénètrent par la bordure en brosse des entérocytes où ils sont compactés en lipoprotéines riches en TG, les chylomicrons. Ces chylomicrons sont ensuite secrétés dans la lymphe puis dans la circulation sanguine (figure 1). La sécrétion d’une grande quantité de chylomicrons à la suite d’un repas riche en lipides se traduit par une hypertriglycéridémie postprandiale reflétée par une augmentation de la concentration des triglycérides dans la circulation sanguine. Une fois dans la circulation générale, les triglycérides provenant des chylomicrons sont hydrolysés en AGL et en glycérol par l’action lipolytique de la lipoprotéine lipase (LPL) qui est une enzyme située sur la surface des cellules endothéliales qui tapissent les vaisseaux sanguins. Les acides gras ainsi générés par l’hydrolyse des TG sont ensuite captés par les tissus utilisateurs ou de stockage, tels que le foie et le muscle (source d’énergie) et le tissu adipeux (réserve des triglycérides et source d’énergie) (figure 1).
16
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Lumière intestinale Entérocytes Circulation Tissus générale
Lipides alimentaires Foie Circulation Circulation Lipase pancréatique Triglycérides lymphatique sanguine
Sels biliaires
Acides gras Monoglycérides
Monoglycérides
Cholestérol
Chylomicron Cholestérol Ester de cholestérol Tissu adipeux Acides gras
Lyso- Phospholipides phospholipides
Muscle
Lipolyse Transport dans la Compactage des Sécrétion dans Acheminement Transport aux enzymatique cellule intestinale chylomicrons la lymphe dans la circulation tissus par les sanguine lipoprotéines
Figure 1 : Les différentes étapes d’absorption des lipides alimentaires
A. L’intestin grêle : organe clé de l’absorption des lipides alimentaires
L’intestin est le premier organe à faire face aux produits de digestion des lipides alimentaires. Il est considéré comme un acteur important de l’homéostasie énergétique et de ses dérèglements.
A.1. Morphologie de l’intestin grêle
L’intestin grêle débute après le pylore, extrémité distale de l’estomac, et se termine au niveau de la valvule iléo-caecale. Il comprend 3 parties distinctes : le duodénum, le jéjunum et l’iléon et est caractérisé par :
17
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
- une surface d’échange importante avec un renouvellement cellulaire rapide - une orientation selon deux axes : horizontal (gastro-colique) et vertical (cryptovillositaire) - une polarisation des entérocytes : présence de microvillosités au pôle apical des entérocytes - la présence d’une couche d’eau non agitée au niveau apical qui sépare la bordure en brosse des entérocytes de la lumière intestinale. La digestion et l’hydrolyse des lipides alimentaires se déroulent dans le duodénum, le plus court segment de l’intestin, qui reçoit les sels biliaires et les enzymes pancréatiques. L’absorption des lipides alimentaires se déroule dans le jéjunum où l’expression de nombreuses protéines impliquées dans l’absorption des lipides est la plus élevée (Vahouny et al., 1968). L’iléon est le site majeur de réabsorption des sels biliaires. La paroi intestinale est constituée de 4 couches tout au long du tube digestif (figure 2A): - La séreuse, qui est le feuillet viscéral du péritoine - La musculeuse, avec la couche longitudinale externe et la couche circulaire interne de fibres musculaires lisses - La sous-muqueuse conjonctivo-vasculaire. Cette couche est occupée par les glandes de Brunner dans les premiers segments duodénaux et joue un rôle dans la neutralisation du suc pancréatique. - La muqueuse, repose sur la muscularis mucosa et comprend l’épithélium et la lamina propria. L’épithélium s’invagine dans la lamina propria pour former les glandes de Lieberkuhn. Il est en continuité avec l’épithélium superficiel qui dessine des expansions digitiformes intraluminales : les villosités intestinales. La lamina propria est un chorion conjonctivo-vasculaire contenant un réseau de capillaires sanguins et lymphatiques (vaisseaux chylifères) permettant le transfert des nutriments absorbés vers le milieu extérieur. Concernant l’épithélium intestinal, il est constitué de quatre types cellulaires : les entérocytes, les cellules muqueuses caliciformes, les cellules endocrines et les cellules de Paneth (figure 2B). Les entérocytes représentent 80% de la population cellulaire totale. Il s’agit des cellules typiquement orientées vers la fonction d’absorption avec au pôle apical une bordure en brosse constituée par des microvillosités régulièrement disposées en contact de la lumière intestinale. La membrane basolatérale des entérocytes contient l’équipement protéique nécessaire à la sécrétion des nutriments dans la circulation générale. Les cellules caliciformes représentent environ 9% des cellules totales et sécrètent le mucus dont les fonctions sont de protéger l’épithélium intestinal et de faciliter le passage des aliments le long
18
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
de l’intestin. Les cellules endocrines synthétisent des hormones telles que la cholécystokinine- pancréozymine et la sécrétine. Les cellules de Paneth sécrètent le lysozyme (enzyme antibactérienne) et le « Tumor Necrosis Facteur-α » (TNF-α) (réponses inflammatoires).
A Séreuse Musculeuse Sous-muqueuse Muqueuse (épithélium)
Lumière intestinale
Villosité Fragment d’intestin grêle Crypte de Liberkhun B
Entérocytes Cellules Cellules Cellules caliciformes endocrines de Paneth
Figure 2 : Structure de l’épithélium intestinal (Pinto and Clevers, 2005) A : Paroi de l’intestin grêle, B : Différents types cellulaires de l’épithélium intestinal : dans chaque cliché, les cellules d’intérêt sont identifiées (flèches) par un marquage de couleurs rouge/bruns plus intenses par rapport aux autres cellules.
B. Des lipides alimentaires aux micelles
L’intestin grêle reçoit des lipides alimentaires tels que les triglycérides, les phospholipides et le cholestérol. Il reçoit également les vitamines liposolubles (A, D, E et K). Les lipides alimentaires sont hydrolysés dans la lumière intestinale. Leurs produits d’hydrolyse rejoignent les sels biliaires pour former les micelles mixtes. Les vitamines liposolubles peuvent aussi être incorporées à ces micelles.
19
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
B.1. Les lipides alimentaires
3 acides gras + Glycérol 2 acides gras + groupement phosphate
Triglycéride Phospholipide
Cholestérol Figure 3 : Structure shématique d’une molécule de triglycéride, de phospholipide et de cholestérol
B.1.1. Les triglycérides
Les triglycérides sont constitués de trois molécules d’acides gras, principalement des acides gras à longues chaînes (AGLC), estérifiés à une molécule de glycérol (figure 3). Les triglycérides ne peuvent pas traverser les membranes cellulaires à cause de leur hydrophobie et de l’absence de transporteurs connus. Leur absorption est assurée par leur émulsification, leur hydrolyse en acides gras libres (AGL) et en 2-monoglycéride (MG) avant leur incorporation dans des micelles mixtes. L’émulsification des triglycérides (TG) commence dans l’estomac par l’action de la lipase pré-duodénale qui est activée en milieu acide et en absence de sels biliaires (Moreau et al., 1988). Le chyme stomacal, qui reprend les lipides alimentaires et les produits de digestion partielle des TG, déclenche les sécrétions biliaires et pancréatiques dans le duodénum. La lipolyse des TG dans le duodénum se poursuit grâce à l’action de plusieurs lipases (Armand, 2007) : - La lipase pancréatique (ou Pancreatic Triglyceride Lipase, PTL) - Les lipases pancréatiques apparentées 1 et 2 (PLRP1 et PLRP2) qui présentent des similarités de structure avec la PTL avec cependant des différences au niveau des séquences. Ces lipases pancréatiques sont activées en présence d’un cofacteur protéique, la colipase grâce
20
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
à laquelle elles se fixent à l’interface lipides/milieu aqueux, recouvertes de sels biliaires. Elles catalysent la coupure des liaisons esters en position sn-1 et sn-3 des triglycérides en donnant des 2-monoglycérides et des AGL.
B.1.2. Les phospholipides
Les phospholipides sont des glycérides dont les deux premiers alccols de la molécule du glycérol sont estérifiés par deux acides gras et le dernier alcool par un acide phosphorique. Cette structure commune à tous les phospholipides porte le nom d’acide phosphatidique (figure 3). L’acide phosphorique est estérifié dans la plupart des phospholipides par l’alccol d’une choline (phosphatidylcholine, PC), ou d’une éthanolamine (phosphatidyléthanolamine, PE), ou d’une sérine (phosphatidylsérine, PS). Chimiquement, on distingue deux groupes majoritaires de phospholipides au niveau de la membrane cellulaire : les phosphoacylglycérols et les phosphosphingolipides. Les PC, PE et PS appartiennent au groupe des phosphoacylglycérols auxquels s’ajoute la sphingomyéline du groupe des phosphosphingolipides. Les phospholipides sont les principaux constituants des membranes cellulaires (membrane cytoplasmique et membranes des organites intracellulaires). Leur caractère amphiphile leur permettent de s'organiser spontanément en bicouche : les queues hydrophobes s'orientent vers l'intérieur de la bicouche alors que les têtes hydrophiles vers les milieux extra- et intracellulaires aqueux. La phospholipase pancréatique A2 (pPLA2) hydrolyse les phospholipides membranaires en position sn-2 et libère un acide gras, (entre autre l’acide arachidonique) et un lysophospholipide. L’acide arachidonique ainsi libéré, peut être oxydé soit par des cyclooxygénase pour former les prostaglandines, les prostacyclines et les thromboxanes, soit par les lipooxygénases pour former les leucotriènes et les hépoxylines. Les phospholipides sont également hydrolysés par d’autres lipases telles que la phospholipase C qui conduit aux diacylglycérol (DAG) et la phospholipase D qui conduit à l’acide phosphatidique (van den Bosch et al., 1965; Wakelam and Pettitt, 1998; Sakai et al., 2004).
21
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
B.1.3. Le cholestérol
Le cholestérol est un lipide de la famille des stérols et dont dérive les hormones stéroidiennes. Sa structure de base est un noyau stéroïde polycyclique issu de la condensation de quatre cycles carbonés et possédant un alcool secondaire (figure 3). Le cholestérol présent dans l’organisme a une double origine : - Le cholestérol exogène qui provient de l’alimentation et constitue environ 30% du cholestérol total de l’organisme - Le cholestérol endogène qui est synthétisé notamment dans le foie et la muqueuse intestinale (van Heek et al., 2000) Le cholestérol est indispensable à la constitution et la stabilisation des membranes en évitant une fluidité excessive. et donc une trop forte perméabilité à certaines substances. Il intervient dans la production de sels biliaires dont le rôle dans la digestion est essentiel. Le cholestérol permet aussi la synthèse d’hormones stéroïdes telle que l’aldostérone, une hormone intervenant dans le contrôle de la tension artérielle, et d’hormones stéroïdes sexuelles telles que la progestérone et la testostérone. Il est également indispensable à la synthèse de la vitamine D qui permet la fixation du calcium sur les os. Chez l’homme, le régime alimentaire fournit 400 mg de cholestérol par jour alors que le foie en sécrète 1 g par jour (Grundy and Metzger, 1972). La plupart du cholestérol alimentaire se présente sous forme libre, avec seulement 10-15% sous forme d'ester de cholestérol. Environ 50% du cholestérol libre dans l'intestin est absorbé par les entérocytes, le reste est éliminé dans les fèces (Bays, 2002; Clearfield, 2003). L’ester de cholestérol est hydrolysé au niveau du duodénum par la lipase hormono-sensible (HSL). Il s’agit d’une enzyme multifonctionnelle présente dans le tissu adipeux (Grober et al., 1997) et dans l’intestin (Grober et al., 2003) et qui hydrolyse les triacylglycérols, les di-et les monoacylglycérols, les esters de cholestérol et les esters de rétinol (Holm et al., 2000). Le cholestérol libre issu de l’hydrolyse des esters de cholestérol par la HSL, est ensuite absorbé par la cellule intestinale.
22
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
B.2. Les vitamines liposolubles
Les vitamines sont essentielles pour le métabolisme et indispensables pour le bon fonctionnement de l’organisme. Elles sont classifiées en vitamines hydrosolubles et liposolubles. Dans ce chapitre, nous nous focaliserons sur les vitamines liposolubles, des constituants lipidiques provenant de l’alimentation, dont l’absorption intestinale suit celles des lipides. Elles sont au nombre de quatre : les vitamines A, D, E et K (figure 4).
D1 D2 Cycle β-ionone Fonction alcool
Vitamine A Vitamine D
3’ 7’ 11’ K1 K2 Cyclohexynyl + Chaîne carbonée latérale cycle chromane Vitamine E Vitamine K
Figure 4 : Structures chimiques des vitamines liposolubles
B.2.1. La vitamine A
La vitamine A est un alcool à longue chaîne, comportant un noyau ß-ionone et une chaîne linéaire polyinsaturée, terminée par une fonction alcool primaire (figure 4). Elle est impliquée dans plusieurs fonctions majeures de l’organisme telles que la vision, la différenciation cellulaire, la reproduction et la croissance de l’embryon. Elle provient de deux sources : - La provitamine A caroténoide telles que les α- et β-carotènes et la β-cryptoxanthine dans les aliments d’origine végétale - La vitamine A préformée comme les esters de rétinol dans les aliments d’origine animale
23
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Les caroténoïdes sont absorbés par l’entérocyte soit sous leur forme intacte, soit sous forme de rétinol après leur hydrolyse par la caroténoïde monooxygénase dans la lumière intestinale. Concernant les esters de rétinol, ils sont hydrolysés dans la lumière intestinale par la rétinyl ester hydrolase pour libérer le rétinol avant son absorption par les entérocytes.
B.2.2. La vitamine D
La vitamine D (liposoluble) est considérée comme une prohormone plutôt qu’une vitamine. Elle fait partie du groupe des sécostéroïdes, molécules parentes des stéroïdes, dont l'une des liaisons du noyau tétracyclique est rompue. Elle est synthétisée par l'organisme humain à partir d'un dérivé du cholestérol sous l'action des rayonnements ultraviolets de la lumière. Son rôle principal est de maintenir l’homéostasie calcique de l’organisme nécessaire pour le métabolisme osseux. Elle assure aussi le maintien de la fonction neuro-musculaire qui se traduit par une force musculaire correcte, une bonne marche et un bon équilibre. Elle existe sous deux formes (figure 4):
- La vitamine D2 ou ergocalciférol d’origine fongique
- La vitamine D3 ou cholécalciférol d’origine animale La vitamine D3, majoritaire par rapport à la vitamine D2, est synthétisée au niveau de la peau à partir du 7-déhydrocholestérol, puis métabolisée dans le foie en 25-(OH)D3 et dans le rein en 1, 25-(OH)2D3 grâce à l’action du cytochrome CYP27B1. La 1, 25-(OH)2D3 est la forme biologiquement active de la vitamine D et agit au niveau de ses tissus cibles (intestin, rein, et os) en se liant à un récepteur nucléaire spécifique, le récepteur à la vitamine D (« Vitamin D Receptor », VDR). Sa durée de vie est généralement courte suite à l’induction rapide de son propre métabolisme induit par sa liaison au VDR et assuré par le CYP24A1.
B.2.3. La vitamine E
La vitamine E constitue l’une des plus abondants antioxydants liposolubles présents dans le plasma et les cellules somatiques des mammifères supérieurs. La vitamine E a un rôle antioxydant. Elle pourrait ainsi avoir un rôle dans la prévention de l’athérosclérose, en luttant contre l’oxydation des lipoprotéines de basse densité (« Low Density Lipopoprotein », LDL). Par ailleurs, elle inhibe l’agrégation plaquettaire et stimule la production des lymphocytes.
24
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
La vitamine E existe sous huit formes naturelles, quatre tocophérols (α, β, γ, δ) et quatre tocotriénols. La structure chimique des tocophérols se compose d’un cycle chromanol mono-, di- ou trimethyle auquel est rattachée une chaîne carbonée latérale saturée de 16 carbones. Les tocotriénols diffèrent des tocophérols par leur chaîne carbonée qui contient 3 doubles liaisons en position 3’, 7’ et 11’ (figure 4). Seuls les α- et β-tocophérol sont retrouvés en quantités importantes dans l’alimentation, le sang et les tissus. L’α-tocophérol est le composé le plus actif et suit les mêmes voies d’absorption intestinale des acides gras à longues chaînes (AGLC). Le caractère hydrophobe de la vitamine E, comme toute autre vitamine lipophile, crée un défi majeur pour les organismes vivants dans le maintien de son absorption adéquate, son transport et sa distribution dans divers tissus.
B.2.4. La vitamine K
La vitamine K est une vitamine liposoluble apportée par l’alimentation soit d’origine végétale pour la K1 ou phylloquinone soit d’origine bactérienne pour la K2 ou ménaquinone (figure 4). Elle intervient dans la fabrication de facteurs de coagulation sanguine et la fixation du calcium par les os. Les vitamines K1 et K2 alimentaires sont absorbées au niveau de l’intestin grêle proximal car elles nécessitent la présence de sels biliaires et de suc pancréatique.
B.3. Formation des micelles
Les produits d’hydrolyse digestive des triglycérides, des phospholipides et des esters de cholestérol, qui sont les 2-monoglycérides (MG), les acides gras libres (AGL), les lysophospholipides et le cholestérol libre (CL), s’associent avec les phospholipides non hydrolysés, les vitamines liposolubles (A, D, E et K), et les sels biliaires dans la lumière intestinale pour former les micelles mixtes (Hernell et al., 1990; Yao et al., 2002) (figure 5). La formation de micelles mixtes est corrélée à la quantité de sels biliaires dans la lumière intestinale (Ponz de Leon et al., 1981). Sous cette forme micellaire, les vitamines liposolubles et les produits d’hydrolyse des lipides seront capables d’entrer en contact avec la muqueuse intestinale. Leur absorption est dans la plupart des cas médiée par des transporteurs membranaires au niveau de l’entérocyte.
25
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
MG AGL CL
L-PC PC Vitamine
Acide biliaire
Figure 5 : Structure schématique d’une micelle mixte La forme et la taille des micelles mixtes dépendent des concentrations relatives de leurs différents constituants. MG : monoglycéride, AGL : acides gras libres, CL : cholestérol libre, PC : phospholipides, L-PC : lyso-PC
C. Protéines impliquées dans le transport entérocytaire des lipides et des vitamines liposolubles
Dans cette partie, nous allons détailler les principales protéines impliquées dans le transport des lipides et des vitamines liposolubles présents au niveau du pôle apical de l’entérocyte (figure 6). Certains d’entre eux sont impliqués dans le transport, depuis la lumière intestinale vers l’entérocyte, des lipides et des vitamines liposolubles. Ces derniers rejoignent ensuite la voie de synthèse intra-entérocytaire puis la voie de sécrétion des lipoprotéines dans la lymphe puis dans la circulation générale. D’autres transporteurs de la famille ABC (ATP- Binding Cassette), présents au niveau apical ou basolatéral de la cellule intestinale, sont impliqués dans l’efflux des lipides vers la lumière intestinale ou vers la circulation sanguine. Il s’agit des transporteurs ABCA1, ABCG5/G8 et ABCB1.
26
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Lumière intestinale
FATP4
/G8 ABCG5
SR
NPC1
-
B1
CD36
-
L1
Jonction serrée Jonction FABP
Lymphe Circulation sanguine
Figure 6 : Principales protéines impliquées dans le transport des lipides au niveau du pôle apical de l’entérocyte
C.1. Captage entérocytaire des acides gras
Avant de traverser la bordure en brosse de l’entérocyte, les acides gras (AG) doivent franchir une fine barrière aqueuse (50-500 µm d’épaisseur). Il s’agit de la couche d’eau « non agitée » qui est adjacente de la surface luminale de la cellule intestinale (Westergaard and Dietschy, 1976). La présence des sels biliaires facilite le transfert des acides gras vers la bordure en brosse de la cellule intestinale. Par ailleurs, cette couche d’eau non agitée a un pH acide en conséquence de la présence des pompes à protons localisées au niveau de la membrane apicale de l’entérocyte (Shiau et al., 1985; Schoeller et al., 1995). Il s’agit des échangeurs apicaux Na+/H+ (NHE) qui assurent l’absorption sodique et régulent le pH intracellulaire en agissant sur la concentration des ions H+ (Binder et al., 1986). Cinq isoformes de l’échangeur Na+/H+ ont été identifiées (Orlowski et al., 1992). L’expression de trois isoformes (NHE1, NHE2 et NHE3) a été observée dans les cellules épithéliales de côlon distal de rat (Ikuma et al., 1999). NHE1, localisée sur les membranes basolatérales serait responsable de la régulation du pH intracellulaire (Bookstein et al., 1994). Les isoformes de type 2 et 3 sont localisées dans les membranes apicales (Bookstein et al., 1997; Ikuma et al.,
27
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
1999). NHE3 serait responsable à elle seule de 75% de l’absorption sodique, d’après une étude réalisée sur des vésicules de membranes apicales (Ikuma et al., 1999). Le microenvironnement acide créé par les pompes à protons au niveau de la couche d’eau non agitée permet la protonation des acides gras dans les micelles. Ce phénomène conduit à la dissociation des micelles et la libération des acides gras protonés à proximité de la bordure en brosse de la cellule intestinale (Shiau, 1981). L’inhibition de ces pompes conduit à une diminution du transfert des acides gras à travers les membranes de la bordure en brosse, ce qui confirme l’importance de cette couche dans l’absorption intestinale des lipides (Schoeller et al., 1995). Du fait du caractère lipophile des acides gras, l’hypothèse d’une simple diffusion passive à travers la bordure en brosse a longtemps été soutenue (Strauss, 1966). Cependant, l’existence d’un transport saturable des acides gras ainsi que des inhibitions compétitives entre les acides gras a été démontré in vitro, sur le modèle Caco-2 d’entérocytes en culture issues d’un adénocarcinome colique humain (Trotter et al., 1996) et in vivo, au niveau du jéjunum perfusé de rat (Stremmel, 1988). Le transport facilité des acides gras au niveau de la membrane apicale des entérocytes est maintenant bien établi. Quatres protéines candidates ont été proposées comme transporteur appartenant à la famille des « Lipid-Binding Protein » (LBPs). Il s’agit du « Fatty Acid Transporter » (FAT/CD36) (Abumrad et al., 1993), de la « Fatty Acid Transfer Protein 4 » (FATP-4) (Schaffer and Lodish, 1994), de la « plasma membrane Fatty Acid Binding Protein » (FABPpm) (Stremmel et al., 1985) et de la cavéoline-1 (cav1) (Trigatti et al., 1991). D’autres protéines cytoplasmiques semblent impliquées dans le trafic intra-entérocytaire des acides gras, il s’agit des « Intestinal et Liver Fatty Acid-Binding Protein » (I-FABP et L-FABP) (Gordon et al., 1983; Alpers et al., 1984) (figure 7).
28
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
pH=6 Dissociation micellaire Couche d’eau AG non agitée pH≤4.8
Diffusion FAT/CD36 passive FATP4 FABPm pH=7 Cav1 Na+ H+ Jonction serrée
AG L-FABP I-FABP
Entérocyte
Figure 7 : Captage entérocytaire des acides gras
C.1.1. FAT/CD36
Le « Fatty Acid Transporter » (FAT/CD36) est une protéine transmembranaire de 88 kDa qui fait partie des récepteurs « éboueurs » de la famille des « Scavenger Receptors » de la classe B. Ces récepteurs sont constitués de deux segments transmembranaires, un grand domaine extracellulaire contenant une séquence hydrophobe qui forme une boucle ancrée dans la bicouche membranaire, et deux courtes queues cytoplasmiques. La protéine CD36 est située aux niveaux du tissu adipeux (Abumrad et al., 1993), du muscle squelettique, du coeur (Van Nieuwenhoven et al., 1995) et de l’intestin grêle (Poirier et al., 1996). Au niveau de l’intestin grêle, elle est exprimée selon un gradient décroissant allant de l’extrémité proximale vers l’extrémité distale de l’intestin, au niveau du pôle apical de l’entérocyte (Nassir et al., 2007). Elle est également présente au niveau intra-entérocytaire, en parallèle avec d’autres protéines intracellulaires tels que les I-FABP et L-FABP et que son expression intestinale est augmentée en présence des lipides alimentaires (Poirier et al., 1996). Le rôle de CD36 dans la captation des acides gras à longues chaînes (AGLC) a été déjà établi. En effet, la surexpression de CD36 dans le muscle augmente la captation des AGLC et leur oxydation pendant la contraction musculaire (Ibrahimi et al., 1999). Cette oxydation accrue des AGLC suite à l’induction de CD36 est également observée en cas de diabète et des régimes hyperlipidiques (Greenwalt et al., 1995). Dans l’intestin, CD36 est impliquée dans l’absorption des AGLC dans la partie proximale de l’entérocyte où le transporteur est majoritairement exprimé (Nassir et al., 2007; Drover et al., 2008). La
29
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
déficience en CD36 chez la souris soumise à un régime riche en lipides (triglycérides et choelstérol) est associé à une diminution significative du taux d’absorption des AGLC sans aucune altération du taux net de l’absorption intestinale des lipides (Drover et al., 2008). CD36 intervient également dans le processus de sécrétion intestinale des chylomicrons. La déficience en CD36 chez la souris conduit à une hypertriglycéridémie postprandiale accompagnée d’une diminution de la clairance plasmatique des lipoprotéines riches en triglycérides (Drover et al., 2005). De plus, le taux plasmatique des remnants de chylomicrons augmente chez les souris déficientes en CD36 (Masuda et al., 2009). La protéine CD36 est aussi localisée à la membrane du pôle apical des cellules sensorielles de l’épithélium lingual postérieur chez les rongeurs (Laugerette et al., 2005) et chez l’homme (Simons et al., 2010). La déficience en CD36 chez la souris abolit la préférence spontanée des animaux pour des émulsions d’acide linoléique sans modification de leur préférence pour le saccharose (Laugerette et al., 2005). Ainsi, CD36 a été montré comme étant un récepteur dédié à la détection des acides gras dans les cellules gustatives de l’épithélium lingual.
C.1.2. FATP4
Les « Fatty Acid Transport Proteins » (FATPs/solute carrier family 27) sont des protéines transmembranaires de 63 kDa, identifiées aux niveaux du tissu adipeux, du cerveau, du foie, des reins et de l’intestin grêle. Chez l’humain, il y a 6 protéines homologues aux FATPs, les hsFATP numérotés de 1 à 6 (Schaffer, 1996; Stahl et al., 2001; Stahl, 2004). FATP4, une protéine de 71 kDa, est la seule FATP exprimée dans l’intestin grêle au niveau des villosités des entérocytes (Stahl et al., 1999) et dans le réticulum endoplasmique (RE) de ces cellules (Garcia-Martinez et al., 2005) et impliquée dans le transport des acides gras au niveau de la bordure en brosse de l’entérocyte (Stahl et al., 1999). Sur des cultures primaires d’entérocytes, l’utilisation d’oligonucléotides anti-sens contre FATP4 induit une diminution de plus de 50% de la captation des acides gras, alors que sa surexpression montre qu’elle est nécessaire et suffisante pour une captation efficace des AGLC (Stahl et al., 1999). De plus, le traitement à l’ézétimibe, inhibiteur de la voie d’absorption du cholestérol, réduit l’absorption des AGLC. Cette réduction est due en partie à une baisse de l’expression de FATP4 au niveau de l’intestin (Sandoval et al., 2010). L’ensemble de ces résultats démontrent que la FATP4 participe au captage entérocytaire des AGLC.
30
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Cependant, plusieurs études ont montré que cette protéine est majoritairement cytosolique comportant un seul domaine transmembranaire et une courte séquence extracellulaire ne contenant pas un domaine de liaison aux AGLC (Stahl et al., 1999; Gertow et al., 2004). Il a été également admis que la FATP4 est une acyl-CoA synthétase spécifique des membranes plasmique et du RE de l’entérocyte. FATP4 par son activité enzymatique acyle les AGLC en acyl-CoA et favorise leur entrée dans la cellule intestinale (Hall et al., 2005; Milger et al., 2006). La surexpression de FATP4 dans des cellules Cos-1 augmente l’activité acyl-CoA synthétase en présence des AGLC (Herrmann et al., 2001). L’invalidation de cette protéine chez la souris s’est révélée létale dès les stades précoces de l’embryogenèse (Gimeno et al., 2003). L’expression ciblée du transgène FATP4 dans les kératinocytes de souris à l’aide d’un promoteur spécifique de ces cellules a permis de rétablir la viabilité chez ces animaux. Ces souris dont la FATP4 est déficiente au niveau intestinal présentent la même efficacité d’absorption intestinale des lipides alimentaires avec cependant une accumulation de triglycérides au niveau de l’entérocyte en présence d’un régime riche en gras (Shim et al., 2009). Ces données montrent que la FATP4 n’a pas de rôle prépondérent dans le captage entérocytaire des AGLC chez la souris mais est plutôt impliquée dans le traffic intra- entérocytaire des acides gras jusqu’au réticulum endoplasmique grâce à son activité acyl-CoA synthétase.
C.1.3. FABPpm
La « plasma membrane Fatty Acid Binding Protein » (FABPpm) est une protéine de 43 kDa localisée principalement au niveau du coeur, du foie et de l’intestin grêle. Au niveau de l’intestin grêle, elle est présente au niveau des microvillosités et sur les membranes latérales des entérocytes du jéjunum et en moindre quantité dans l’iléon de rat (Stremmel et al., 1985). Elle est majoritairement impliquée dans la captation des acides gras mais peut lier également le cholestérol et les monoglycérides. Des expériences d’incubation des explants de jéjunum avec un anticorps anti-FABPpm montrent une inhibition partielle du captage des acides gras libres par les entérocytes (Stremmel, 1988). Par contre, des transfections de FABPpm au niveau d’ovocytes de xénopes n’altèrent pas le transfert des acides gras (Zhou et al., 1995). Par conséquent, l’ensemble de ces résultats remet en cause le rôle physiologique déterminant de cette protéine, pour laquelle des études plus approfondies
31
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
sur des modèles déficients en FABPpm seront nécessaires pour déterminer l’importance de ce rôle.
C.1.4. Cavéoline1
La cavéoline-1 est une protéine de 22 kDa associée à la cavéoline-2 sous forme d’hétéro-oligomères. C’est une « Lipid-Binding Protein » (LBP) localisée au niveau des invaginations non recouvertes de clathrine de la membrane plasmique, les cavéoles. Elle est aussi présente au niveau du pôle apical des entérocytes (Field et al., 1998). En plus de son rôle primordial dans la biogénèse des cavéoles, la cavéoline est impliquée dans l’adressage des molécules telles que le cholestérol vers leur site de ré- estérification dans l’entérocyte (Conrad et al., 1995) et dans le transport vésiculaire des acides gras au sein de l’hépatocyte (Pohl et al., 2002). En effet, l’inhibition de la formation des cavéoles par des oligonucléotides antisens de la cavéoline-1 réduit le captage de l’acide oléique de 23%. De plus, la transfection de la cavéoline-1 dans les cellules HepG2 montre sa colocalisation avec les cavéoles et l’acide stéarique internalisé (Pohl et al., 2002). Ces résultats soulignent le rôle de la cavéoline dans la captation et le trafic intracellulaire des acides gras à longues chaînes. La cavéoline-1 intervient également dans le stockage des triglycérides puisqu’elle est présente au niveau de la membrane des gouttelettes lipidiques (Pol et al., 2001). La cavéoline joue un rôle important dans l’homéostasie des lipides. En effet, les souris déficientes en cavéoline-1 sont maigres et résistantes à l’obésité induite par un régime gras et présentent une triglycéridémie postprandiale augmentée (Razani et al., 2002).
C.1.5. FABPs
Une fois dans l’entérocyte, les acides gras sont transportés vers les organites par différentes protéines cytosoliques appartenant à la famille des Fatty Acid-Binding Proteins (FABPs). Ce sont des polypeptides de 14-15 kDa liant les AGLC avec une forte affinité. Au niveau de l’intestin grêle, deux FABPs sont exprimés : l’intestinal FABP (I-FABP) et la liver FABP (L-FABP) (Agellon et al., 2002; Besnard et al., 2002; Hanhoff et al., 2002) et constituent environ 2% des protéines solubles (Ockner and Manning, 1974). Ces deux FABPs présentent une distribution intestinale identique : elles sont plus exprimées dans les villosités que dans les cryptes, dans le jéjunum que dans l’iléon, et dans la muqueuse intestinale des
32
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
animaux soumis à un régime hyperlipidique (Ockner and Manning, 1974). Cependant, elles ont des différences quant à leur spécificité de liaison aux composés lipidiques. I-FABP lie fortement les AGLC alors que L-FABP peut lier aussi les lysophospholipides (Bansal et al., 1989). De plus, le transfert des AGLC médié par la I-FABP requiert une interaction collisionelle avec la membrane plasmique alors que celui médié par la L-FABP s’effectue par une diffusion aqueuse. Ceci suggère que la I-FABP pourrait être impliquée dans le transport des AGLC vers le site de ré-estérification. Des modifications dans les propriétés de liaison de la I-FABP peut aboutir à des altérations du processus d’absorption qui pourrait être liées à des altérations dans l’adressage des AGLC vers le réticulum endoplasmique (RE) (Levy et al., 2001). Leur rôle au niveau intestinal n’a pas été clairement établi. Les souris invalidées pour I-FABP ou L-FABP ne présentent pas de variations dans l’absorption des acides gras (Vassileva et al., 2000; Martin et al., 2003). Ceci peut s’expliquer par des possibles compensations de leur fonction par d’autres protéines cytosoliques telles que l’ « Acyl-CoA Binding Protein » (ACBP) et la « Sterol Carrier Protein 2 » (SCP2) (Martin et al., 2003). La déficience de l’une de ces FABPs chez la souris ne modifie pas la quantité de lipides au niveau de l’entérocyte de l’intestin proximal. Cependant, le taux d’acide gras diminue dans l’intestin proximal (Lagakos et al., 2011). Cette diminution de la concentration en acides gras est accompagnée d’une augmentation de l’expression intestinale de CD36, suggérant un rôle compensateur du taux d’acide gras dans la muqueuse. Dans cette même étude, les auteurs ont également montré que les FABPs participent au métabolisme intestinal des lipides en les orientant vers des voies différentes. La L-FABP est impliquée dans le trafic des acides gras par la voie catabolique, la β-oxydation des acides gras, alors que la I-FABP est impliquée dans le trafic des acides gras par la voie anabolique de synthèse des TG (Lagakos et al., 2011). Cependant, l’étude de Newberry et al, menée sur des souris déficientes en L-FABP soumises à une charge lipidique a montré une rétention entérocytaire des triglycérides accompagnée d’une diminution de la sécrétion des lipoprotéines en comparaison avec les souris témoins (Newberry et al., 2006). En accord avec cette étude, Neeli et al, ont montré que la L-FABP est indispensable à la formation des vésicules de transport de pré-chylomicrons du RE vers l’appareil de Golgi (Neeli et al., 2007). L’ensemble de ses données indiquent que les fonctions physiologiques des deux FABPs sont redondantes et nécessitent d’être clairement expliquées.
33
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
C.2. Transporteurs du cholestérol
Comme celle des acides gras, l'absorption du cholestérol a longtemps été considérée comme un processus de diffusion passive, simple et indépendante de l’énergie. Cependant, de nombreuses études ont montré que ce mécanisme d’absorption est facilité par des transporteurs présents sur la bordure en brosse de l’entérocyte. Parmi ces transporteurs, on cite NPC1L1, SR-B1, CD36 et certains transporteurs ABC tels que les transporteurs ABCA1, ABCG5/G8 et ABCB1 (figure 8).
Dissociation CL CL micellaire CL Lumière intestinale
ABCG5 Diffusion NPC1L1 ABCG8 ABCB1 passive SR-B1
CD36 Jonction serrée Jonction
CL
Entérocyte ABCA1
Figure 8 : Captage entérocytaire du cholestérol Adapté de (Iqbal and Hussain, 2009)
C.2.1. NPC1L1
Le « Niemann-Pick C1 Like 1 » (NPC1L1) est une protéine transmembranaire de 151 kDa. Elle a une homologie de 50% avec NPC1, un gène défectueux dans la maladie de « Niemann-Pick type C » (NP-C) associée à un problème de stockage du cholestérol (Carstea et al., 1997; Davies et al., 2000). Cette protéine possède un domaine sensible aux stérols, ou « Sterol Sensing Domain » (SSD), composé de 5 hélices transmembranaires. Quant au promoteur du gène NPC1L1, il comporte un élément de réponse aux stérols ou « Sterol Response Element » (SRE).
34
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
NPC1L1 est exprimée au niveau de l’intestin grêle et du foie. Au niveau de l’intestin grêle, elle est localisée au niveau de la bordure en brosse de l’entérocyte (Iyer et al., 2005) avec un gradient d’expression croissant tout au long de l’axe céphalo-caudal (Altmann et al., 2004; Sane et al., 2006). L'identification de NPC1L1 comme un transporteur principal du cholestérol dans les entérocytes a été mise en évidence chez les souris déficientes en NPC1L1, qui montrent une réduction de l'absorption du cholestérol (Altmann et al., 2004). Son rôle a été également facilité par la découverte de l'inhibiteur de l'absorption du cholestérol, l’ézétimibe (Altmann et al., 2004). Il a été démontré que l'ézétimibe se lie aux cellules surexprimant NPC1L1 et à la bordure en brosse intestinale (Garcia-Calvo et al., 2005). La suppression de NPC1L1 se traduit également par l'élimination de la capacité de liaison de l’ézétimibe à la bordure en brosse (Garcia-Calvo et al., 2005), ce qui indique que NPC1L1 est une cible de l'ézétimibe. Bien que la localisation principale de NPC1L1 a été montrée sur la membrane apicale des entérocytes au niveau de la bordure en brosse (Iyer et al., 2005), sa localisation intracellulaire a été observée dans les cellules d’hépatome humain hepG2 (Davies et al., 2005) et dans le modèle Caco-2, d’entérocytes en culture (Sane et al., 2006). NPC1L1 pourrait alors capter le cholestérol libre au niveau de la membrane plasmique puis, une fois le complexe internalisé par endocytose, il interviendrait dans son transport intracellulaire vers le RE où le cholestérol est estérifié, puis associé aux lipoprotéines naissantes (Field et al., 2007). En effet, l'incubation des cellules Caco-2 avec l'ézétimibe n'a causé qu'une légère diminution de l'absorption du cholestérol micellaire par le côté apical, mais a nettement supprimé son estérification. Skov et ses collaborateurs ont montré qu’en présence du cholestérol, NPC1L1 agit comme un transporteur membranaire internalisé dans un compartiment endosomal, et réduisant ainsi l’absorption du cholestérol (Skov et al., 2011). NPC1L1 est également impliqué dans le transport d’autres stérols, dont les phytostérols. Davis et ses collaborateurs montraient chez la souris déficiente en NPC1L1 que ce récepteur était impliqué dans l’absorption des stérols végétaux, et que son affinité était plus faible pour les phytostérols que pour le cholestérol (Davis et al., 2004).
C.2.2. SR-B1
Le « Scavenger Receptor classe B type 1 » (SR-B1) est une protéine transmembranaire de 82 kDa, de la famille des récepteurs « éboueurs » de classe B. Sa
35
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
structure est comparable à celle de CD36, avec une large boucle extracellulaire, 2 domaines transmembranaires avec des extrémités N et C terminales cytoplasmiques. Acton et ses collaborateurs ont identifié SR-B1 comme le premier récepteur des « High Density Lipoprotein » (HDL) (Acton et al., 1996). Son homologue humain, à 80%, est appelé CLA-1 et issu du gène SCARB1. Principalement localisée dans les tissus stéroïdogènes et le foie, la protéine SR-B1 se retrouve également le long du tractus intestinal, son expression étant alors maximale au niveau de l’intestin proximal (Cai et al., 2001). Elle est également présente avec une moindre intensité au niveau des vésicules d’endocytose, du RE et de l’appareil de Golgi (Levy et al., 2004). Au niveau du foie, SR-B1 a une grande affinité pour les particules HDL (Acton et al., 1996). Elle permet la captation cellulaire du cholestérol libre des HDL et l’efflux de l’ester de cholestérol vers les HDL et a la capacité de se lier à des « Low Density Lipoprotein » (LDL) modifiées (acétylées ou oxydées), aux phospholipides anioniques, aux apolipoprotéines circulantes ou au virus de l’hépatite C. Au niveau de l’intestin, SR-B1 participe à l’absorption du cholestérol alimentaire (Hauser et al., 1998). Les travaux de Bietrix et ses collaborateurs ont montré que la surexpression de SR-B1 chez la souris augmente l’absorption intestinale du cholestérol (Bietrix et al., 2006). Cependant, si les « Scavenger Receptors classe B » (SR-B1 et CD36) favorisent la captation du cholestérol au niveau de la bordure en brosse de l’entérocyte, leur inactivation ne l’altère pas (Mardones et al., 2001; Nguyen et al., 2009). Ceci suggère que l’absorption médiée par SR-B1, à la différence de NPC1L1, n’est pas une étape limitante dans le transport du cholestérol, et qu’il existe des mécanismes de compensation. SR-B1 est aussi impliqué dans l’absorption des triglycérides des HDL in vitro sur des hépatocytes en culture, les HepG2 (Greene et al., 2001) et sur les cellules Cos transfectées par SR-B1 (van Bennekum et al., 2005). Les travaux de Bietrix et ses collaborateurs sont les premiers à mettre en évidence in vivo le rôle de SR-B1 dans l’absorption intestinale des triglycérides et de leurs produits d’hydrolyse (Bietrix et al., 2006). Ce transporteur joue également un rôle important dans le métabolisme des lipoprotéines riches en triglycérides, les chylomicrons et les « Very Low Density Lipoprotein » (VLDL). La déficience en SR-BI chez la souris entraîne une diminution de la production hépatique des (VLDL) (Wiersma et al., 2010). De plus, l’invalidation de SR-B1 dans les cellules Caco-2 diminue la sécrétion de l’apoB100 et l’apoB48 (Hayashi et al., 2011). SR-B1 intervient aussi dans la captation des
36
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
remnants de chylomicrons, facilitant leur internalisation ultérieure par le récepteur au LDL (LDL-R) et par le « LDL-Receptor related Protein » (LRP) (Out et al., 2004).
C.2.3. CD36
En plus de son implication dans la captation et le transport des acides gras (section C.1.1), CD36 a la capacité de se lier à plusieurs ligands tels que les LDL oxydées (Nicholson et al., 1995), les lipoprotéines natives (Calvo et al., 1998) et les phospholipides oxydés (Podrez et al., 2002). Ce transporteur est aussi impliqué dans le transport du cholestérol au niveau des vésicules de membrane de bordure en brosse (« Brush Border Membrane », BBM) préparées à partir d’intestin de souris (van Bennekum et al., 2005). D’autres études ont montré que le transport du cholestérol de la lumière intestinale vers le système lymphatique est significativement réduit chez les souris déficientes en CD36 (Nauli et al., 2006; Nassir et al., 2007). De plus, CD36 est impliquée dans l’absorption du cholestérol au niveau de l’intestin proximal, où le transporteur est majoritairement exprimé (Nassir et al., 2007). Toutefois, comme pour SR-BI, l’absorption du cholestérol n’est que partiellement diminuée dans l’intestin proximal des souris déficientes en CD36, en SR-BI ou pour ces deux récepteurs. L’action de ces deux scavengers récepteurs dans l’absorption intestinale du cholestérol reste donc modérée.
C.2.4. SCP2
Le « Sterol Carrier Protein 2 » (SCP2) est une protéine soluble impliquée dans le trafic intracellulaire des acides gras et du cholestérol. Sa localisation intracellulaire est un sujet de controverse. Certains ont rapporté la présence de la protéine dans les peroxysomes alors que d'autres l’ont rapporté dans le cytosol. Son rôle dans le transport intracellulaire des lipides a été proposé dans différentes études. En effet, elle lie le cholestérol et stimule son transfert entre les organelles (Chanderbhan et al., 1982) ainsi que sa conversion en ester de cholestérol (Murphy and Schroeder, 1997). Cependant, SCP2 montre une affinité pour les acides gras et les « Fatty Acyl CoA » plus importante que celle du cholestérol (Frolov et al., 1996; Stolowich et al., 1997).
37
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Le transport intracellulaire du cholestérol par SCP2 a été mis en évidence par Puglielli et al, qui ont montré, en utilisant des oligonucléotides antisens sur des fibroblastes en culture, que cette protéine augmente le transport du cholestérol nouvellement synthétisé du RE vers la membrane plasmique (Puglielli et al., 1995). De plus, la surexpression de scp2 dans les cellules d’hépatome de rat augmente le contenu de la membrane plasmique en cholestérol et diminue l’estérification du cholestérol et la production des HDL (Baum et al., 1997). Son rôle in vivo a été également recherché. En effet, la surexpression de SCP2 chez la souris montre une diminution du cholestérol des HDL, une augmentation du cholestérol des LDL et du cholestérol libre dans le foie ainsi qu’une diminution de sa synthèse endogène (Zanlungo et al., 2000). De plus, la sécrétion biliaire des acides biliaires, des phospholipides et du cholestérol est augmenté chez les souris surexprimant scp2 (Amigo et al., 2003). Ces données montrent que SCP2 stimule la circulation entérohépatique du cholestérol et des acides biliaires.
C.2.5. Transporteurs ABC
Des transporteurs de la famille « ATP-Binding Cassette » (ABC) tels que ABCA1, ABCG5/G8, ABCB1 peuvent transporter, en hydrolysant l’ATP, de multiples substrats, et notamment des lipides au travers la membrane plasmique.
ABCA1 L’ « ATP-Binding Cassette A1 » (ABCA1), connue comme une protéine régulatrice de l’efflux du cholestérol (CERP), est une protéine de 220 kDa exprimée dans plusieurs tissus notamment le foie, les macrophages, le cerveau et l’intestin grêle (Dean et al., 2001). Chez les humains, elle est codée par le gène ABCA1 (Luciani et al., 1994). Il a été montré par plusieurs groupes en 1999 que la mutation génétique de l’ABCA1 est responsable de la maladie de Tangier, caractérisée par une forte réduction du taux des HDL plasmatiques (Bodzioch et al., 1999; Brooks-Wilson et al., 1999; Lawn et al., 1999). Au niveau intestinal, le transporteur ABCA1 participe à l’efflux du cholestérol, des phospholipides et d’autres molécules lipophiles à travers la membrane cellulaire pour les lier à l’apolipoprotéine A1 et permettre la formation des HDL intestinaux (Mulligan et al., 2003; Oram and Heinecke, 2005), mais sa contribution majeure au niveau des pôles de l’entérocyte (apical ou basolatéral) a longtemps été l’objet d’investigation. Grâce à diverses études, il est
38
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
maintenant établi que le transporteur ABCA1 régule l’efflux de cholestérol intestinal au niveau de la membrane basolatérale des entérocytes de poulet (Mulligan et al., 2003), de souris et des cellules Caco-2 (Ohama et al., 2002; Iqbal et al., 2003) par une voie indépendante de l’apoB (Iqbal et al., 2003; Iqbal and Hussain, 2005), et permet la formation des HDL intestinales qui rejoignent directement la circulation sanguine dans la veine porte (Mulligan et al., 2003; Iqbal and Hussain, 2009). L'importance du transporteur ABCA1 dans la biogenèse des HDL dans l'intestin a été mise en évidence lors de la suppression de son expression intestinale. Brunham et ses collaborateurs ont montré que le cholestérol des HDL est diminué de 30% dans le plasma en l’absence de l’ABCA1 (Brunham et al., 2006). Cette étude avec plusieurs autres ont montré que le cholestérol des HDL est aussi présent dans la lymphe mésentérique indépendamment de l’ABCA1 (Sipahi et al., 1989; Vasconcelos et al., 1989; Oliveira et al., 1993). Cependant, la quantification du cholestérol des HDL dans la lymphe ne peut pas fournir une évaluation précise de l'importance de cette voie du fait des autres sources de production.
ABCG5/G8 Deux autres transporteurs ABC, ABCG5 et ABCG8, principalement localisés sur la membrane apicale des cellules intestinales et sur la membrane caniculaire des hépatocytes, fonctionnent en hétérodimères (Graf et al., 2002), et interviennent dans le contrôle de l’homéostasie des stérols totaux de l’organisme. Ces deux protéines limitent l’absorption des stérols issus des plantes en les sécrétant de l’épithélium intestinal vers la lumière et en favorisant la sécrétion des stérols et du cholestérol hépatique dans la bile (Hui and Howles, 2005; Orlowski et al., 2007). Le gène de l’un ou l’autre est défectueux dans la β- sitostérolémie (ou phytostérolémie). Cette déficience en ABCG5/G8 entraîne des troubles du métabolisme lipidique qui sont associés à une diminution de la synthèse du cholestérol endogène et à une hypercholestérolémie qui peut conduire à une athérosclérose coronaire et aortique prématurée (Stefkova et al., 2004). La déficience en ABCG5/G8 chez la souris se traduit par une une diminution de la sécrétion biliaire du cholestérol (Yu et al., 2002) et une augmentation de l’absorption intestinale des phytostérols (Klett et al., 2004; Plosch et al., 2004), avec un effet mineur sur l’absorption du cholestérol (Yu et al., 2002; Plosch et al., 2004). L’induction physiologique ou la surexpression des ABCG5 et ABCG8 chez la souris provoque une réduction de l’absorption intestinale du cholestérol (Yu et al., 2002; Yu et al.,
39
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
2003). Ceci prouve clairement le rôle important de ces transporteurs dans le contrôle de l’absorption entérocytaire du cholestérol.
ABCB1 Appelé aussi P-glycoprotéine (Pgp), l’ABCB1 est une glycophosphoprotéine de 170 kDa fortement exprimée dans les cellules cancéreuses et dans de nombreux tissus tels que le foie, l’intestin et la barrière hémato-encéphalique. Elle appartient à la famille des transporteurs « MultiDrug Resistance » (MDR) qui confère aux cellules cancéreuses la résistance aux médicaments (Dano, 1973). Principalement considérée comme un transporteur d’efflux des xénobiotiques et des médicaments, la Pgp est également impliquée dans le transport du cholestérol. L’activité ATPasique de la Pgp reconstruite dans des protéoliposomes est augmentée en présence du cholestérol (Shapiro and Ling, 1994). Cette activité est inhibée dans les membranes qui surexpriment la Pgp et traitées par la « methyl-β-cyclodextrine » (MβCD) qui extrait le cholestérol des membranes (Garrigues et al., 2002). Par ailleurs, le flux du cholestérol de la membrane plasmique vers le RE est diminué en présence des inhibiteurs de la Pgp (Metherall et al., 1996). De plus, les cellules transfectées avec la Pgp absorbent mieux le cholestérol que les cellules témoins (Tessner and Stenson, 2000).
C.3. Transporteurs des phospholipides
Le transport des phospholipides au niveau intestinal fait intervenir certains transporteurs de la famille ABC. Le transporteur ABCA1, en plus de son rôle dans l’efflux du cholestérol des entérocytes vers les lipoprotéines, transfère aussi des lipides polaires dont les sphingolipides, vers l’apoA1 (Barter et al., 2003; Knight, 2004; Yokoyama, 2005). Certains auteurs ont montré qu’il est présent au niveau de la membrane de Golgi des cellules épithéliales et transporte les phospholipides vers la membrane plasmique (Orso et al., 2000). La Pgp joue un rôle important dans le transport des phospholipides notamment les céramides et les sphingolipides (voir chapitre 3).
40
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
C.4. Transporteurs des vitamines liposolubles
Les vitamines sont des compléments indispensables aux échanges vitaux. Comme les lipides, les vitamines doivent être apportées régulièrement et en quantité suffisante par l’alimentation. Un apport excessif de vitamines liposolubles (A et D essentiellement) provoque une hypervitaminose, très toxique pour l'organisme. De la même façon, une carence en vitamines liposolubles provoquent une hypovitaminose qui est la cause de diverses maladies tels que les troubles de la vision (carence en vitamine A), le rachitisme (carence en vitamine D), stérilité et anémie hémolytique (carence en vitamine E). Le transport intestinal des vitamines liposolubles fait intervenir certains transporteurs de lipides.
C.4.1. Transport de la vitamine A
L’homéostasie de la vitamine A est finement régulée par de nombreuses protéines de transport qui vont permettrent la transformation de cette vitamine soit vers la forme de stockage (ester de rétinol) dans le foie, soit vers le composé actif (rétinol). Les transporteurs impliqués dans la captation intestinale du rétinol ne sont pas encore définis. Cependant, une fois dans l’entérocyte, le rétinol est immédiatement séquestré par une liaison à des protéines de transport cytosoliques dites « Cellular Retinol Binding Protein », CRBP-I et II (Napoli, 1999; Noy, 2000). La première est exprimée dans de nombreux tissus, tandis que la seconde est principalement exprimée dans les entérocytes. Dans les études menées sur les cellules Caco-2, la surexpression de CRBP-II ou son induction par l'acide rétinoïque augmente l’absorption cellulaire et l'estérification du rétinol (Rajan et al., 1991). La plupart des rétinols est généralement estérifiée et stockée. Dans les entérocytes, deux enzymes, la « Lecithin Retinol Acyl Transferase » (LRAT) et l’ « Acyl-CoA Retinol Acyl Transferase » (ARAT) peuvent catalyser l'estérification du rétinol libre in vitro (Helgerud et al., 1982). Il a été suggéré que l’ester de rétinol peut suivre la voie de sécrétion et du stockage dans les chylomicrons (Blomhoff et al., 1991). Contrairement aux triglycérides, aux esters de cholestérol et autres lipides, les esters de rétinol ne sont pas présents dans d'autres lipoprotéines comme les lipoprotéines de densité intermédiaire, les lipoprotéines de basse densité, ou les lipoprotéines de haute densité (Levin, 1993).
41
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
C.4.2. Transport de la vitamine D
Il a été longtemps considéré que la vitamine D, comme tous les autres micronutriments liposolubles, est absorbée par un processus passif (Hollander et al., 1978; Hollander, 1981). Très récemment, il a été montré que l’absorption intestinale du cholécalciférol, la forme active de la vitamine D et présentant une structure chimique proche de celle du cholestérol, est protéine-dépendant faisant intervenir les mêmes transporteurs du cholestérol dont SR-B1, NPC1L1 et CD36 (Reboul et al., 2011). L’inhibition chimique de SR-B1 et NPC1L1 réduit l’absorption du cholécalciférol dans les cellules Caco-2 de 50 et 30%, respectivement. Cette réduction a été également montrée dans la même étude in vivo chez les souris traitées par les inhibiteurs chimiques de SR-B1, NPC1L1 et CD36. De plus, le contenu intestinal du cholécalciférol est plus important chez les souris surexprimant SR-B1 dans le duodénum et le jéjunum proximal, alors qu’il est moins important dans le jéjunum médian et distal des souris traitées à l’ézétimibe (Reboul et al., 2011). L’ensemble de ces résultats montre que SR-B1, NPC1L1 et CD36 jouent un rôle important dans l’absorption intestinale de la vitamine D.
C.4.3. Transport de la vitamine E
L’absorption intestinale de la vitamine E, appelée aussi l’α-tocophérol, de la lumière intestinale vers l’entérocyte, comme celle du cholestérol et des acides gras, a longtemps été considérée comme un simple processus de diffusion passive. Des travaux antérieurs avaient indiqué que SR-B1 est impliqué dans la captation de la vitamine E par les tissus extra-intestinaux (Goti et al., 2001; Mardones et al., 2002). Les travaux de Reboul et ses collaborateurs amènent à une meilleure compréhension de la signification physiologique du rôle de SR-B1 dans le transport de la vitamine E. Premièrement, l’inhibition chimique de SR-B1 par « Block Lipid Transport 1 » (BLT1) ou encore l’addition d’un anitcorps anti-SRB1 dans le milieu apical des cellules Caco-2 diminue significativement l’absorption de la vitamine E. De plus, la biodisponibilité de l’α-tocophérol est de 3 fois plus importante chez les souris surexprimant SR-B1 par rapport aux animaux témoins (Reboul et al., 2006). En plus de son rôle dans l’absorption des stérols, le transporteur NPC1L1 est impliqué dans l’absorption de l’α-tocophérol par les entérocytes (Narushima et al., 2008). L’α- tocophérol est plus absorbé dans les cellules Caco-2 qui surexpriment NPC1L1 en
42
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
comparaison avec les cellules témoins. Le traitement à l’ézétimibe diminue fortement son absorption. L’ensemble de ces résultats met en évidence le rôle de NPC1L1 dans l’absorption intestinale de la vitamine E. Les mécanismes impliqués dans le trafic intracellulaire, l’assemblage et/ou l’efflux de la vitamine E dans les lipoprotéines intestinales n’ont pas été bien établis. Toutefois, les données biochimiques ont suggéré que le trafic intracellulaire de la vitamine E est fonctionnellement lié à son incorporation dans les chylomicrons mais également dans les HDL intestinales au niveau basolatéral de l’entérocyte par l’intermédiaire du transporteur d’efflux ABCA1 (Anwar et al., 2006). Conformément à l'importance de la voie des chylomicrons, l'absorption de la vitamine E dépend de la disponibilité en acide oléique pour la synthèse des triglycérides et l'assemblage des chylomicrons. Son absorption est inhibée par les antagonistes de la « Microsomal Triglyceride Transfert Protein » (MTTP) qui est impliquée dans la voie de synthèse des chylomicrons. Il a été montré que des mutations dans le gène de la MTTP provoquent une abêtalipoprotéinémie. Cette pathologie est caractérisée par une malabsorption des lipides provoquant une diminution du cholestérol et des triglycérides plasmatiques et une déficience en vitamines liposolubles notamment en vitamine E (Chardon et al., 2009). Un traitement avec la vitamine E pourrait prévenir de l’abêtalipoprotéinémie (Runge et al., 1986). En effet, la carence en vitamine E chez les patients abêtalipoprotéinémiques augmente la peroxydation des lipides membranaires dans la rétine et la destruction oxydative de la vitamine (Hayes, 1974). La supplémentation de la vitamine E à des doses importantes atténue significativement les lésions rétinales et neurologiques (Runge et al., 1986). Par ailleurs, la sécrétion de la vitamine E est stimulée par l'addition des HDL exogènes au pôle basolatéral des cellules Caco-2 (Anwar et al., 2006). Ces résultats sont comparables à ceux réalisés avec du cholestérol dont la sécrétion intestinale vers les HDL dans la circulation se fait via ABCA1 (Iqbal et al., 2003; Brunham et al., 2006). Ces éléments sont en faveur d’une absorption intestinale de la vitamine E via les deux voies principales d’absorption connues pour le cholestérol : par les chylomicrons via la lymphe ou par les HDL via la circulation portale (sections D et E).
43
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
D. Assemblage des chylomicrons intestinaux
D.1. Généralités
Les entérocytes ont la capacité d’assembler et de sécréter deux types de lipoprotéines : les chylomicrons et les lipoprotéines de haute densité (HDL). Les chylomicrons sont les plus grosses lipoprotéines circulantes dont le coeur hydrophobe est constitué principalement d’ester de cholestérol et de triglycérides reformés. A leur périphérie, ces lipoprotéines sont constituées de lipides polaires (phospholipides et cholestérol libre) et d’apolipoprotéines dont la principale est l’apolipoprotéine B48 (apoB48) (figure 9). Chez l’homme, l’apoB48 est exclusivement produite dans les entérocytes (Kane, 1983; Cladaras et al., 1986).
Apolipoprotéines
Phospholipides Cholestérol Triglycérides et ester de cholestérol
Figure 9 : Structure d’un chylomicron
D.2. Estérification des lipides dans l’entérocyte
Une fois dans l’entérocyte, les acides gras sont éstérifiés séquentiellement dans le RE par la monoacylglycérol acyltransférase (MGAT) et la diacylglycérol acyltransférase (DGAT) pour former les triglycerides appelés aussi les triacylglycérols (TAG). En ce qui concerne les phospholipides, ils sont acylés par des acyltransférase 1-acyl-glycérol-3-phosphate (AGPAT) pour former l'acide phosphatidique (PA), qui est aussi transformé en TAG. Le cholestérol libre (CL) est estérifié par l'acyl-CoA cholestérol acyltransférase (ACAT) en esters de cholestérol (CE) (figure 10).
44
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Figure 10 : Estérification des acides gras et du cholestérol et acylation des phospholipides (Tso and Liu, 2004)
D.2.1. Estérification des acides gras
Dans l’entérocyte, les AGLC sont activés en acyl-CoA par les « long chain acyl-CoA synthetases » (Tanaka et al., 1979). Les acyl-CoA peuvent suivre deux voies métaboliques différentes dans l’entérocyte : l’estérification dans le RE et l’oxydation dans les mitochondries. En période post-prandiale, les acyl-CoA sont préférentiellement orientés vers la voie d’estérification et permettent la synthèse des TG et des phospholipides. Dans l’entérocyte, il existe deux voies pour la synthèse des TG : celle des 2-monoacylglycérol et celle de l’α-glycérophosphate (figure 11). Pendant la période post-prandiale, la voie des 2- monoacylglycérol qui est spécifique à l’intestin est prépondérante, alors que durant les périodes interprandiales et de jeûne, la voie de l’α-glycérophosphate, qui est également trouvée dans le foie, est majoritaire. La voie du 2-monoacylglycérol conduit à la ré-estérification des monoglycérides (MG) en présence d’acyl-CoA sous l’action de deux enzymes : la monoacylglycérol-acyltransférase (MGAT) (Cao et al., 2003) puis la diacylglycérol-acyltransférase (DGAT), qui forment respectivement des 1,2- diglycérides et des TG. L’autre voie impliquée dans la synthèse des TG est la voie de l’α-glycérophosphate qui utilise l’α-glycérophosphate comme accepteur d’acyl-CoA pour former de l’acide phosphatidique via la glycérophosphate acyltransférase (GPAT). Sous l’action de l’acide phosphatidique phosphohydrolase (PAP), il y a formation de 1,2-diacylglycérol qui est ensuite estérifié soit par la DGAT en TG soit par la phosphocholine diacylglycérol-acyltransférase en phospholipides.
45
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Figure 11 : Les deux voies métaboliques de synthèse des triacyglycérols (Shim et al., 2009) MGAT : monoacylglycérol acyltranférase ; DGAT : Diacylglycérol acyltransférase ; GPAT : glycérol-3-phosphate acyltransférase ; LPAAT : acide lysophosphatidique acyltransférase ; PAP : acide phosphatidique phosphorylase
MGAT Les MGAT facilitent l’incorporation des acides gras insaturés dans les triglycérides. A ce jour, trois MGAT ont été identifiées chez les mammifères : MGAT1, MGAT2 et MGAT3 (Cao et al., 2003). Chez l’Homme, la MGAT1 est exprimée dans le foie et les reins (Yen et al., 2002). La MGAT2 est abondante dans le foie, l’intestin, le côlon, l’estomac et les reins (Cao et al., 2003; Yen and Farese, 2003). Au niveau intestinal, la MGAT2 est plus exprimée dans le jéjunum et son expression diminue dans l’iléon (Cao et al., 2004). Par ailleurs, il a été montré qu’un régime riche en lipides induit une augmentation de l’expression intestinale et de l’activité de la MGAT2 (Cao et al., 2004). La MGAT3 est exprimée dans la partie distale de l’intestin et catalyse la synthèse des diacyglycérols à patir des monoacylglycérols. De plus, elle possède une activité diacylglycérol acyltransférase ayant une forte homologie de séquence avec la DGAT2 (Cao et al., 2007).
46
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
DGAT Actuellement, deux gènes codant pour cette enzyme ont été identifiés au niveau de l’intestin, le foie et le tissu adipeux : la DGAT1 et la DGAT2 (Cases et al., 1998; Oelkers et al., 1998; Farese et al., 2000). La DGAT1 possèdent des homologies de séquence avec les acyl-CoA : cholestérol acyltransférases 1 et 2 (ACAT1 et ACAT2), enzymes impliquées dans la biosynthèse des esters de cholestérol. La DGAT2 appartient à la famille comprenant les MGAT1 et 2. Au niveau intestinal, les deux DGAT sont majoritairement exprimées dans l’entérocyte proximal. Elles catalysent la synthèse des triacylglycérol en utilisant comme substrat les diacylglycérols ou les monoacylglycérols et l’acylcoenzyme A et diffèrent par leur propriétés catalytiques (Cao et al., 2007; Cheng et al., 2008), leur localisation cellulaire (Stone et al., 2009) et leur régulation physiologique (Meegalla et al., 2002). Les produits enzymatiques majeurs catalysés par la DGAT2 sont les triacylglycérols alors que ceux catalysés par la DGAT1 dépendent de la concentration des monoacyglycérols. La surexpression de la DGAT1 entraîne une accumulation des petites gouttelettes lipidiques dans la périphérie de la cellule alors que la surexpression de la DGAT2 entraîne une augmentation des larges gouttelettes lipidiques dans le cytosol de la cellule hépatocytaire (Stone et al., 2004). Par ailleurs, l’invalidation de la DGAT1 chez la souris conduit à une faible sécrétion de chylomicrons suite à une surcharge en lipides (Buhman et al., 2002).
D.2.2. Estérification du cholestérol
Environ deux tiers du cholestérol entrant dans le système lymphatique via les lipoprotéines intestinales sont estérifiés démontrant que l’estérification du cholestérol est une étape essentielle dans le processus d’absorption du cholestérol. Elle est réalisée sous l’action de l’ « Acyl-CoA Cholesterol Acyl-Transferase 2 » ou ACAT2 (Temel et al., 2007). L’expression de l’ACAT2 est limitée à l’intestin grêle et au foie (Anderson et al., 1998; Cases et al., 1998) contrairement à son homologue, l’ACAT1, dont la répartition est ubiquitaire (Chang et al., 1993). Par ailleurs, la liaison entre l’ACAT2 et le cholestérol est très spécifique car même les phytostérols, dont la structure est proche de celle du cholestérol, ne seraient pas (Field and Mathur, 1983; Field et al., 1997) ou très peu (Temel et al., 2003) estérifiés par l’ACAT2. Les souris déficientes en ACAT2 sous régime riche en cholestérol, montrent un taux d’absorption du cholestérol considérablement réduit (Buhman et al., 2000). Ces résultats montrent que l’absorption du cholestérol est stimulée par la présence de l’ACAT2 qui est
47
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
nécessaire pour la voie de synthèse des chylomicrons, la voie majoritaire d’absorption du cholestérol au niveau de l’intestin.
D.3. Mécanisme d’assemblage des pré-chylomicrons
FATP4
/G8 ABCG5
SR
NPC1
-
B1
-
L1 CD36
MG + AG
C DGAT-1
ACAT-2 PL TG MTTP C CE
C CE MTTP TG PL Pré-chylomicron RE
C CE apoB48 vésicule TG COPII PL
C CE Golgi TG PL
C CE TG PL chylomicron
Lymphe
Figure 12 : Assemblage intracellulaire des chylomicrons (Levy et al., 2007) ACAT2 : acylCoA:cholestérol-acyltransférase, AG : acides gras, C : cholestérol, DGAT1 : diacylglycérol-acyltransférase1, CE : esters de cholestérol, MG : monoglycérides, MTTP : microsomal triglycerides transfer protein, PL : phospholipides, TG : triglycérides, RE : réticulum endoplasmique
La formation des chylomicrons débute au niveau du RE avec l’assemblage des pré- chylomicrons. Ensuite, ces particules sont transférées vers l’appareil de Golgi pour leur maturation, avant leur sécrétion dans la lymphe. L’équipe de Hussain a montré qu’il existe
48
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
deux voies distinctes d’assemblage et de sécrétion des lipoprotéines intestinales (Iqbal et al., 2003; Iqbal and Hussain, 2005) : - la voie apoB-dépendante qui correspond à la production des chylomicrons - la voie apoB-indépendante qui met en jeu l’apoA1 et conduit à la biogenèse des HDL intestinales. Le processus de synthèse des pré-chylomicrons peut être divisé en trois étapes (Hussain et al., 2005) (figure 12): - Assemblage de la lipoprotéine primaire - Formation des gouttelettes lipidiques riches en triglycérides et en esters de cholestérol - Fusion de la lipoprotéine primaire avec les gouttelettes lipidiques La biosynthèse des chylomicrons débute dans le réticulum endoplasmique granuleux (REG) en période postprandiale sous la dépendance de l’apoB48 et de protéines chaperonnes, telles que la « Microsomal Triglyceride Transfer Protein » (MTTP) (Hussain et al., 2003).
Lors de la 1ère étape, la formation des lipoprotéines primaires nécessite la présence de la MTTP qui catalyse le transfert de lipides (essentiellement des PL, des CE et des TG) de la membrane du réticulum endoplasmique lisse (REL) vers l’apoB48 nouvellement synthétisée.
Au cours de la 2ème étape, des gouttelettes lipidiques riches en triglycérides et en ester de cholestérol se forment dans la lumière du REL indépendamment de la présence d’apoB48. Ces gouttelettes s’enrichissent en lipides en fonction des apports alimentaires, ce qui détermine ensuite la taille des lipoprotéines produites (Hussain, 2000; Hussain et al., 2001). La 3ème étape se caractérise par l’expansion du coeur lipidique des lipoprotéines primaires grâce à la fusion de ces dernières avec les gouttelettes lipidiques, ce qui aboutit à la formation de lipoprotéines de basse densité, pouvant correspondre à des « Very Low Density lipoprotein » de densités comparables aux VLDL d’origine hépatique ou à des chylomicrons de petites et de grandes tailles (Hussain, 2000).
D.4. Acteurs intervenant dans l’assemblage des chylomicrons
D.4.1. ApoB48
L'apolipoprotéine B (apoB) est l’apolipoprotéine structurale retrouvée associée aux lipoprotéines plasmatiques. Dans le génome humain, il existe un seul gène apoB (45 kb). L’apolipoprotéine B existe sous deux formes, l’apoB100 et l’apoB48. L’apoB100, la forme
49
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
hépatique, est une grosse protéine (515 kDa), dont la structure est composée d'une série de domaines organisés: NH2 / hélice α1 / feuillet β1 / hélice α2 / feuillet β2 / hélice α3 / COOH. L’apoB48, la forme intestinale (250 kDa), ne comprend que les domaines βα1 (acides amines 1 a 1000) et α1 (acides aminés 827 a 2001) et ne possède que 2152 acides aminés (Segrest et al., 2001) (figure 13). La protéine apoB48 est traduite à partir de l’ARNm de l’apoB100 et sa synthèse est le résultat d’une maturation post-transcriptionnelle très originale appelée « édition de l’ARN » ou «editing». Dans l’intestin, la substitution d’une cytosine par une uracile en position 6666 du transcrit de l’apoB100 change le codon CAA de la glutamine en codon stop (UAA), provoquant l’arrêt de la traduction en position 2153. Dans l’édition de l’ARNm de l’apoB au niveau intestinal, la protéine « ApoB Editing Complex » (APOBEC) qui est une cytidine déaminase est l’élément central de l’édition et fonctionne au sein d’un complexe multiprotéique, appelé éditosome. L’APOBEC se lie sur la séquence cible riche en AU (adénine, uracile) et contenant la séquence d’amarrage qui est une cytidine placée à cinq nucléotides en amont du site d’édition, grâce à des facteurs complémentaires (Davidson and Shelness, 2000). Ce phénomène d’édition apparaît progressivement au cours du développement embryonnaire. Chez l’embryon, l’intestin ne synthétise que de l’apoB100, qui ne sera plus que très faiblement représenté dans l’intestin adulte (Davidson and Shelness, 2000). Ainsi, le gène de l’apoB48 représente 48% de la séquence de l’apoB100 (Chan et al., 2003). Il est important de mentionner que le domaine de liaison au récepteur aux LDL est spécifique du gène de l’apoB100 et n’est pas représenté sur l’apoB48 (figure 13). Chez l'homme, l’apoB100 est seulement présente dans les lipoprotéines issues de la synthèse hépatique (VLDL et ses remnants) tandis que l’apoB48 n'est présente que dans les lipoprotéines d'origine intestinale (chylomicrons et des remnants de chylomicrons) (Olofsson and Boren, 2005). Cependant, d’autres équipes ont décrit la présence de l’apoB100 dans l'intestin (Hoeg et al., 1990).
Figure 13 : Représentation schématique de l’apoB100 humaine (Segrest et al., 2001)
50
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Il n'y a qu'une seule molécule d'apoB par lipoprotéine et, par conséquent, la mesure des concentrations plasmatiques d'apoB reflète le nombre de lipoprotéines circulantes. Différentes études ont montré qu’au cours de la digestion, la quantité de lipides transportée est plus importante bien que la teneur en apoB48 ne varie pas, en raison de l’augmentation de la taille des lipoprotéines sécrétées (Hayashi et al., 1990).
D.4.2. MTTP
La « Microsomal Triglyceride Transfer Protein » (MTTP) est un complexe hétérodimérique de 150 kDa environ comprenant une grande sous-unité de 88 kDa et une petite sous-unité de 58 kDa. Elle est exprimée dans l’intestin, le foie, les reins, le cœur, les ovaires et les testicules. Au niveau de l’intestin, elle est exprimée avec un gradient décroissant du duodénum au côlon chez le hamster. Son activité dans le duodénum et le jéjunum est 4 fois supérieure à celle du foie (Lin et al., 1994). Elle est présente dans le RE et permet la lipidation de l’apoB naissante par un transfert, depuis la membrane du RE, de lipides polaires et neutres. Des mutations dans les domaines de l'apoB ou de la MTTP sont décrites chez des sujets atteints d’une abétalipoprotéinémie (une pathologie dans laquelle l’apoB ou la MTTP ne sont pas synthétisées) (Wetterau et al., 1998). L’inactivation de la MTTP au niveau intestinal par le tamoxifène entraîne une diminution de 80% de la sécrétion d’apoB48 par les entérocytes avec pour conséquence, une accumulation des triglycérides au niveau du cytosol et une absence de chylomicrons sécrétés (Xie et al., 2006). La MTTP intervient également dans l’incorporation des esters de cholestérol dans les lipoprotéines du foie et de l’intestin (Iqbal et al., 2008). Les patients ayant une abétalipoprotéinémie souffrent d’une carence profonde en vitamine E compte-tenu que cette vitamine est transportée par les chylomicrons (Anwar et al., 2006; Anwar et al., 2007).
D.4.3. ApoA4
L’apoprotéine A4 (ApoA4) est une protéine de liaison aux lipides qui est exprimée principalement dans l'intestin grêle des mammifères. Bien que de nombreuses autres fonctions extra-intestinales lui ont été attribuées (Tso and Liu, 2004), l’apoA4 exerce un rôle primordial dans l'absorption intestinale des lipides. Dans l'entérocyte, l’apoA4 est incorporée dans les
51
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
chylomicrons naissants à un stade précoce de leur synthèse dans le RE et est présente à leur surface lorsqu’ils sont sécrétés. L’apoA4 est impliquée dans l'amélioration de la sécrétion des chylomicrons par les entérocytes. De tous les gènes intestinaux associés à l'absorption des lipides, le gène de l'apoA4 est le plus sensible aux flux intestinaux des lipides. En effet, sa surexpression dans les cellules intestinales de porc (IPEC-1) augmente à la fois la sécrétion des chylomicrons et la taille des lipoprotéines sécrétées (Lu et al., 2002; Lu et al., 2006). Par ailleurs, elle joue un rôle important dans le contrôle de la consommation alimentaire. L’injection intraveineuse de l’apoA4 chez les rats pendant le jeûne diminue la consommation alimentaire durant les premiers temps du repas (Fujimoto et al., 1992). Ces données suggèrent que l’apoA4 est un signal circulant libéré en réponse à un apport riche en lipides. De plus, la réduction de l’expression de l’apoA4 après un repas riche en gras (Yoshioka et al., 2008) pourrait représenter un effet de satiété plus élevé de nutriments riches en gras.
D.5. Sécrétion des chylomicrons par l’entérocyte
Les pré-chylomicrons assemblés dans le RE sont ensuite transférés à l’appareil de Golgi par bourgeonnement du RE et formation de vésicules nommées « Pre-Chylomicron Transport Vesicles » (PCTV) (Kumar and Mansbach, 1997; Kumar and Mansbach, 1999). Ils sont ensuite exportés dans des vésicules de grande taille (250 nm) par une protéine d'enveloppe complexe II (COPII) qui se trouve sur les PCTV (Siddiqi et al., 2003). Les protéines de la famille COPII, dont font partie la protéine Sar1b, la petite GTPase, et les complexes protéiques Sec23/24 et Sec13/31, sont nécessaires à la fusion de ces vésicules avec le complexe Golgien (Siddiqi et al., 2003). L’activité GTPasique de la protéine Sar1 régule le bourgeonnement de la membrane du RE (Springer et al., 1999). La protéine Sar1 couplée au guanosine triphosphate (GTP) est capable de s’associer à la membrane du RE et interagit avec l’hétérodimère Sec23/24 (Bi et al., 2002). Ce pré-complexe peut ensuite lier l’hétérodimère Sec13/31. La membrane du RE se déforme et les protéines COPII se polymérisent. L’hydrolyse du GTP provoque la dissociation de ces protéines et la vésicule de sécrétion formée est libérée (Barlowe et al., 1994). Une fois dans l’appareil de Golgi, les pré- chylomicrons sont transformés en chylomicrons qui sont sécrétés au niveau de la membrane basolatérale des entérocytes dans l’espace intercellulaire.
52
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
D.6. Métabolisme des chylomicrons
Les chylomicrons synthétisés dans l’entérocyte rejoignent, via la circulation lymphatique mésentérique, le canal lymphatique thoracique, qui les transporte jusqu’à la veine cave supérieure. Dans le sang, ils sont enrichis en apoprotéines apoC et apoE et sont rapidement épurés de 90% de leurs triglycérides par l’action de la lipoprotéine lipase (LPL), lipase accrochée à l’endothélium vasculaire par l’intermédiaire d’héparine sulfate protéoglycane (figure 14). La présence d’apoC2 à la surface des chylomicrons est un cofacteur indispensable à l’action de cette enzyme sur son substrat (Stein and Stein, 2003). De plus, la LPL est aussi contrôlée par l’apoC3 qui inhibe son activité. Un rapport apoC2/apoC3 favorise la dégradation des triglycérides des chylomicrons (Olivecrona and Beisiegel, 1997). Parallèlement à l’hydrolyse des triglycérides, les chylomicrons perdent d’autres constituants puisque 80% des phospholipides et 40% des apolipoprotéines (principalement apoA1, A2 et C) sont à l’origine d’une partie des HDL.
Figure 14 : Métabolisme des chylomicrons (http://www.bio-economie.com/cholesterol-atherosclerose-lipoproteine-a-lpa-atherosclerosis- lipoprotein.pdf)
La « Phosphoipid Transfer Protein » (PLTP) transfère les phospholipides et le cholestérol libre des lipoprotéines riches en triglycérides vers les HDL et joue un rôle
53
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
important dans la formation et le remodelage de ces dernières. De plus, la protéine de transfert des esters de cholestérol (« Cholesteryl Ester Transfer Protein », CETP), liée principalement aux HDL plasmatiques, transfère les esters de cholestérol des HDL au chylomicrons et aux LDL, et les TG des chylomicrons aux LDL et aux HDL. Le transfert médié par la CETP favorise indirectement l'élimination des esters de cholestérol de la circulation par leur absorption hépatique via le récepteur aux LDL (Barter et al., 2003) (figure 14). Le catabolisme des chylomicrons conduit donc à la formation : - des HDL naissantes constituées de phospholipides, d’apoprotéines A et C et du cholestérol libre (Illingworth, 1993). - des acides gras accompagnés de mono- et diglycérides. Ces acides gras fournissent l’énérgie aux muscles squelettiques ou sont stockés en triglycérides dans le tissu adipeux. - des remnants de chylomicrons, appelés aussi β-VLDL intestinales, qui sont reconnus au niveau du foie par certains récepteurs spécifiques de l’apoprotéine E (apoE) et absorbés par endocytose.
E. Assemblage des HDL intestinales
Les HDL représentent une classe particulière des lipoprotéines, de masse et de taille beaucoup plus faible que les LDL et sont principalement synthétisées dans le foie. Plusieurs travaux ont mis en évidence une voie de synthèse des HDL intestinales indépendante de l’apoB et de la MTTP. Cette voie a pour acteurs principaux, l’apoA1 et l’ABCA1, qui vont générer un efflux basolatéral de 25 à 30% par les entérocytes (Iqbal and Hussain, 2005; Brunham et al., 2006). Ces HDL intestinales ont une taille et une densité plus faible que les HDL assurant le transport retour du cholestérol depuis les tissus périphériques vers le foie. Leur sécrétion par l’intestin constitue environ 30% en comparaison avec celle des chylomicrons et des VLDL (Temel et al., 2005). Le cholestérol libre et les phospholipides sont sécrétés par le pôle basolatéral des entérocytes via le transporteur ABCA1 sur lequel est lié l’apoA1, permettant alors la formation des HDL intestinales (Iqbal and Hussain, 2005; Hussain and Bakillah, 2008) qui sont directement sécrétées dans la circulation sanguine (figure 15). L’importance du transporteur ABCA1 dans la formation des HDL intestinales a été démontrée en utilisant des souris déficientes en ABCA1 (Brunham et al., 2006) et
54
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
implicitement chez des souris déficientes en ACAT2 pour qui la voie apoB, voie de synthèse des chylomicrons, n’est pas fonctionnelle (Buhman et al., 2000). En effet, l’estérification du cholestérol par l’ACAT2 est une étape nécessaire pour l’assemblage et la sécrétion des chylomicrons. Les souris simple « Knock out » (KO) en ABCA1 et ACAT2 montrent une diminution de l’absorption du cholestérol de 23% et de 48%, respectivement. La diminution est de 79% chez les souris double KO pour ces gènes. Ces résultats confirment l’existence de ces deux voies de transport du cholestérol et montrent la prépondérance du transporteur ABCA1 dans la régulation de l’absorption du cholestérol comparé à la protéine ACAT2
(Temel et al., 2005).
FATP4
SR
NPC1
ABCG5 /G8
-
B1
-
L1 CD36
C MG + AG PL DGAT-1
C ACAT-2 PL TG MTTP C C MTTP E C CE TG PL
C CE TG apoB48 PL
C CE TG PL
C CE TG C PL PL chylomicron Sang ABCA1 Lymphe
HDL ApoA-I
Figure 15 : Formation des HDL intestinales
F. Métabolisme hépatique des lipoprotéines
F.1. Captation des remnants de chylomicrons
Les remnants de chylomicrons sont directement internalisés dans plusieurs tissus périphériques (cœur, muscle) avant d’être captés finalement par le foie. Les récepteurs
55
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
tissulaires, LDL-R et LRP, interviennent dans la reconnaissance et l’internalisation des remnants portant l’apoE (Hussain et al., 1999). Le récepteur SR-B1 est aussi impliqué dans le captage des remnants de chylomicrons au niveau hépatique (Out et al., 2005).
F.2. Sécrétion des VLDL
Les lipoprotéines de très basse densité (VLDL) sont synthétisées et sécrétées par le foie dans le but de fournir des lipides aux cellules des tissus périphériques. Leur formation fait intervenir la MTTP et l’apoB100. Les VLDL contiennent essentiellement des triglycérides et des esters de cholestérol produits par l’ACAT. L’apoprotéine apoE est majoritairement associée aux VLDL naissantes du foie. Comme pour les chylomicrons remnants, après leur sécrétion dans le compartiment intravasculaire, les VLDL hépatiques et intestinales sont hydrolysées par la lipoprotéine lipase (LPL) en lipoprotéine de densité intermédiaire (« Intermediate Density Lipoprotein », IDL), et par la lipase hépatique (« hepatic lipase », HL) en lipoprotéine de faible densité (LDL). Les LDL formées sont riches en esters de cholestérol et ne contiennent que de l’apoB100.
F.3. Voie de retour du cholestérol : « Reverse Cholesterol Transport » (RCT)
Cette voie consiste à extraire le cholestérol excédentaire des cellules afin de l’éliminer au niveau du foie puis dans la bile par une voie métabolique dite « antiathérogène ». Dans le plasma, le cholestérol des HDL est estérifié par la « Lecithin-Cholesterol Acyl Transferase » (LCAT). En transférant le cholestérol des HDL vers les VLDL/IDL, la CETP peut offrir une voie alternative de retour du cholestérol au foie. Les HDL plasmatiques peuvent également subir une maturation par la PLTP qui permet l’émergence de αHDL2 à partir des αHDL3. Dans l’étape finale de la voie de retour, le cholestérol des différentes lipoprotéines peut être capté au niveau du foie par SR-B1 (Acton et al., 1996), au niveau du rein par le LDL-R rénal ou la cubiline (Moestrup and Kozyraki, 2000). Dans le foie, le cholestérol est ensuite soit éliminé par la bile, soit stocké dans des VLDL et remis potentiellement en circulation.
56
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
G. Voie d’excrétion du cholestérol : « TransIntestinal Cholesterol Excretion » (TICE)
L’existence d’une voie alternative directe du transport du cholestérol de la circulation sanguine vers la lumière intestinale a été récemment montrée. Il a été longtemps considéré que la voie hépatobiliaire est la seule voie pour la sécrétion du cholestérol de l’organisme. Ainsi, les souris déficientes à la fois pour ABCG5 et ABCG8 ont une diminution de l’excrétion biliaire du cholestérol. En revanche, le taux de cholestérol dans les fécès de ces souris est identique en comparaison avec les souris témoins (Yu et al., 2002; van der Velde et al., 2007). Des résultats similaires ont été retrouvés chez des souris déficientes en mdr2 (multidrug résistance). Cette protéine est localisée à la membrane canaliculaire des hépatocytes. Son inactivation bloque la sécrétion des phospholipides et du cholestérol dans la bile (Smit et al., 1993). Cependant, le taux de cholestérol dans les fécès des souris déficientes en mdr2 est identique à celui des souris témoins (Brunham et al., 2006). Cette part de cholestérol excrétée dans les fécès est supérieure à la somme de la quantité du cholestérol alimentaire et du cholestérol biliaire (van der Velde et al., 2007). Cette voie de sécrétion du cholestérol passe directement du sang à travers l’entérocyte et est appelée la voie du « TransIntestinal Cholesterol Excretion » ou TICE. La déficience en ACAT2 chez la souris entraîne une augmentation du cholestérol fécal sans modification du taux de cholestérol biliaire (Brown et al., 2008). De plus, l’excrétion intestinale du cholestérol par la voie du TICE est plus important au niveau proximal de l’intestin grêle (Brown et al., 2008). La voie du TICE est stimulée par le régime alimentaire. Lorsque les souris sont nourries avec régime hyperlipidique, l’excrétion fécale des stérols est augmentée (Sehayek et al., 1998; de Vogel-van den Bosch et al., 2008; van der Velde et al., 2008). Elle est aussi augmentée chez les souris nourries avec un régime « Western diet » contenant des taux élevés en cholestérol et en acides gras (van der Velde et al., 2007). Un régime riche seulement en cholestérol n’affecte pas la voie du TICE, suggérant que la voie d’excrétion du cholestérol dépend du contenu du régime en acides gras (van der Velde et al., 2008). Par ailleurs, l’activation de certains récepteurs nucléaires tels que PPARδ (Vrins et al., 2009) et LXR (van der Veen et al., 2009) augmente la perte fécale du cholestérol par la voie TICE. Les transporteurs impliqués dans cette voie d’excrétion de cholestérol ne sont pas encore connus.
57
Chapitre 1 : Absorption intestinale des lipides et des vitamines liposolubles 2011
Dans l’étude de Van der Veen et al, ABCG5 en tant que cible de ces récepteurs nucléaires, a été suggérée en étant impliqué mais seulement en partie (van der Veen et al., 2009). Tandis que dans l’étude de Vrins et al, ce transporteur ne semble pas impliqué (Vrins et al., 2009). Il faut rechercher l’implication d’autres transporteurs dans cette voie d’élimination du cholestérol.
58
Chapitre 2 : Absorption intestinale des médicaments lipophiles : exemples des lactones macrocycliques
L'intestin grêle est la porte principale d'entrée, non seulement des lipides et des nutriments lipidiques, mais aussi des xénobiotiques et médicaments administrés par voie orale dans la circulation systémique. Plusieurs facteurs peuvent affecter l’absorption intestinale des médicaments. Dans ce contexte, nous citons les facteurs : - Chimiques (pH gastrique) - Physicochimiques (liposolubilité des médicaments) - Mécaniques (temps de vidange gastrique, vitesse de transit) - Physiopathologiques (métabolisme intestinal, infections intestinales) La voie orale est la voie d’administration la plus utilisée des médicaments. Un des défis pour l’industrie pharmaceutique est d’augmenter la biodisponibilité des médicaments administrés par voie orale. Plus de 40% des nouveaux médicaments sont lipophiles et présentent une très faible solubilité en milieu aqueux. Ainsi, leur absorption est étroitement liée à celle des lipides. En revanche, les mécanismes de passage des médicaments lipophiles à travers l’entérocytes ont été peu décrits. Dans ce chapitre, nous allons aborder les différentes étapes intervenant dans l’absorption des médicaments lipophiles ainsi que les stratégies utilisées pour améliorer leur biodisponibilité et donc leur efficacité.
A. Absorption des médicaments lipophiles
A.1. Dans la lumière intestinale
Après administration par voie orale, le médicament doit d’abord se dissoudre dans le tractus gastro-intestinal avant son entrée dans les entérocytes. Les sécrétions biliaires favorisent sa solubilisation en même temps que les produits de digestion lipidique (acides gras, monoglycérides, diglycérides) qui s’incorporent dans une série de structures colloïdales telle que les vésicules uni-et multilamellaires, les micelles simples ou mixtes (figure 16).
59
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
Ces structures permettent de solubiliser les médicaments lipophiles dans la lumière intestinale et d’améliorer leur processus d’absorption.
Figure 16 : Solubilisation intestinale des médicaments lipophiles (Porter et al., 2007)
A.2. Au niveau de l’entérocyte
Comme les autres composants lipidiques de micelles, les médicaments lipophiles se dissocient de leur forme micellaire dans la lumière intestinale, (Hoffman, 1970; Simmonds, 1972). Ils sont ensuite absorbés au niveau de la bordure en brosse de l’entérocyte soit par simple diffusion passive, soit par un système de transport protéine-dépendant pouvant impliquer les transporteurs de lipides (Porter et al., 2007). La biodisponibilité des médicaments est conditionnée non seulement par leur absorption mais aussi par leur métabolisation dans la cellule. Cette métabolisation a lieu principalement dans le foie et fait intervenir deux types d’enzymes : les enzymes de biotranformation de type I (les cytochromes CYP450) et II (glutathion S transférases). Concernant les médicaments lipophiles, ils sont absorbés au niveau de l’intestin et passent dans la lymphe où ils sont distribués aux tissus périphériques avant d’atteindre le foie, ce qui leur permet d’éviter le premier passage hépatique. La métabolisation intestinale des médicaments lipophiles, bien qu’elle soit mineure par rapport à celle dans le foie, forme un obstacle à leur absorption puisqu’elle diminue leur biodisponibilité dans l’organisme. Elle est réalisée soit dans le RE, soit dans la fraction cytosolique de la cellule intestinale (Danielson, 2002; Yengi et al., 2007). Les cytochromes CYP450 intestinaux majeurs incluent les CYP1A1, CYP3A1, CYP3A4 et CYP2B1 (Kaminsky and Zhang, 2003).
60
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
De plus, l’efflux des médicaments en dehors de la cellule est un autre facteur qui conditionne leur biodisponibilité. Il est réalisé par les transporteurs de la membrane apicale des entérocytes, les « MultiDrug Resistance » (MDR) qui jouent un rôle important dans le devenir de nombreux médicaments dont les médicaments lipophiles. (Wacher et al., 2001). Les principaux transporteurs MDR étudiés sont : la « P-glycoprotéine » (Pgp), les « Mutlidrug Resistance-associated Protein » (MRP) et la « Breast Cancer Resistance Protein » (BCRP) (figure 17). Ils font partie de la famille des transporteurs « ATP-Binding Cassette » (ABC) qui utilisent l’ATP pour pouvoir assurer le transport unidirectionnel de leurs substrats. L’existence d’une synergie entre le métabolisme intestinal assuré par les CYP450 et les MDR renforce le rôle de ces deux systèmes dans de nombreuses interactions entre médicaments (Cummins et al., 2002). En effet, les molécules qui échappent au métabolisme intra-entérocytaire peuvent atteindre la circulation sanguine via des transporteurs ABC à localisation basolatérale tel que ABCA1 ou encore être effluées par d’autres à localisation apicale vers la lumière intestinale où elles peuvent ensuite être ré-absorbées (Benet and Cummins, 2001; Benet et al., 2004). Concernant l’absorption intestinale des médicaments, le rôle des transporteurs de lipides tels que NPC1L1, SR-B1, FATP4 et CD36 dans le passage apical des médicaments lipophiles n’a jamais été recherché. En revanche, de nombreuses études ont montré l’implication des transporteurs des acides aminés (« Di/tri-Peptide Transporter », PepT1) (Brodin et al., 2002), des cations organiques (« Organic Cation Transporter », OCT) (Kim and Shim, 2006), des acides biliaires (« Apical Sodium dependant Bile acid Transporter », ASBT) (Balakrishnan and Polli, 2006) et des anions organiques (« Organic Anion-Transporting Polypeptide », OATP) (Kim, 2003) dans le transport des médicaments (figure 17). Le grand nombre de ces transporteurs explique l’importance de la prise en charge des composés pharmaceutiques de cette manière.
61
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
Figure 17 : Localisation entérocytaire des principaux transporteurs d’efflux. Cette représentation schématique d’un entérocyte permet de mettre en évidence le grand nombre de tranporteurs membranaires impliqués dans les influx et les efflux des molécules d’interêt pharmacologiques (Adapté de http://www.springerimages.com/Images/ Biomedicine/1-10.1208_s12248-009-9098-z-2)
B. Interactions des médicaments lipophiles avec les lipoprotéines plasmatiques : exemple des lactones macrocycliques
Les lipoprotéines sont également impliquées dans le transport de nombreux xénobiotiques hydrophobes dans la circulation sanguine (Wasan and Cassidy, 1998). Les médicaments lipophiles tels que l’amphotéricine B, la cyclosporine A, l’annamycine et la nystatine interagissent particulièrement avec les HDL et les LDL plasmatiques (tableau 1). Cette interaction avec les lipoprotéines plasmatiques influence la pharmacocinétique (absorption, distribution et élimination), l’activité pharmacologique et la toxicité des médicaments lipophiles (Wasan and Cassidy, 1998).
62
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
Médicaments % de xénobiotiques Références lipophiles VLDL LDL HDL Protéines Clozapine 1 6 13 80 (Procyshyn et al., 2003) Eritoran (E5564) 4 13 66 17 (Rossignol et al., 2004) Halofantrine 18 32 10 40 (McIntosh et al., 2003) Cyclosporine A 8 31 46 15 (Sgoutas et al., 1986) Amphotéricine B 4 22 74 N (Wasan et al., 1993) Moxidectine 4 23 68 5 (Bassissi et al., 2004)
Tableau 1 : Distribution des médicaments lipophiles dans les différentes classes de lipoprotéines plasmatiques chez l’Homme
Les lactones macrocycliques (LMs) sont des médicaments antiparasitaires lipophiles largement utilisées dans le traitement des parasites internes et externes chez les animaux et chez l’homme. L’ivermectine, une LM de la famille des avermectines, est capable de se lier aux HDL chez les chiens (Rohrer and Evans, 1990) et les chèvres (Bassissi et al., 2004). La moxidectine, une autre LM de la famille des mylbémycines, est principalement associée aux HDL plasmatiques mais aussi aux LDL chez différentes espèces animales dont l’homme (Bassissi et al., 2004) (tableau 1). Les différences dans les pourcentages d’association des médicaments lipophiles avec les lipoprotéines plasmatiques pourraient être dues à la nature de ces médicaments (polaire ou apolaire). Le logP, coefficient de partage octanol/eau permet la classification des médicaments lipophiles selon leur degré d’hydrophobie. Les médicaments hautement lipophiles ont un logP supérieur à 5. La Clozapine, un antipsychotique, est majoritairement présente dans la fraction protéique (tableau 1) avec une faible liaison avec les lipoprotéines plasmatiques en comparant avec la moxidectine. La Clozapine est beaucoup moins lipophile (logP = 3,2) que la moxidectine (logP = 6). L’halofantrine est plus lipophile (logP = 8) que la moxidectine, ce qui pourra expliquer son importante association avec les lipoprotéines riches en triglycérides (VLDL). Gerkovish et ses collaborateurs ont montré que cette association est proportionnelle à la quantité de triglycérides contenue dans les lipoprotéines (Gershkovich and Hoffman, 2005).
63
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
Plusieurs facteurs conditionnent la répartition des médicaments lipophiles dans les lipoprotéines.
Influence de la teneur plasmatique en lipides La distribution des médicaments lipophiles dans les lipoprotéines plasmatiques peut être partiellement influencée par la concentration plasmatique en cholestérol et en triglycérides dans les lipoprotéines. Chez les sujets normolipidiques, la moxidectine se retrouve majoritairement fixée aux HDL (68%) alors qu’elle est assocciée aux VLDL et aux LDL chez les sujets dyslipidémiques (hypertriglycéridémique ou hypercholestérolémique) (Bassissi et al., 2006). La cyclosporine A, un immunosupresseur lipophile, se déplace par affinité envers les lipides des HDL vers les VLDL/LDL chez les sujets dyslipidémiques (Wasan et al., 1997).
Influence de l’espèce La distribution des médicaments lipophiles dans les différentes classes de lipoprotéines plasmatiques est également fonction de l’espèce animale considérée La répartition de la moxidectine est plus importante dans les fractions LDL et HDL dans les 6 espèces étudiés (figure 18A). Cette répartition est fonction de la proportion du cholestérol dans les lipoprotéines de chacune de ces espèces. Le cholestérol des LDL est élevé chez l’homme par rapport aux autres espèces étudiées, ce qui pourra expliquer la répartition la plus importante de la moxidectine dans cette fraction. Par contre, la moxidectine est moins associée aux HDL plasmatiques dans lesquelles le cholestérol est le plus faible chez l’homme (Bassissi et al., 2004). La nystatine, un anti-fongique amphiphile, est répartie dans les fractions plasmatiques riches en cholestérol et en protéines (Ramaswamy et al., 1999). Elle est majoritairement présente dans la fraction déficiente en lipoprotéines (LDPF), du fait qu’elle est assez hydrophile. Sa répartition dans les lipoprotéines plasmatiques est également fonction de l’espèce et de la teneur en lipides et protéines (figure 18B). Ces résultats montrent qualitativement le comportement nettement différent de molécules lipophiles.
64
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
Figure 18 : Distribution de la moxidectine (A) et la nystatine (B) dans les fractions plasmatiques des différentes espèces (Ramaswamy et al., 1999; Bassissi et al., 2004) LDL/VLDL : lipoprotéines de basse/très basse densité, HDL : lipoprotéines de haute densité LPDF : fraction déficiente en lipoprotéines
C. Transport intestinal lymphatique des médicaments lipophiles
La plupart des médicaments hydrophiles ou amphiphiles (logP <5) administrés par voie orale rejoignent la circulation systémique par une absorption directe via le sang portal. Cependant, les médicaments hautement lipophiles (logP >5) rejoignent la circulation sanguine via le système intestinal lymphatique par les lipoprotéines riches en triglycérides, les chylomicrons, comme c’est le cas des lipides alimentaires (Porter and Charman, 2001) (Figure 19).
65
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
Figure 19 : Transport des lipides et des médicaments par la lymphe mésentérique ou par le sang portal après une administration orale (Porter et al., 2007).
L’association des médicaments lipophiles avec les chylomicrons est une étape cruciale et déterminante dans leur absorption intestinale lymphatique. Cependant, le mécanisme d’association est peu connu. Il est possible que ces médicaments s’incorporent dans le noyau triglycéride pendant la synthèse des chylomicrons ou bien s’associent directement aux chylomicrons déjà formés (Gershkovich and Hoffman, 2005). Une forte corrélation linéaire entre la fixation des médicaments lipophiles aux chylomicrons et leur transport intestinal lymphatique a été bien établie. En effet, l’halofantrine récupérée dans la lymphe des rats gavés avec une formulation à base d’huile d’arachide représente 16% de la dose administrée (Caliph et al., 2000) dont 68% se retrouve associée aux chylomicrons (Gershkovich and Hoffman, 2005). De plus, la quantité de la moxidectine récupérée dans la lymphe intestinale est stimulée par l’ingestion des lipides et représente 22% de la dose administrée chez les chiens (Lespine et al., 2006). Ces résultats suggèrent qu’une partie des médicaments lipophiles, durant le processus d’absorption intestinale, est incorporée dans les chylomicrons synthétisés par les entérocytes avant leur sécrétion dans la lymphe puis dans la circulation sanguine.
66
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
D. Stratégies d’amélioration de l’absorption des médicaments lipophiles
L’une des approches utilisées pour améliorer la biodisponibilité orale des médicaments lipophiles consiste à l'utilisation des systèmes de délivrance de médicaments à base de lipides (Charman, 2000; Gershanik and Benita, 2000) et/ou d’émulsifiants (Bogman et al., 2003; Cornaire et al., 2004).
D.1. Véhicules lipidiques
La capacité des véhicules lipidiques tels que les formulations lipidiques et les lipides alimentaires (soit dans le système de distribution pharmaceutique ou dans les aliments) à améliorer l'absorption des médicaments lipophiles est bien connue depuis de nombreuses années (Fleisher et al., 1999).
D.1.1. En postprandial
Le transport des médicaments lipophiles par le système intestinal lymphatique est significativement exacerbé par leur co-administration avec l’alimentation. Un régime riche en gras augmente la voie de synthèse des lipoprotéines intestinales et favorise l’accessibilité des médicaments au système lymphatique. Le transport lymphatique de l’halofantrine est plus important chez les chiens soumis à un régime gras comparé à ceux qui ont reçu le régime normal (Khoo et al., 2001).
D.1.2. Formulation lipidique
La co-administration des lipides augmente le flux intestinal lymphatique des médicaments lipophiles. Khoo et ses collaborateurs ont montré que l’administration orale de l’halofantrine dans une formulation contenant des acides gras à longues chaînes (AGLC) stimule le transport lymphatique du médicament (27% de la dose administrée) (Khoo et al., 2003).
67
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
La biodisponibilité et le transport lymphatique des médicaments lipophiles sont fortement modulés par la structure et la nature des lipides dans les formulations :
la longueur des chaînes lipidiques Les AGLC (C>14) sont principalement transportés par les chylomicrons vers la lymphe, alors que les acides gras à courtes chaînes (AGCC), qui sont beaucoup moins hydrophobes, traversent l’entérocyte vers le sang portal (Bloom et al., 1951; Chaikoff et al., 1951; Kiyasu et al., 1952). L’administration orale chez les rats d’une formulation de probucol (Palin and Wilson, 1984) ou d’halofantrine (Caliph et al., 2000) à base d’huile d’arachide contenant des AGLC augmente le transport lymphatique de ces médicaments comparée à une formulation d’AGCC. De plus, l’administration orale de l’huile de tournesol riche en AGLC augmente la biodisponibilité de la moxidectine chez le lapin (Bassissi et al., 2004).
la nature des lipides En termes de classes lipidiques (acides gras, monoglycérides, diglycérides, triglycerides ou phospholipides), plusieurs études ont examinés l’effet de l’administration de ces lipides sur le transport lymphatique des médicaments lipophiles (Ichihashi et al., 1992; Porter et al., 1996). En effet, la présence des phospholipides dans la formulation augmente la concentration de l’halofantrine dans la lymphe (Trevaskis et al., 2006).
D.2. Inhibition des enzymes de métabolisation et des transporteurs d’efflux : rôle des lipides
D.2.1. Inhibition des CYP450
Une autre approche a été utilisée pour améliorer l’absorption des médicaments lipophiles. Il s’agit de l’inhibition des enzymes de métabolisation intestinale et hépatique des médicaments, principalement les cytochromes P450. Le rôle des lipides dans le métabolisme pré-systémique des médicaments lipophiles a été établi. En effet, l’infusion intraduodénale de l’halofantrine en présence de l’acide oléique réduit la métabolisation entérocytaire du médicament par les cyp3a1/2 et cyp2a11 chez les rats (Trevaskis et al., 2006). De plus, le traitement des sacs d’intestins éversés avec une formulation d’amiodarone à base d’huile
68
Chapitre 2 : Absorption intestinale des médicaments lipophiles 2011
d’arachide et du cholestérol augmente la concentration du médicament comparée à celle de son métabolite (Shayeganpour et al., 2008). Ces résultats soulignent l’importance des lipides dans l’augmentation de la biodisponibilité des médicaments lipophiles via l’inhibition de leur métabolisation par les cytochromes P450.
D.2.2. Inhibition des transporteurs d’efflux
L’inhibition de l’efflux des médicaments lipophiles est un autre moyen pour améliorer leur absorption et leur biodisponibilité. La Pgp est un transporteur bien décrit dans l’efflux de nombreux xénobiotiques, dont les médicaments lipophiles et son inhibition augmente leur biodisponibilité. Lo et ses collaborateurs ont montré que les émulsifiants tels que le polysorbate 80 favorise l’absorption intestinale de l’épirubicine, un anticancéreux lipophile, en bloquant la fonction de la Pgp chez les rats (Lo, 2003). Par ailleurs, le rôle des lipides dans la modulation des transporteurs d’efflux est peu décrit dans littérature (voir chapitre 3).
69
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des lactones macrocycliques
A. P-glycoprotéine
A.1. Généralités
La famille des transporteurs « ATP-Binding Cassette » (ABC) regroupe une multitude de transporteurs membranaires impliqués chez les mamifères dans l’efflux en dehors de la cellule et/ou de l’organisme de diverses substances telles que des xénobiotiques, des sucres, des peptides, des ions et des médicaments (Dallas et al., 2006) (figure 20).
Figure 20 : Représentation schématique de l’efflux des xénobiotiques par les transporteurs ABC (Lespine et al., 2009)
Les protéines de la famille ABC représentent des facteurs déterminants dans l’accumulation, la pénétration, la distribution et l’excrétion des médicaments. Certains d’entre eux sont impliqués dans le développement du phénotype « MultiDrug Resistance » (MDR). Ce phénotype se définit comme la faculté des cellules à présenter une résistance croisée à des agents cytotoxiques de structures différentes et présentant des mécanismes d’action différents, limitant ainsi l'efficacité de la chimiothérapie (Goldstein et al., 1989). Ces transporteurs MDR sont : la P-glycoprotéine (Pgp), les « Multidrug Resistance-associated Protein » (MRP) et la « Breast Cancer Resistance Protein » (BCRP) (tableau 2). Leur expression dans l’intestin, le
70
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
foie et le rein permet la détoxication de ces tissus, et l’élimination des médicaments de la circulation systémique, exerçant ainsi une action protectrice contre leur toxicité.
Famille Gène Protéine B ABCB1 MDR1 ABCB1 (Pgp, MDR) C ABCC1 ABCC1 MRP1 C ABCC2 ABCC2 MRP2 C ABCC3 ABCC3 MRP3 C ABCC4 ABCC4 MRP4 C ABCC5 ABCC5 MRP5 G ABCG2 ABCG2 BCRP
Tableau 2 : Transporteurs ABC multidrogues, gènes et protéines (Vautier et al., 2006)
Nous nous sommes plus particulièrement intéressés dans ce chapitre à la P- glycoprotéine (Pgp, ABCB1). Elle appartient à la famille des transporteurs MDR et a été la première décrite associée à la résistance des cellules cancéreuses aux médicaments utilisés en chimiothérapie (Dano, 1973). Elle a été ensuite identifiée comme le transporteur actif d’un grand nombre de composés ayant des structures chimiques très variées (Gottesman and Pastan, 1993). Chez l’humain, elle est codée par le gène MDR1 (Ueda et al., 1986) localisé sur le chromosome 7 (Fojo et al., 1986), alors que chez le rat, la souris et le hamster, elle est codée par 2 gènes mdr1a et mdr1b (Devault and Gros, 1990) situés sur le chromosome 5 (http://www.ncbi.nlm.nih.gov/gene/18669).
A.2. Structure de la P-glycoprotéine
La Pgp est une phosphoglycoprotéine de 170-180 kDa possédant une partie cytosolique renfermant le site de fixation de l’ATP lui conférant le rôle d’efflux (Sun et al., 2004). L’analyse de sa séquence montre qu’elle est constituée de deux moitiés de 610 acides aminés fortement homologues reliées par une séquence de 60 acides aminés peu conservée. Chaque moitié de la Pgp est divisée en deux régions (figure 21) :
71
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
- une région N-terminale possédant une faible homologie de séquence avec la région N- terminale de l’autre moitié de la Pgp - une région C-terminale fortement homologue d’une moitié à l’autre. Ces deux régions C- terminales forment chacune une large boucle cytoplasmique. Chaque moitié comporte : - six segments transmembranaires formés d’une vingtaine d’acides aminés hydrophobes reliés par des boucles extracellulaires courtes et des boucles intracellulaires plus longues. - un domaine « ATP-Binding Cassette » (ABC) ou « Nucleotide Binding Domain » (NBD). Chaque domaine NBD renferme un site consensus contenant des motifs conservés caractéristiques des transporteurs ABC et intervenant dans la fixation de l’ATP : les motifs Walker A et B, la région C (également appelée signature ou motif LSGGQ) et les boucles D, H et Q. Un motif commun à tous les transporteurs ABC, la boucle A contenant un acide aminé aromatique conservé a été identifié comme étant essentiel à la fixation de l’ATP (Ambudkar et al., 1999).
Boucles extracellulaires courtes
6TMD
Boucles intracellulaires longues
N
C
ère ère 1 moitié 2 moitié
Figure 21 : Modèle structural de la Pgp humaine (Ambudkar et al., 2003) Le gène de la Pgp est constitué de 28 exons présentéss en couleurs différentes sur le schéma. La protéine est formée de 1280 acides amines et divisée en deux moitiés. Chaque moitié est composée de 6 hélices transmembranaires formant un domaine transmembranaire (TMD) reliés par 3 boucles extracellulaires courtes et 3 boucles intracellulaires longues, et d’un domaine de liaison aux nucléotides. Les cercles noirs représentent les résidus concernés par les « Single Nucleotide Polymorphisme » (SNP) actuellement décrits.
72
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
A.3. Fonctions de la P-glycoprotéine
La Pgp est fortement exprimée dans les cellules cancéreuses, mais également dans de nombreux tissus tels que l’épithélium intestinal, la barrière hémato-encéphalique, le foie et le rein. Au niveau de ces tissus, elle détient un rôle d’excrétion ou de barrière protectrice vis-à- vis de l’organisme en limitant l’absorption de substances exogènes ou de toxines (figure 22). La Pgp est également présente dans des compartiments spécialisés de la membrane plasmique, appelés cavéoles. Les cavéoles sont des invaginations de la membrane plasmique en forme de cupules et qui sont impliquées dans plusieurs processus physiologiques, dont le transport intracellulaire du cholestérol (Johnstone et al., 2000) et l’apoptose (Karwatsky et al., 2003). La Pgp intervient également dans l’initiation de la réponse immune, en étant potentiellement impliquée dans le transport de certaines cytokines, et dans la multiplication et la baisse de la différenciation des cellules souches hématopoïétiques (Pendse et al., 2003).
Barrière hémato- encéphalique intact Elimination hépatique facilitée Elimination rénale facilitée
Absorption intestinale reduite
Figure 22 : Fonctions de la P-glycoprotéine
A.4. Substrats de la P-glycoprotéine
La Pgp possède une large spécificité de substrats. Elle est capable de transporter des médicaments ayant des structures très diverses, plutôt à caractère hydrophobe, électriquement neutres ou portant une charge positive tels que la doxorubicine, la vinblastine ou le taxol, ainsi qu’une très grande variété de substances qui confèrent à la Pgp toute son importance en pharmacologie (tableau 3).
73
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
Classes Exemples Substances anticancéreuses Vinca alcaloïdes (Vinblastine, Vincristine) ; Mitoxantrone ; Anthracyclines (Doxorubicine, Daunorubicine) ; Paclitaxel ; Actinomycine D ; Topotécan ; Mitomycine C Autres agents cytotoxiques Colchicine ; Bromure d’éthidium ; Puromycine Peptides Valinomycine ; Gramicidine D Inhibiteurs de la protéase du VIH Ritonavir ; Indinavir ; Saquinavir Fluorophores Rhodamine ; Hoechst 33342 ; Calcéïne-AM Antihistaminiques Féxofénadine, Cétirizine
Tableau 3 : Quelques substrats transportés par la Pgp (Ambudkar et al., 1999)
B. Transporteurs ABC multidrogues et médicaments lipophiles
Parmi les nombreux médicaments lipophiles qui interagissent avec les transporteurs MDR, certains médicaments antiparasitaires lipophiles tels que les lactones macrocycliques (LMs) sont pris en charge par la Pgp et les autres transporteurs MDR.
B.1. P-glycoprotéine et lactones macrocycliques
Le lien entre la Pgp et les lactones macrocyliques (LMs) a été décrit pour la première fois chez les souris déficientes en Pgp (Schinkel et al., 1994). En effet, après l’administration de l’ivermectine, ces souris montrent des signes de toxicité, et presque toutes celles qui sont homozygotes pour la mutation (mdr1ab-/-) sont mortes à cause d’une concentration cérébrale d’ivermectine 100 fois plus élevée par rapport aux témoins (Schinkel et al., 1994). Cela est conforme à la propriété des LMs à se lier à des récepteurs GABA dans le système nerveux central des mammifères. Les LMs ont une forte affinité pour les récepteurs de glutamate spécifiques chez les parasites et les insectes. L’hypersensibilité et la neurotoxicité dues à l’ivermectine ont été également observées dans une sous-population de souris CF1 déficientes en Pgp (Kwei et al., 1999) et chez les chiens Colley (Mealey et al., 2001; Roulet et al., 2003) où la Pgp présente une mutation. D’autres travaux ont mis en évidence l’implication de la Pgp dans le transport des LMs.
74
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
Dupuy et ses collaborateurs ont montré une accumulation intracellulaire de la moxidectine dans les hépatocytes de rat traités au vérapamil (Dupuy et al., 2001). De plus, le flux de l’ivermectine, la sélamectine et la moxidectine dans les cellules Caco-2 est plus important dans le sens baso-latéral que dans le sens apico-basal, montrant ainsi que leur efflux apical est médié par la Pgp (Griffin et al., 2005). L’ivermectine a été ensuite ajoutée sur la liste des inhibiteurs du transport médié par la Pgp (Polli et al., 2001). La forte capacité de l’ivermectine à inhiber la Pgp se situe dans le même rang que les inhibiteurs puissants décrits jusqu’alors comme la cyclosporine A, son dérivé PSC833 (Valspodar) et le lopéramide (médicament anti-diarrhéique) (Didier and Loor, 1996; Eneroth et al., 2001). La cyclosporine A, qui a été largement étudiée pour sa capacité à réverser le phénotype MDR (Twentyman, 1992), partage des similitudes avec l’ivermectine en terme d’interaction avec la Pgp. Les deux molécules (la cyclosporine A et l’ivermectine) sont des modulateurs de la Pgp, leur forte affinité de liaison pour cette protéine pourrait être attribuée à leur grande taille moléculaire et à leur richesse en liaisons hydrogène, ce qui semble être lié à un transport lent des substrats de la Pgp (Saeki et al., 1993; Pouliot et al., 1997). En conséquence, ces deux molécules sont capables d’inhiber fortement la fonction de la Pgp à de faibles concentrations. Toutes les deux inhibent avec la même efficacité le transport de la calcéine-AM, un substrat de référence de la Pgp, dans les cellules Caco-2 (Didier and Loor, 1996). En outre, la cyclosporine A entre en compétition avec l’ivermectine pour se lier aux membranes préparées à partir des cellules résistantes aux médicaments et surexprimant la Pgp (Twentyman, 1992). Les LMs peuvent également influencer l’activité ATPasique de ce transporteur. En effet, une augmentation des concentrations de LMs sur les vésicules inversées préparées à partir des membranes de cellules surexprimant la Pgp (les cellules MDR DC-3F/ADX) inhibe son activité ATPasique comparée aux cellules témoins, les cellules DC-3F parentales sensibles (Lespine et al., 2007). Les mêmes auteurs ont montré également que l’ivermectine entre en compétition avec le vérapamil dans les vésicules membranaires surexprimant la Pgp, avec une constante d’inhibition (Ki) de 0,05 µM (Lespine et al., 2007). L’ivermectine, en raison de sa grande taille moléculaire, peut également entrer en compétition avec les substrats de la Pgp. Il est probable que le noyau hexahydrobenzofurane et le macrocycle des lactones macrocyliques sont à l’origine de la spécificité de leur liaison à la Pgp, tandis que leur fraction disaccharidique est probablement impliquée dans un autre site de liaison, augmentant ainsi l’affinité de la Pgp (Kiki-Mvouaka et al., 2010). Le fait d’occuper les sites de liaison de la Pgp semble être un intérêt particulier 75
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
pour inhiber sa liaison avec un grand nombre de ligands et réverser efficacement la résistance MDR. D’autres LMs comme l’éprinomectine, la doramectine et l'abamectine peuvent aussi inhiber la fonction de transport de la Pgp et moduler son activité ATPasique. L’abamectine et l’éprinomectine ont une affinité légèrement plus élevée pour la Pgp que les autres LMs (1,5 et 2,5 fois plus élevée par rapport à la doramectine et l’ivermectine, respectivement) (Lespine et al., 2009). Étant donné que ces deux LMs ont une double liaison sur C22-23, il pourrait être intéressant d'examiner sa contribution réelle pour la liaison avec le transporteur. En revanche, la moxidectine, de la famille des milbémycines et qui n'a pas le groupement disaccharidique sur la carbone C13 (figure 23), a une affinité plus faible pour la Pgp par rapport aux avermectines, soit de 10 fois moins (Lespine et al., 2009).
13 13
Dissacharide 1
2 3
Mylbémycine Avermectine
Figure 23 : Structure chimique de l’avermectine et la mylbémycine
La sélamectine possède une structure intermédiaire avec un seul résidu saccharidique, et ressemble à l'ivermectine puisqu’elle est transportée par la Pgp (Griffin et al., 2005; Brayden and Griffin, 2008). De plus, la sélamectine est capable d’inhiber la Pgp (Lespine et al., 2007) et a une faible affinité pour le transporteur (tableau 4).
76
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
Tableau 4 : Relation entre structure, lipophilie et interaction des lactones macrocycliques avec la Pgp (Lespine et al., 2009) La présence du groupement saccharidique influence le degré d’hydrophobie des lactones macrocyliques et influence certainement leur répartition dans les lipides des membranes. Le logP, coefficient de partage octanol/eau, est la mesure de la solubilité différentielle de composés chimiques dans deux solvants. Les valeurs du log P présentées dans le tableau permettent de classifier les LMs selon leur lipophilie : la moxidectine et la sélamectine avec un logP très élevé de 6 et 6,3, respectivement et les autres LMs avec un logP<6 (entre 3 et 5,6). IC50 (« Inhibitory Concentration »), c’est la concentration nécessaire pour inhiber de 50% le transport de la rhodamine 123 dans les cellules surexprimant la Pgp. Le Ki, ou constante d’inhibition, est la concentration en inhibiteur pour laquelle une inhibition des sites enzymatiques de la Pgp demi-maximale est observée.
Sur la base des différences structurales de la doramectine et la sélamectine (Lespine et al., 2007), il semble que le groupement saccharidique joue un rôle important dans l'interaction des LMs avec la Pgp. Il influence également le degré d’hydrophobie de la molécule qui joue un rôle important dans la partition dans les lipides membranaires, qui est une étape nécessaire pour l’interaction des substrats avec la Pgp. Le logP, coefficient de partage octanol/eau des LMs, est la mesure de la distribution des LMs entre la phase aqueuse et la phase
77
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
membranaire. Il permet la classification des LMs en deux classes principales selon leur degré d’hydrophobie: la moxidectine et la sélamectine avec un logP de 6 et 6.3, respectivement, et d’autres LMs avec un logP < 6 (tableau 5). La relation réciproque entre le logP de ces deux classes de LMs et les paramètres d’interaction avec la Pgp (Ki) montre que ces évènements sont dus à une interaction directe des LMs avec le transporteur et non pas à un effet secondaire des interactions des médicaments avec la membrane. Comme pour la voie du TICE d’excrétion du cholestérol par l’intestin, il a été également montré que les LMs tels que l’ivermectine et l’éprinomectine sont excrétées dans les fécès tout au long de l’intestin grêle. Pour ces médicaments, cette excrétion est dépendante de la Pgp (Kiki-Mvouaka et al., 2010).
B.2. Lactones macrocycliques et autres transporteurs MDR
Compte-tenu de la spécificité des substrats de la Pgp et des autres transporteurs ABC, il a été postulé que les transporteurs de la famille MRP pourraient être également impliqués dans la biodisponibilité des LMs. Il a été montré que l’ivermectine interagissait avec MRP1 et en moindre mesure avec MRP2 et 3, avec des constantes d’inhibition (Ki) de 0,5 ; 3,6 et 2,7 respectivement (Lespine et al., 2006). L’interaction de la moxidectine avec les MRPs a été également montrée. En effet, l’inhibition des MRPs entraîne une accumulation de la moxidectine dans les hépatocytes de rat en culture (Dupuy et al., 2006). L’ensemble de ces résultats montre que les MRP peuvent aussi moduler la biodisponibilité des LMs. Ainsi, l’interaction de la « Breast Cancer Resistance Protein » (BCRP) avec les LMs a été bien établie. Il a été montré que les lactones macrocyliques sont des inhibiteurs potentiels de BCRP (Merino et al., 2009). En effet, le traitement des cellules MDCKII transfectées par la BCRP humaine par l’ivermectine ou la sélamectine provoque une accumulation de la mitoxantrone (MXR), un substrat fluorescent de BCRP, de 95 et 32%, respectivement (Merino et al., 2009). Par contre, l’inhibition de BCRP par la fumitrémorgine C n’augmente pas la concentration de la moxidectine dans les hépatocytes de rat en culture (Dupuy et al., 2006), suggérant que BCRP n’est probablement pas impliquée dans la modulation de la biodisponibilité de la moxidectine.
78
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
C. P-glycoprotéine et lipides
C.1. Pgp et cholestérol
En plus de leur fonction dans le transport des médicaments, les transporteurs ABC sont également impliqués dans le transport et la régulation d'une variété de composés endogènes tels que les nucléotides, les acides biliaires, les porphyrines, les stéroïdes / conjugués stéroïdes et les sphingolipides (Litman et al., 2001; Bodo et al., 2003; Kruh and Belinsky, 2003; Schinkel and Jonker, 2003). Ils ont été impliqués dans le maintien de l'assymétrie des lipides à travers les membranes cellulaires dont la membrane plasmique (Sietsma et al., 2001). Les transporteurs MDR qui sont impliqués dans le transport des médicaments lipophiles ont également la capacité de transporter des analogues de lipides membranaires (Borst et al., 2000). La Pgp montre une activité d’hydrolyse de l’ATP couplée à l’efflux d’une variété de molécules hydrophobes (Gottesman and Pastan, 1993; Sharom, 1997). Elle présente une activité ATPase basale en l’absence d’un substrat ajouté (Sharom, 1997), ce qui reflète la présence des substrats endogènes inconnus (Higgins and Gottesman, 1992; Borgnia et al., 1996). Pour supporter cette hypothèse, un lien entre la Pgp et le cholestérol cellulaire a été établi. D’une part, la Pgp est principalement localisée au niveau des micro-domaines des membranes riches en cholestérol, les radeaux lipidiques (Luker et al., 2000). D’autre part, lorsque la Pgp est reconstruite dans des protéoliposomes, elle montre une activité ATPasique plus importante en présence du cholestérol (Shapiro and Ling, 1994). De plus, elle joue un rôle important dans la redistribution du cholestérol membranaire selon un couplage entre la translocation du cholestérol et sa stimulation qui induit l’activité ATPasique de la Pgp (Garrigues et al., 2002). Cette activité ATPasique basale de la Pgp est inhibée dans les membranes surexprimant la Pgp traitées par la « methyl-β-cyclodextrine » (MβCD) qui extrait le cholestérol des membranes (Garrigues et al., 2002). Le flux du cholestérol de la membrane plasmique vers le RE diminue en présence des inhibiteurs de la Pgp (Metherall et al., 1996). Ainsi, l’absorption du cholestérol exogène augmente dans les cellules transfectées avec la Pgp (Tessner and Stenson, 2000). Par ailleurs, l’enrichissement du feuillet externe de la membrane plasmique avec du cholestérol peut faciliter l’efflux de la molécule vers les HDL, probablement via ABCA1. Une autre étude réalisée sur des souris déficientes en Pgp soumises soit à un régime normal ou riche en lipides « High Fat Diet » (HFD) montre un taux 79
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
de cholestérol fécal augmenté par rapport aux souris sauvages (Thornton et al., 2008). Cette perte du cholestérol dans les fécès peut être due à une augmentation de l’efflux du cholestérol du foie vers la bile via ABCG5/G8, ou de l’entérocyte vers la lumière intestinale via ABCA1 ou ABCG5/G8 (Thornton et al., 2008). Il est fort possible que l’invalidation de la Pgp puisse être compensée par une modification de la fonctionnalité des autres transporteurs également impliqués.
C.2. Pgp et sphingolipides
Les sphingolipides (sphingomyéline, sphingosine, céramides) sont principalement localisés dans la membrane plasmique avec une fraction importante dans le Golgi et le RE. La surexpression de la Pgp a été associée à une altération de la composition lipidique de la membrane cellulaire et à une élévation des taux de cholestérol et de nombreux glycolipides et une modification des taux de sphingomyélines (Lavie et al., 1999). Les travaux d’Eckford et Sharom mettent en évidence la capacité de la Pgp d’agir comme une « flippase » pour les glycosylcéramides. En effet, l’incubation des protéoliposomes surexprimant la Pgp avec un glycosylcéramide fluorescent en présence de l’ATP montre une augmentation de la fluorescence dans le feuillet interne des protéoliposomes en comparaison avec ceux incubés en l’absence de l’ATP (Eckford and Sharom, 2005). Une récente étude a montré que la combinaison des antagonistes de la Pgp avec des céramides pourrait prévenir la résistance des cellules tumorales aux agents chimiothérapeutiques (Chapman et al., 2011). En effet, l’inhibition de la Pgp par le tamoxifène augmente la toxicité du C6-ceramide dans les cellules de cancer ovarien. Cette aumentation de toxicité se traduit par une diminution de la synthèse du C6-glycosylcéramide qui est la forme non toxique du C6-céramide (Chapman et al., 2011).
D. P-glycoprotéine et désordres métaboliques
Il a été démontré que les polymorphismes dans la séquence codant pour le gène ABCB1 chez les humains sont associés à des désordres dans le métabolisme des lipides. Dans une population hypercholestérolémique, les haplotypes G2677T et C3435T du gène ABCB1 sont associés à un taux élevé du cholestérol total et du LDL-cholestérol (LDL-C) (Kajinami et al., 2004; Rodrigues et al., 2005). Par contre, l’étude menée sur la cohorte STANISLAS 80
Chapitre 3 : P-glycoprotéine, rôle dans le transport des lipides et des LMs 2011
composée de sujets sains a montré que le polymorphisme G2677T/A est associé à une diminution du LDL-C (Jeannesson et al., 2009). De plus, dans une population japonaise saine, l’haplotype C3435T augmente l’expression intestinale de la Pgp (Nakamura et al., 2002). Il a été également montré que la Pgp est impliquée dans le transport du cholestérol libre de la membrane plasmique vers le RE, le site d’estérification du cholestérol par l’ « Acyl-CoA Cholesterol Acyl-Transferase » (ACAT) (Debry et al., 1997). L’ensemble de ces études mènent à conclure que l’augmentation de l’activité de la Pgp associée aux variants de l’ABCB1 pourrait résulter d’une accumulation intracellulaire de l’ester de cholestérol qui par la suite, réduit la voie de synthèse endogène du cholestérol ainsi que la captation des LDL par les « LDL receptor protein » (LDL-R). Par conséquent, la réduction du nombre des LDL-R sur la membrane cellulaire est en faveur de l’hypercholestérolémie chez ces individus. Le polymorphisme de la Pgp a été également montré associé à l’obésité. En effet, parmi 95 polymorphismes de 67 gènes candidats explorés dans une cohorte japonaise de 4252 individus, seul le polymorphisme de la Pgp a été clairement et significativement associé à l’obésité (Ichihara et al., 2008). L’évaluation de l’indice de masse corporelle étant plus important chez les individus portant l’haplotype 2677A/T de la Pgp que ceux portant le génotype GG (Ichihara et al., 2008). Un lien entre la Pgp et le diabète a été également montré. En effet, le taux d’expression de la Pgp est significativement atténué dans le cortex cérébral chez les souris diabétiques (Kamei et al., 2005). De plus, la perméabilité intestinale de la digoxine, un substrat de la Pgp, diminue significativement chez les rats diabétiques (Neerati et al., 2011). Ces résultats montrent que le diabète mellitus provoque une altération de la fonction de la Pgp, probablement une diminution de sa fonction de transport et/ou de son expression. Cette diminution est restaurée par le traitement par l’insuline qui, à la suite de son injection chez les rats diabétiques, diminue la perméabilité de la digoxine (Neerati et al., 2011). Par conséquent, une toxicité accrue des substrats de la Pgp pourrait se mettre en place chez les patients diabétiques en raison de la diminution de la fonction de la Pgp.
81
Objectifs de la thèse
82
Objectifs de la thèse 2011
L’identification des transporteurs sur le pôle apical de la cellule intestinale a permis de mieux comprendre les mécanismes d’absorption des lipides et des micronutriments lipidiques et de définir l’implication de certains d’entre eux dans l’homéostasie des lipides. L’ensemble des données de la littérature rapporte aujourd’hui l’implication de plusieurs transporteurs dans l’absorption du cholestérol, des triglycérides et des vitamines liposolubles. La perturbation des processus d’absorption médiée par ces transporteurs sont liée à des problèmes majeurs de santé publique (dyslipémies, obésité, athérosclérose, maladies cardiovasculaires). En plus de son rôle dans l’absorption des lipides et des micronutriments lipidiques, l’intestin joue un rôle majeur dans l’absorption des médicaments lipophiles qui pourrait mettre en jeu des mécanismes similaires impliquants des transporteurs communs.
Dans ce contexte, les objectifs de ce travail s’articulent autour de trois axes principaux :
1. Compte-tenu de l’implication de NPC1L1 et SR-B1 dans l’absorption du cholestérol alimentaire et de la vitamine E (le tocophérol) au niveau de la bordure en brosse de l’entérocyte, nous avons recherché : - Si la composition des micelles en lipides contenant aussi le cholestérol ou le tocophérol influençait le rôle de NPC1L1 et SR-B1 dans l’absorption intestinale des ces composés - Le niveau de contribution de chacun de ces transporteurs tout au long de l’intestin dans l’absorption du cholestérol et du tocophérol Cette étude a été réalisée in vitro, sur des cellules Caco-2 d’adénocarcinome humain et in vivo, sur des souris soit transgéniques surexprimant SR-B1 ou bien traitées par l’ézétimibe, un inhibiteur de NPC1L1.
2. La Pgp (ABCB1, MDR) est aussi impliquée dans le transport du cholestérol et de certains lipides (Chapitre 3, section C). Le fait qu’un polymorphisme de ce transporteur soit associé à une hypercholestérolémie et une obésité fait supposer qu’elle pourrait jouer un rôle important dans l’homéostasie des lipides. - Ainsi, nous avons recherché si la déficience en Pgp peut engendrer un phénotype particulier lié à une perturbation du métabolisme des lipides.
83
Objectifs de la thèse 2011
- Sur la base des résultats obtenus qui montrent que l’absence de la Pgp est associée au développement de l’obésité chez la souris, nous avons recherché si la déficience en Pgp pourrait modifier le processus d’absorption des lipides ? Cette étude a été réalisée in vivo sur un modèle de souris déficientes en Pgp.
3. Etant donné que la Pgp est principalement connu pour son implication dans le transport des xénobiotiques et notamment de nombreux médicaments lipophiles, nous avons étudié l’influence des formulations lipidiques sur le transport des médicaments lipophiles, notamment l’ivermectine, appartenant à la famille des lactones macrocyliques antiparasitaires. Cette étude a été également réalisée in vivo sur des souris déficientes en Pgp.
84
Modèles et outils utilisés
85
Modèles et outils utilisés 2011
A. Modèles utilisés
A.1. Les souris surexprimant le gène sr-b1
Afin d’étudier le rôle de SR-B1 dans l’absorption du cholestérol tout au long de l’intestin, nous avons utilisé un modèle de souris qui surexprime ce transporteur notamment au niveau intestinal où se fait principament l’absorption du cholestérol. Dans ce modèle, l’expression de SR-B1 est décroissante tout au long de l’intestin grêle et croissante des cryptes jusqu’aux villosités (Le Beyec et al., 1999). La modification génétique a été effectuée chez la souris sur un fond génétique B6D2. L’ADN complémentaire (ADNc) de SR-B1 murin a été obtenu par la digestion du vecteur pRC/CMV par les enzymes de restriction HindIII et XbaI. Le fragment contenant le domaine activateur (« enhancer ») de l’apolipoprotéine apoC3 (500/890 pb) couplé au promoteur de l’apolipoprotéine apoA4 (700 pb) a été excisé du plasmide pUCSHCAT par les mêmes enzymes de restriction (Ogami et al., 1990). La construction contenant l’enhancer de l’apoC3 couplé au promoteur de l’apoA4, utilisée pour sa spécificité intestinale, et le fragment d’ADNc de SR-B1 (1,8 kb) (Ji et al., 1997) a été cloné dans le site XbaI du vecteur pcADN1.1. Un fragment linéaire de la construction a été obtenu par la digestion du vecteur par les enzymes de restriction SalI et AvrII et utilisé pour générer des souris transgéniques par des procédures standards. Les animaux fondateurs ont été rétrocroisés avec des C57Bl6 pendant 12 générations pour avoir des animaux homozygotes pour SR-B1 (SR-B1+/+) (Bietrix et al., 2006).
A.2. Les souris invalidées pour les gènes mdr1a et mdr1b
La P-glycoprotéine est une protéine impliquée dans la « MultiDrug Resistance » (MDR) dans la cellule tumorale et conduit à la polychimiorésistance en clinique humaine. Elle est codée par un seul gène chez la plupart des mamifères, incluant l’homme (ABCB1, MDR1) et par deux gènes chez les rongeurs (abcb1a et abcb1b, mdr1a et mdr1b). Les souris déficientes en Pgp (mdr1ab-/-) ont été générées afin de mieux comprendre le rôle de la Pgp dans le transport des médicaments (Schinkel et al., 1994).
86
Modèles et outils utilisés 2011
Pour étudier le rôle de ce transporteur dans l’homéostasie des lipides et dans l’absorption des médicaments lipophiles, nous avons utilisé les souris invalidées pour les deux gènes qui codent pour la Pgp. L’invalidation d’un gène ou « knock-out (KO) » est une technique permettant de le désactiver en remplaçant son allèle normal par un allèle mutant non fonctionnel. Elle permet de mieux comprendre la fonction des gènes. En 1994, Schinkel et ses collaborateurs ont généré les souris déficientes en mdr1a sur fond génétique C57Bl6. L’invalidation de ce gène a été réalisée en remplaçant le fragment génomique Nhel (1,6 kb) contenant les exons 6 et 7 par un gène de résistance à l’hygromycine (figure 24). Ce remplacement induit au niveau de la protéine une délétion des domaines transmembranaires 2, 3 et 4 ainsi qu’une délétion de la première boucle cytoplasmique et de la seconde extracellulaire avec un décalage de phase à partir de l’extrémité 3’ du gène (Schinkel et al., 1994).
Figure 24 : Inactivation ciblée du gène mdr1a
Cette construction a été transfectée dans des cellules souches embryonnaires (E14). La sélection des clones de cellules souches ayant le gène mdr1a codant pour une protéine tronquée a été réalisée grâce à la présence du gène de résistance à l’hygromycine. Les souris chimères ont été générées en injectant le clone résistant dans un blastocyste de souris C57Bl6 puis dans l’utérus d’une souris du même fond génétique (Bradley, 1987). Le croisement des souris chimériques avec des sauvages a abouti à des descendances hétérozygotes pour la délétion. Les homozygotes (mdr1a-/-) ont été obtenu en croisant les souris hétérozygotes de la première génération (Schinkel et al., 1994).
87
Modèles et outils utilisés 2011
Les souris déficientes en mdr1b ont été obtenues en 1997 de la même manière en remplaçant les exons 3 et 4 du gène mdr1b par une cassette néomycine (Schinkel et al., 1997). Les souris double KO (mdr1ab-/-) ont également généré en délétant le locus mdr1b sur le chromosome où le locus mdr1a est déjà délété (figure 25).
Figure 25 : Inactivation du gène mdr1b dans un chromosome déjà inactivé pour mdr1a
Ces délétions ont été faites chez des souris C57Bl6 aussi bien que chez des souris « Friend Virus B-Type » (FVB) (Schinkel et al., 1997). La lignée FVB est une lignée blanche caractérisée par un taux de fécondité élevé et des zygotes faciles à injecter par rapport à la lignée transgénique C57Bl6. Dans notre étude, les souris déficientes en Pgp (mdr1ab-/-) que nous avons utilisées dérivent du fond génétique FVB.
A.3. Les cellules Caco-2/TC7
Les cellules Caco-2 sont des cellules issues d’un adénocarcinome colique humain. Cultivées en monocouches, elles se différencient pour former un épithélium mimant la barrière intestinale. Les cellules expriment alors les caractéristiques morphologiques et fonctionnelles de l’épithélium intestinal (microvillosités, jonctions serrées, enzymes spécifiques...) (Pinto et al., 1983). Elles sont polarisées et expriment tout un panel de transporteurs au niveau apical aussi bien qu’au niveau basolatéral. Le clone TC7 a été spécialement choisi en raison de son homogénéité par rapport aux cellules Caco-2 parentales, qui sont très hétérogènes, et de sa viabilité lors de l’incubation apicale avec des micelles
88
Modèles et outils utilisés 2011
mixtes par rapport à la lignée Caco-2 parentale (Haikal et al., 2008). De plus, il exprime de façon constitutive la Pgp au niveau apical (Raeissi et al., 1999). Le modèle Caco-2 est couramment utilisé comme modèle intestinal in vitro donnant des résultats reproductibles et en corrélation étroite avec ceux obtenus chez l’homme (Artursson et al., 1996). Ce modèle cellulaire a été largement utilisé pour étudier l’absorption des lipides tel que le cholestérol (Cai et al., 2004) et des micronutriments lipidiques tel que le tocophérol (vitamine E) (Narushima et al., 2008). Il est également utilisé pour les études de transport apical et basal des médicaments lipophiles (Fogh, 1975).
B. Outils utilisés
B.1. Les micelles biliaires
En ce qui concerne l’étude rapportant sur le rôle de NPC1L1 et SR-B1 dans l’absorption du cholestérol et du tocophérol in vitro, sur des cellules Caco2/TC7, nous avons utilisé des micelles biliaires simples et mixtes qui diffèrent par leur composition en lipides. Les micelles simples contiennent de l’acide biliaire (le taurocholate) alors que les micelles mixtes contiennent de plus, soit de l’acide oléique, soit de l’acide oléique et d’autres lipides (tableau 5).
Lipides Micelles simples Micelles mixtes 1 Micelles mixtes 2
Taurocholate (acide biliaire) 5 mM 5 mM 5 mM Acide oléique 0.5 mM 0.5 mM Phosphatidylcholine 0.04 mM Lysophosphatidylcholine 0.16 mM Monooléine 0.3 mM
Tableau 5 : Composition lipidique des micelles utilisées lors de notre étude
Les cellules Caco-2 ne sont pas équipées par les enzymes digestives nécessaires pour l’hydrolyse des lipides alimentaires avant leur absorption. Pour cela, les micelles ont été préparées à partir des produits d’hydrolyse des lipides et non pas à partir des lipides 89
Modèles et outils utilisés 2011
complexes comme les triglycérides. Les micelles simples et mixtes sont utilisées afin de mimer les conditions physiologiques à jeun (sécrétion des HDL) et après un repas riche en lipides (sécrétion des chylomicrons et des HDL), respectivement (Iqbal et al., 2003; Iqbal and Hussain, 2005). Les micelles mixtes 1 ne contiennent pas des phospholipides, bien qu’in vivo, dans les périodes interprandiales, la bile est composée de phospholipides. Dans nos conditions, nous avons utilisé le modèle le plus simple possible de micelle (mixte 1) du point de vue physicochimique pour garder le rôle stimulant de l’acide oléique. Cependant, elle ne reflète pas la signification réelle de la bile formée. Les micelles mixtes M3 restent aussi un modèle simplifié de micelles puisque la concentration de phospholipides dans la bile est aux alentours de 15-20 mM. Cette concentration est plus élevée que celle utilisée dans les micelles M3 données aux cellules Caco-2, étant donné que ces cellules ne supportent pas les hautes concentrations de sels biliaires et que l’intestin est protégé par le mucus.
B.2. Les formulations
Afin d’étudier l’influence des lipides et des émulsifiants sur la biodisponibilité de l’ivermectine, nous avons utilisé 3 formulations d’ivermectine qui sont : (tableau 6). - La formulation dite « aqueuse » correspond à la dilution au 26,6 de la formulation commerciale d’ivermectine (oramec® Merial, France) dans de l’eau - La formulation dite « polysorbate » contient entre autres un agent émulsifiant non ionique, le polysorbate 80 qui permet la solubilisation de l’ivermectine (voir tableau 6) - La formulation dite « lipidique » contient l’huile de maïs Ces trois formulations contiennent 0.003% d’ivermectine et sont administrées par voie orale aux souris.
90
Modèles et outils utilisés 2011
Formulations
Constituants Aqueuse Polysorbate 80 Huile 7.5 µl 7.5 µl Ivermectine (oramec 0.08%) (6 µg d’IVM) (6 µg d’IVM) 1.4 µl Ivermectine (5mM in DMSO) (6 µg d’IVM)
Polysorbate 80 16 µl Propylène glycol 40 µl Benzyl alcool 6 µl Disodium phosphate anhydre 0.2 µl Sodium dihydrogène phosphate monohydrate 1.8 µl Huile de maïs 200 µl eau 200 µl 200 µl
Tableau 6 : Composition de différentes formulations d’ivermectine utilisées lors de notre étude
91
Résultats
92
Publication 1: Contribution de NPC1L1 et SR-B1 dans l’absorption intestinale du cholestérol et du tocophérol : études in vivo versus in vitro
L’absorption entérocytaire du cholestérol et de la vitamine E (tocophérol) contenus dans des micelles mixtes composées d’acides biliaires, d’acide gras et d’autres lipides tels que les monoglycérides, la phosphatidylcholine (PC) et la lyso-PC fait intervenir le transporteur NPC1L1 (Sane et al., 2006; Narushima et al., 2008). SR-B1 est également impliqué dans l’absorption du tocophérol ou du cholestérol in vitro et in vivo (Altmann et al., 2002; Bietrix et al., 2006).
L’une des approches de cette étude a consisté à étudier et à comparer le rôle de NPC1L1 et SR-B1 dans l’absorption du cholestérol et du tocophérol en utilisant d’une part, le modèle cellulaire Caco-2/TC7, originaire d’un adénocarcinome colique humain en présence de micelles biliaires et d’autre part, un modèle intégré de digestion in vivo chez la souris surexprimant SR-B1 ou encore traitée à l’ézetimibe pour mettre en évidence le rôle des transporteurs SR-B1 et NPC1L1, respectivement, dans l’absorption des composés lipophiles.
Dans le modèle cellulaire, nous avons utilisé 3 types de micelles contenant simultanément du cholestérol radiomarqué au tritium et un dérivé fluorescent estérifiable, le NBD-cholestérol, ou le tocophérol. Les micelles simples ne contiennent que de l’acide biliaire et orientent le cholestérol et le tocophérol vers la voie entérocytaire des HDL. Deux autres types de micelles mixtes ont été utilisés. Les premières contiennent de l’acide biliaire et de l’acide oléique, alors que les secondes contiennent de plus d’autres lipides comme les phospholipides et les monoglycérides. Les micelles mixtes orientent le cholestérol et le tocophérol vers la voie de synthèse des chylomicrons et, plus modérément, des HDL (Iqbal et al., 2003; Iqbal and Hussain, 2005). Chez la souris, la localisation de l’absorption du cholestérol et du tocophérol a été recherchée pendant la digestion in vivo tout au long des 20 premiers centimètres de l’intestin grêle correspondant au duodénum et une majorité du jéjunum. Leur niveau d’absorption a été corrélé aux niveaux d’expression de NPC1L1 et de SR-BI. L’implication de NPC1L1 a été suivie en mesurant l’absorption intestinale du cholestérol et du tocophérol chez les souris
93
témoins et les souris traitées à l’ézétimibe. Le rôle de SR-BI a été mis en évidence chez les souris transgéniques surexprimant spécifiquement ce transporteur, dans l’intestin grêle. Les différents fragments des intestins murins (duodénum, jéjunum proximal, médian et distal) ont été récupérés à 2 h après un gavage lipidique et dosés pour leur contenu en analogues du cholestérol (NBD- et [3H]-cholestérol) ou du γ-tocophérol.
Les résultats in vitro ont montré que l’absorption du [3H]cholestérol et du tocophérol en présence des micelles mixtes est plus importante que celles des micelles simples. Leur absorption à partir des micelles mixtes est inhibée par l’ézétimibe (inhibiteur de NPC1L1) et BLT1 (inhibiteur de SR-B1) de façon non additive. Ceci suggère un mécanisme similaire d’absorption de ces deux nutriments par une voie qui implique successivement NPC1L1 mais aussi SR-BI et qui pourrait conduire à la formation de chylomicrons. Par ailleurs, l’absorption du NBD-cholestérol diffère de celle du [3H]cholestérol et du tocophérol car il n’y a pas d’action apparente de NPC1L1 et SR-BI, quelque soit le type de micelles fournies aux cellules. Les résultats in vivo ont montré que l’absorption du [3H]cholestérol est inhibée par l’ézétimibe tout au long de l’axe duodéno-jéjunal, en corrélation avec le niveau d’expression croissant de NPC1L1. Par contre, la surexpression intestinale de SR-B1 augmente l’absorption du cholestérol dans le jéjunum distal sans modification de l’expression de NPC1L1. Comme il a été montré précédemment in vitro, aucune implication de NPC1L1 et de SR-BI n’a été observée dans absorption du NBD-cholestérol, en accord avec les résultats de (Adams et al., 2011). Par ailleurs, nous montrons, pour la première fois, que le tocophérol est beaucoup plus absorbé par les parties médianes et distales du jéjunum par rapport au duodénum et au jéjunum proximal. Cette absorption n’est pas médiée par SR-B1 ni NPC1L1 suggérant l’existence d’un ou des transporteurs encore inconnus dans l’absorption du tocohpérol au niveau du jéjunum. En revanche, le transporteur NPC1L1 est impliqué dans l’absorption du tocophérol dans le jéjunum distal.
En conclusion, nous avons pu montrer que le cholestérol et le tocophérol suivent la même voie d’absorption in vitro en présence des micelles mixtes faisant intervenir les transporteurs NPC1L1 et SR-B1. Par contre, la contribution de ces transporteurs dans l’absorption du cholestérol et du tocophérol in vivo est différente tout au long de l’axe duodéno-jéjunal.
94
British Journal of Nutrition, page 1 of 9 doi:10.1017/S0007114511004405 q The Authors 2011
Respective contributions of intestinal Niemann-Pick C1-like 1 and scavenger receptor class B type I to cholesterol and tocopherol uptake: in vivo v. in vitro studies
Emmanuelle Reboul1,2,3*†, Zeina Soayfane4,5,6†, Aure´lie Goncalves1,2,3, Michela Cantiello4,5,7, Romain Bott1,3, Michel Nauze4,5,7, Franc¸ois Terce´4,5,7, Xavier Collet4,5,7 and Christine Come´ra4,5,6 1INRA, UMR1260 ‘Lipid Nutrients and Prevention of Metabolic Diseases’, Marseille F-13385, France 2INSERM, U1025 ‘Bioavailability of Micronutrients’, Marseille F-13385, France 3Universite´ Aix-Marseille, Marseille F-13385, France 4INSERM, U563, Toulouse F-31024, France 5Institut Fe´de´ratif de Recherche Bio-Me´dicale de Toulouse, Universite´ Paul Sabatier, IFR150, Toulouse F-31062, France 6TOXALIM, UMR1331-INRA-INP-UPS, Toulouse F-31027, France 7INSERM, UMR1048, Toulouse F-31432, France
(Received 4 March 2011 – Revised 9 June 2011 – Accepted 4 July 2011)
Abstract The intestinal absorption of cholesterol and lipid micronutrients such as vitamin E has been shown to share some common pathways. The present study aims to further compare the uptake of cholesterol ([3H]cholesterol v. 22-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-23,24- bisnor-5-cholen-3-ol (NBD-cholesterol)) and tocopherol in Caco-2 TC-7 cells and in mouse intestine, with special focus on the respective roles of scavenger receptor class B type I (SR-BI) and Niemann-Pick C1-like 1 (NPC1L1). Conversely to NBD-cholesterol, the uptakes of [3H]cholesterol and tocopherol by Caco-2 cells were impaired by both block lipid transport-1 and ezetimibe, which inhibit SR-BI and NPC1L1, respectively. These inhibitions occurred only when cholesterol or tocopherol was delivered to cells included in micelles that con- tained biliary acid and at least oleic acid as a lipid. In vivo, after 2 h of digestion in mice, the uptake of the two cholesterol analogues and of tocopherol all showed distinct patterns along the duodenum–jejunum axis. [3H]Cholesterol uptake, which correlated closely to NPC1L1 mRNA expression in wild-type (wt) mice, was strongly inhibited by ezetimibe. Intestinal SR-BI overexpression did not change NPC1L1 expression and led to a significant increase in [3H]cholesterol uptake in the distal jejunum. Conversely, neither ezetimibe treatment nor
British Journal ofSR-BI Nutrition overexpression had an effect on NBD-cholesterol uptake. However, in contrast with SR-BI mRNA expression, tocopherol absorption increased strongly up to the distal jejunum in wt mice where it was specifically inhibited by ezetimibe, and was increased in the proximal intestine of intestinal SR-BI-overexpressing mice. Thus, cholesterol and tocopherol uptakes share common pathways in cell culture models, but display different in vivo absorption patterns associated with distinct contributions of SR-BI and NPC1L1.
Key words: Vitamin E: Cholesterol: Intestinal absorption: Membrane transporters
Over the last few years, there have been significant advances in mechanisms by which micellar cholesterol crosses the our understanding of the mechanisms governing the intestinal brush-border membrane remain unknown. Other membrane absorption of dietary lipids and lipid micronutrients. Intestinal transporters, such as scavenger receptor class B type I (SR-BI), cholesterol absorption was initially thought to occur by passive have also been identified, to a lesser extent, as playing roles in diffusion. It is now well acknowledged that micellar cholesterol cholesterol uptake(3,4) and lipid sensing(5) in the enterocyte. uptake by the enterocyte depends mainly on Niemann-Pick The roles of NPC1L1 and SR-BI in the intestine are not C1-like 1 (NPC1L1) activity(1,2), although the molecular limited to cholesterol transport. It has recently been shown
Abbreviations: BLT1, block lipid transport 1; DMEM, Dulbecco’s minimum essential medium; iSR-BI tg, intestinal scavenger receptor class B type I- overexpressing transgenic; NBD, 22-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-23,24-bisnor-5-cholen-3-ol; NPC1L1, Niemann-Pick C1-like 1; SR-BI, scavenger receptor class B type I; wt, wild type.
* Corresponding author: E. Reboul, fax þ33 4 91 78 21 01, email [email protected]
† These authors contributed equally to the paper. 2 E. Reboul et al.
that both proteins were involved in the uptake of micellar vita- purchased from Sigma-Aldrich (Saint-Quentin-Fallavier, min E(6,7), but their relative involvement in tocopherol or France). Block lipid transport 1 (BLT1), a chemical inhibitor cholesterol uptake is not known. of lipid transport mediated by SR-BI, was from Chembridge However, note that some of the above observations vary (San Diego, CA, USA). Ezetimibe, a chemical inhibitor of strongly depending on model and experimental conditions cholesterol transport mediated by NPC1L1, was purchased used. In particular, in vitro and in vivo data are sometimes from Sequoia Research Products (Reading, UK). Both 1000- conflicting. For example, although it appears clear that SR-BI fold concentrated inhibitor stock solutions were prepared in is involved in cholesterol uptake in brush-border membrane dimethyl sulphoxide. vesicles(8), there are still doubts over its in vivo involvement, as the distribution of the cholesterol absorption along the small intestine in mice fed with a basal diet is not different Cell culture 2/2 (9) in SR-BI or wild-type (wt) animals . Conversely, although Preparation of micelles. Cholesterol or tocopherol was cholesterol uptake in brush-border membrane vesicles pre- delivered to the cells in three different types of micelles in 2/2 pared from small intestines of wt and NPC1L1 mice has Dulbecco’s minimum essential medium (DMEM) containing (8) been reported as equivalent , NPC1L1 visibly has a clear 5 % lipoprotein-deficient serum (prepared as previously (10) in vivo contribution . Indeed, both wt mice treated with described(14) with minor changes) at the final concentrations ezetimibe and NPC1L1-deficient mice displayed an inhibition presented in Table 1. The simplest M1 micelles contained from 50 to 70 % of cholesterol absorption. Residual pathways 5mM of taurocholic acid in DMEM associated with a mixture 3 independent of NPC1L1 and ezetimibe are thus responsible of 5 mM-cholesterol, 7·4 kBq/ml [ H]cholesterol (1·48 MBq/ (1) for absorption of the remaining 30 % of cholesterol and the mmol) and 10 mM-NBD-cholesterol, or 10 mM-a-tocopherol. totality of fluorescent 22-(N-(7-nitrobenz-2-oxa-1,3-diazol-4- The M2 micelles contained oleic acid (0·5 mM). The M3 (11) yl)amino)-23,24-bisnor-5-cholen-3-ol (NBD)-cholesterol . micelles also contained oleic acid (0·5 mM) and other lipids Considering both the similarities and uncertainties related to usually found during digestion process. Appropriate volumes cholesterol and vitamin E uptake, the aim of the present study of each lipid stock solution were dried under a stream of was to characterise and compare the uptake of [3H]cholesterol, N2. The lipids were first resuspended in 208 ml of DMEM NBD-cholesterol and tocopherol, both in vitro in Caco-2 cells containing 24 mM-taurocholate, mixed for 2 min with a (12,13) and in vivo in the mouse intestine. Previous studies vortex to form the micelles and then diluted to 1 ml in a sol- indicated that the transport pathways for cholesterol or vitamin ution of DMEM and 5 % lipoprotein-deficient serum to reach (15) E differ in enterocytes according to distinct micellar delivery. 5mM final of taurocholate . We thus evaluated cholesterol and vitamin E uptake by compar- ing the effects of inhibition of SR-BI or NPC1L1 in Caco-2 cells in combination with three different types of micellar vehicles. Culture conditions These uptake parameters were also analysed in vivo by Caco-2 cell line, clone TC-7(16), was a gift from Dr M. Rousset comparing incorporation along the duodenal–jejunal axis in (UMRS 872, Villejuif, France). Cells were cultured in T-75
British Journal ofwt Nutrition C57BL/6J mice against intestinal scavenger receptor class B flasks in DMEM supplemented with 10 % heat-inactivated type I-overexpressing transgenic (iSR-BI tg) mice and wt mice fetal bovine serum, 1 % non-essential amino acid and 1 % anti- treated with the NPC1L1 inhibitor ezetimibe. We show a biotics (complete medium), as previously described(17). clear-cut difference between in vitro and in vivo results, indicat- ing that the human Caco-2 line displays similar pathways for cholesterol and tocopherol uptake, which is not as evident in Uptake experiments the mice models. Indeed, in vivo results enabled us to clearly distinguish the respective locations of the intestinal absorption Cells were seeded in twenty-four-well plates at a density of of cholesterol and tocopherol, and to specify where and to 20 000 cells per well, and then differentiated for 20–21 d. what extent NPC1L1 and SR-BI (which are involved in vitro) Table 1. Lipid composition of the three types of micelles used in cell are physiologically involved during digestion. experiments*
Micelles Micelles Micelles Experimental methods no. 1 no. 2 no. 3 Lipids (M1, mM) (M2, mM) (M3, mM) Chemicals Taurocholate 5 5 5 2R,4 0R,8 0R-a-tocopherol ($99 % pure) and 2R,4 0R,8 0R-g-toco- Oleic acid – 0·5 0·5 Phosphatidylcholine – – 0·04 pherol ($97 % pure) were purchased from Flucka (Vaulx- Lysophosphatidylcholine – – 0·16 en-Velin, France). Tocol, used as internal standard for HPLC Monoolein – – 0·3 analysis, was purchased from Lara Spiral (Couternon, 3 Phosphatidylcholine, 2-oleoyl-1-palmitoyl-sn-glycero-3-phosphocholine; lysopho- France). [ H]Cholesterol was from Amersham (Les Ulis, sphatidylcholine, 1-palmitoyl-sn-glycero-3-phosphocholine. France). Monoolein, 2-oleoyl-1-palmitoyl-sn-glycero-3-phos- * Micelles were prepared as described in Experimental methods. Each type of micelle contained a mixture of 5 mM-cholesterol, 10 mM-NBD-cholesterol and 3 phocholine, 1-palmitoyl-sn-glycero-3-phosphocholine, oleic 74 kBq [ H]-cholesterol (1·48 MBq/mmol of total cholesterol) or 10 mM-a-toco- acid, NBD-cholesterol, sodium taurocholate and SDS were pherol. Cholesterol and vitamin E intestinal uptake 3
Cells were pre-incubated for 16 h in serum-free medium, and proximal jejunum (4 cm), the medium jejunum (6 cm) and then for 1 h in medium containing 5 % lipoprotein-deficient the distal part of the jejunum (6 cm). Samples for tocopherol
serum supplemented with dimethyl sulphoxide (control), analysis were flushed with a stream of N2 to prevent oxidation. 10 mM-BLT1 or 100 mM-ezetimibe. For lipid absorption All samples were stored at 2808C until analysis. measurement, cells were finally incubated for 1 h with differ- For cholesterol measurement, the fragments were resus- ent micelles supplemented or not with the inhibitors. After pended in 1–1·5 ml PBS, 0·25 % SDS and homogenised using incubation, the culture medium was harvested, the cells an Ultra-Turrax homogeniser (Labomoderne, Paris, France). were washed twice in 500 ml PBS containing 5 mM-taurocho- Radioactivity was determined by liquid scintillation counting, late, then lysed in 500 ml PBS containing 0·25 % SDS. Protein and the fluorescence of NBD-cholesterol was quantified concentrations were estimated on aliquots of cell samples using a spectrofluorimeter (Varioskan; Thermo Scientific, using a bicinchoninic acid kit (Pierce, Montluc¸on, France). Courtabœuf, France), with excitation and emission wave- lengths of 470 and 556 nm, respectively. For tocopherol measurement, samples were resuspended in 500 ml PBS and Cholesterol and 2R,40R,80R-g-tocopherol uptake in mice ground with two 3-mm-diameter stainless-steel balls in 2 ml All animal studies were performed in conformity with the Eppendorf tubes using a MM301 ball mill (Retsch, Eragny- Public Health Service Policy on Human Care and Use of Lab- sur-Oise, France). oratory Animals and in accordance with the local ethics com- mittee of the Toulouse animal facility platform (Anexplo). Tocopherol extraction and HPLC analysis Tocopherol was extracted from 500 ml aqueous samples using Preparation of emulsions tocol as an internal standard, as previously described(6,18). For cholesterol and tocopherol delivery to mice, emulsions Tocopherol and tocol were then separated using a (6) were prepared as described previously with minor changes. 250 £ 4·6 nm RP C18,5mm Zorbax column (Interchim, Montlu- Briefly, for each mouse, 100 ml of 9 % NaCl was added to c¸on, France) and a guard column. The mobile phase was 100 ml of maize oil containing a mixture of 30 mg of choles- 100 % methanol. Flow rate was 1·5 ml/min, and the column terol, 10 kBq of [3H]cholesterol (0·118 MBq/mmol of total was kept at a constant temperature (308C). The HPLC system cholesterol) and 5 mg of NBD-cholesterol, or 5 mg of g-toco- comprised a Dionex separation module (P680 HPLC Pump pherol. Emulsions were formed by bath sonication (Branson and ASI-100 Automated Sample Injector; Dionex, Aix-en-Provence, 3510; Branson, Danbury, CT, USA) for 15 min at 08C, and France) and a Jasco fluorimetric detector (Jasco, Nantes, France). were freshly used for force feeding. g-Tocopherol was Tocopherols were detected at 325 nm after light emission at chosen instead of a-tocopherol as (i) it shows no discrimi- 292 nm, and identified by retention time compared with nation in absorption and (ii) because g-tocopherol, in contrast pure (.95 %) standards. Quantification was performed using to a-tocopherol, is not detectable in the intestine by HPLC Chromeleon software (version 6.50 SP4 Build 1000; Dionex, before oral administration(6,18). Aix-en-Provence, France) comparing peak area with standard
British Journal of Nutrition reference curves. All solvents used were of HPLC grade from SDS (Peypin, France). Animals Mice overexpressing SR-BI in the intestine were generated as RNA extraction and quantitative real-time RT-PCR previously described(4). C57BL/6 Rj (wt) mice were purchased from Janvier (Le-Genest-St-Isle, France). They were housed in Total RNA was isolated from the four different fragments of a temperature-, humidity- and light-controlled room. They intestine using the TRIzol method (Invitrogen, Cergy-Pontoise, were given a standard chow diet with water ad libitum and France). Complementary DNA was reverse-transcribed from were fasted overnight before oral administration. To assess 2 mg of total RNA and diluted to 20 ng/ml using sterilised the effect of ezetimibe, mice received two intraperitoneal water. Quantitative real-time RT-PCR was performed on injections of 10 mg/kg ezetimibe at 27 and 4 h before oral 12·5 ng of complementary DNA in a final volume of 12·5 ml, administration. At 2 h after oral administration, the mice using Power SYBR Green PCR Master Mix and an ABI-Prism were killed and the first 20 cm of their intestine was harvested 7000 thermal cycler (Applied Biosystems, Villebon-sur-Yvette, downstream of the biliary canal. Intestines were carefully France) under standard PCR conditions. Primer sequences are washed with PBS and 5 mM-taurocholate, and cut into four reported in Table 2. All data were normalised to cyclophilin fragments corresponding to the duodenum (first 4 cm), the expression levels and were analysed using LinRegPCR(19).
Table 2. Oligonucleotide sequences for quantitative real-time PCR
Gene NCBI Refseq Forward primer (50 –30) Reverse primer (50 –30)
Cyclophilin NM_011149 tggagagcaccaagacagaca tgccggagtcgacaatgat SR-BI NM_016741 tctacatcaaatctgtcaagggcat actggctcgatcttccctgtt NPC1L1 NM_207242 gacagatcccaactttgaggt aaccgtcaggtattgctggtaga
SR-BI, scavenger receptor class B type I; NPC1L1, Niemann-Pick C1-like 1. 4 E. Reboul et al.
Membrane preparation and protein analysis M1 micelle-mediated uptake, but strongly decreased toco- pherol uptake in M2 and very strongly decreased tocopherol The mice were killed and the intestine was removed and cut uptake in M3 micelles (M2, 227 and 246 % and M3, 255 into four fragments, as described above. Each section was to 277 % for ezetimibe and BLT1, respectively). BLT1 and opened and the mucosa was scraped, immediately frozen in ezetimibe has no additive effect. liquid N2 and stored at 2808C. Tissues were then homogen- ised at 48C in PBS, as previously described(4). Proteins were determined using a bicinchoninic acid kit, and 50 mg were used for western blot analysis. Proteins were separated by In vivo uptake of [3H]- and NBD-cholesterol or tocopherol SDS-PAGE using 12 % gels under reducing conditions accord- in wild-type mice and transgenic mice overexpressing ing to Laemmli(20) and were electrophoretically transferred to scavenger receptor class B type I in the intestine polyvinylidene fluoride membranes according to Burnette(21). We investigated in vivo the intestinal absorption of cholesterol The blotting membrane was incubated with rabbit polyclonal and tocopherol in wt C57BL/6J mice treated or not with ezeti- anti-SR-BI IgG (NB400-104; Novus Biologicals, Littleton, CO, mibe and in a mouse model of intestinal overexpression USA) or with a 1:500 dilution of rabbit serum against of SR-BI that we have previously developed(4). We first NPC1L1 generously donated by Dr Helen Hobbs. For quantified the expression of SR-BI and NPC1L1 mRNA in visualisation, monoclonal anti-rabbit IgG (Sigma) were used four different fragments of mouse intestine (duodenum and as secondary antibodies at 1:5000 dilution. proximal, medium and distal jejunum) from wt or iSR-BI tg mice (Fig. 2). SR-BI mRNA and protein expression decreased Statistical analysis along the duodenum–jejunum axis in wt mice, as already described(4), but was strongly increased in all intestinal frag- Differences between more than two groups of unpaired data ments of iSR-BI tg mice (Fig. 2(a)). This mRNA expression were tested by the non-parametric Kruskal–Wallis test. The was similar to our previous observations on total intestine non-parametric Mann–Whitney U test was used as a post (25-fold overexpression). In contrast, NPC1L1 mRNA and pro- hoc test when the Kruskal–Wallis test showed significant tein expression slightly increased from duodenum to medium differences between groups. Differences between only two jejunum in wt mice, but were not modified by intestinal SR-BI groups of unpaired data were tested by the Mann–Whitney overexpression (Fig. 2(b)). U test. Values of P,0·05 were considered to be significant. To focus on the intestinal absorption process, we then All statistical analyses were performed using Statview software analysed the uptake of [3H]-, NBD-cholesterol or tocopherol version 5.0 (SAS Institute, Cary, NC, USA). at 2 h after feeding in wt mice, which is a time long enough to obtain significant uptake values without significant Results secretion. Indeed, as the half-time of gastric emptying after a liquid meal is about 15 min in mice(22), 2 h after oral adminis- Effect of micellar composition on [3H]- and tration were sufficient to allow mixed micelles to form, make NBD-cholesterol or tocopherol uptake via scavenger
British Journal of Nutrition contact with both the duodenal and jejunal mucosa and be receptor class B type I and Niemann-Pick C1-like 1 in taken up by enterocytes. [3H]-Cholesterol displayed an Caco-2 cells increased uptake from duodenum to medium jejunum, We first investigated the role of SR-BI and NPC1L1 on the which was well correlated to NPC1L1 mRNA expression uptake of cholesterol associated with three different types of (Fig. 3(a)). Conversely, the uptake of NBD-cholesterol was micelles (Table 1) by Caco-2 cells. When compared to M1 similar in the first three duodenal and jejunal fragments and micelles, adding oleic acid to taurocholate (M2 micelles) sig- decreased by 30 % in the distal fragment (Fig. 3(d)). In con- nificantly increased the uptake of both [3H]- and NBD-choles- trast, the uptake profile of tocopherol strongly increased terol (Fig. 1(a) and (b)). More complex micelles (M3) induced along the duodenum–distal-jejunum axis (16-fold increase a further increase in the uptake of both cholesterol analogs. between the first and the last fragment (Fig. 3(g)), partly in Inhibition of SR-BI (BLT1, 10 mM) or NPC1L1 (ezetimibe, agreement with the increased NPC1L1 mRNA expression, but 100 mM) had no effect on M1 micelle-mediated uptake or inversely correlated to SR-BI mRNA expression (Fig. 2). NBD-cholesterol uptake in M2 or M3 micelles, but impaired Cross-comparing uptake values between wt and iSR-BI tg [3H]cholesterol uptake in M2 (230 % inhibition) and M3 mice revealed a significant increase in the incorporation of (50 % inhibition) micelles. This indicated that the uptake of [3H]cholesterol in the distal jejunum of iSR-BI tg mice [3H]cholesterol and not NBD-cholesterol, which was associ- (Fig. 3(b)), in agreement with the stronger overexpression of ated with micelles containing at least oleic acid, was partially SR-BI mRNA in the distal jejunum (150-fold increase) than in dependent on SR-BI or NPC1L1. The effects of the inhibitors the duodenum (16-fold increase). NBD-cholesterol uptake were not additive, suggesting similar routing pathways for remained unchanged in the iSR-BI tg mice (Fig. 3(e)), whereas both proteins. tocopherol uptake was significantly increased in the duode- When the experiment was performed with tocopherol num (3·2-fold) and proximal jejunum (2·4-fold) in iSR-BI tg (Fig. 1(c)), we again observed a significantly increased mice compared to wt mice (Fig. 3(h)), indicating a major (although less pronounced) uptake among M1, M2 and M3 difference in the absorption of these lipid molecules related micelles. The inhibition of SR-BI or NPC1L1 did not affect to the intestinal overexpression of SR-BI. Cholesterol and vitamin E intestinal uptake 5
(a) † 0·5 † 0·4 * 0·3 * * * * * 0·2 0·1 (nmol/mg protein) H]cholesterol uptake H]cholesterol 3
[ 0·0
(b)
0·75 † † 0·50
0·25
(nmol/mg protein) 0·00 NBD-cholesterol uptake NBD-cholesterol (c) 4 † † 3 * 2 * * * 1 * * (nmol/mg protein) Tocopherol uptake Tocopherol 0
BLT1 10 µM – + ––+ + –––+ + + Ezetimibe 100 µM –– ++ –– ++ –++– M1 M2 M3
Fig. 1. Effect of micellar lipid composition and transporter inhibitors on [3H]cholesterol, 22-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-23,24-bisnor-5-cholen-3-ol
British Journal of(NBD)-cholesterol Nutrition and a-tocopherol uptake in Caco-2 cells. The combined effects of lipid micellar composition (M1, M2 and M3, see Table 1), scavenger receptor 3 class B type I inhibitor (block lipid transport 1 (BLT1), 10 mM) and Niemann-Pick C1-like 1 inhibitor (ezetimibe; 100 mM)on(a)[H]cholesterol (b) NBD-cholesterol and (c) tocopherol uptake were evaluated in differentiated Caco-2 cells. [3H]- and NBD-cholesterol were mixed in each type of micelle (see Experimental methods section). Incubation time was 1 h. Values are means, with their standard errors represented by vertical bars (n 3). * Mean values were significantly different from those of micelles without inhibitor (P#0·05). † Mean values were significantly different from those of M1 micelles (P#0·05).
Finally, ezetimibe treatment of wt mice strongly decreased tocopherol, by the enterocyte in vitro and in vivo, and to con- the absorption of [3H]cholesterol (by over 50 %) in all four sider the relative involvement of two major membrane lipid intestinal fragments (Fig. 3(c)). This suggested an active transporters, i.e. NPC1L1 and SR-BI, in this process. The participation of NPC1L1 in [3H]cholesterol absorption in the Caco-2 cell line is a widely used human intestinal in vitro duodenum and jejunum. Ezetimibe also inhibited tocopherol model giving reproducible results that usually correlate closely absorption, but only in the distal jejunum, where it is mainly with human in vivo figures(23). This cell model has been absorbed in control wt mice (Fig. 3(i)). In contrast, NBD- extensively used to study the absorption of both choles- cholesterol uptake was not inhibited by ezetimibe, but slightly terol(24 – 26) and tocopherol(7,27,28). The clone TC-7 was increased by up to 20 % in duodenum (Fig. 3(f)). chosen specifically because it is more homogenous than the parent Caco-2 cell line(29) and because it shows good viability after apical incubation with mixed micelles(16). A key step Discussion appears to be related to the composition of the lipid donors Understanding the molecular mechanisms of lipid absorption interacting with uptake efficiency(12,13,15,25,30,31). Here, we by the enterocyte is a critical challenge, as both cholesterol used three types of micelles as donor vehicles. The simplest (one-third of total body cholesterol comes from diet) and M1 micelles contained only the bile salt taurocholate. fat-soluble vitamins may be involved. The objectives of More conventional M2 micelles contained, in addition, 10 % the present study were to compare the absorption of two oleic acid. Finally, the M3 micelles mimicking the mixed lipid nutrients, i.e. cholesterol ([3H]- or NBD-analogues) and micelles found in dietary conditions(17) were M2 micelles 6 E. Reboul et al.
3 (a) 85 kDa cholesterol, more embedded for [ H]cholesterol) and/or to 8 1234 1234 differential binding to the hydrophobic extracellular loops wt mice iSR-BI tg mice found in SR-BI(32) and NPC1L1(2). These results are consistent * * with previous data showing that NBD-cholesterol uptake is 6 independent of NPC1L1 and ezetimibe(11), which raises the question of the usefulness of NBD-cholesterol as an analog * 4 * of cholesterol. In contrast to both cholesterol analogs, toco- pherol uptake was less influenced by micellar composition. In this case, the long hydrophobic chain of tocopherol 0·50 mRNA expression (SR-BI/cyclophilin) (which is close to a fatty acid structure) may favor an optimal 0·25 association with the M1 taurocholate micelles. 0·00 We found no additive effect of BLT1 and ezetimibe on either [3H]-cholesterol or tocopherol uptake. Although BLT1(33,34) (b) 140 kDa and ezetimibe(35) are described as highly specific inhibitors 12341234 of SR-BI and NPC1L1, respectively, it has also been suggested 10 wt mice iSR-BI tg mice that they could display a broad target of specificity(36). Indeed, it has already been shown that ezetimibe could block scaven- 8 ger receptors(25), and that ezetimibe could inhibit cholesterol uptake by brush-border vesicles in the absence of 6 NPC1L1(8). Our data corroborate with a possible cross-inhi- 4 bition of SR-BI and NPC1L1. Another possible explanation for the non-additive effect of BLT1 and ezetimibe is that
mRNA expression NPC1L1 and SR-BI participate cooperatively in the same 2 (NPC1L1/cyclophilin) lipid transport pathway. Blocking one would then impair the 0 functioning of the other. Interestingly, the knockdown of PM D NPC1L1 in Caco-2 cells has been found to inhibit free choles- Duodenum Jejunum terol absorption and decrease SR-BI expression, effectively suggesting cooperation between the two proteins(26). Fig. 2. Scavenger receptor class B type I (SR-BI) and Niemann-Pick C1-like 1 (NPC1L1) expression along the duodenal–jejunal axis in wild-type (wt) and Finally, the effect of oleic acid on the SR-BI- and NPC1L1- transgenic (tg) mice overexpressing SR-BI in the intestine. Relative expression dependent uptake of cholesterol and tocopherol could also profiles of (a) SR-BI and (b) NPC1L1 mRNA were analysed by real-time quan- be attributed to a specific increase in chylomicron synthesis, titative RT-PCR in wt ( ) and intestinal SR-BI-overexpressing tg mice (iSR-BI as already observed(10,11). Indeed, cholesterol and tocopherol tg, ) in the duodenum (4 cm) and in proximal (P, 4 cm), medium (M, 6 cm) and distal (D, 6 cm) jejunum fragments. Values were normalised to cyclophilin were recently shown to follow two distinct absorption path- expression and are expressed as mean values with their standard errors rep- ways in vitro in Caco-2 cells(10,11), and also in vivo (12,13,37), resented by vertical bars, n 4 for each group. * Mean values were significantly British Journal of Nutrition with an apoB-dependent routing being specifically stimulated different from those of wt intestinal fragments (P#0·05). Insets: Western blots 3 of protein expression profiles in different intestinal fragments ((1) duodenum, in the presence of oleic acid. The absorption of [ H]cholesterol (2) proximal jejunum, (3) medium jejunum, (4) distal jejunum). or tocopherol through NPC1L1 or SR-BI observed here may involve this pathway, as absorption is only inhibited in the presence of micelles containing oleic acid. Furthermore, it added with three lipids (2-oleoyl-1-palmitoyl-sn-glycero-3- has recently been shown that oleic acid is able to decrease phosphocholine, 1-palmitoyl-sn-glycero-3-phosphocholine NPC1L1 expression in Caco-2 cells in conditions similar to (38) and monoolein). We clearly demonstrated that specific our M2 micelles (taurocholate and 0·5 mM-oleate) . absorption of [3H]cholesterol or tocopherol is mediated by In conclusion, this Caco-2 cell study shows that, in the pre- SR-BI or NPC1L1 (between 30 and 70 % inhibition by BLT1 sence of oleic acid, SR-BI and NPC1L1 seem to be involved in and ezetimibe) when associated with micelles containing at a common absorption pathway that ensures both cholesterol least oleic acid (physiological M3 performing better than and tocopherol uptake. M2). Interestingly, we observed a strong effect of micelle com- In vivo studies were then conducted to pinpoint the respect- plexity on the uptake capacity of [3H]- and NBD-cholesterol ive and physiological contributions of SR-BI and NPC1L1 to (more complex micelles were more absorbed, as shown by cholesterol and tocopherol absorption, using wt mice, iSR-BI the 2·5- to 5-fold increase in absorption of M2 and M3 tg mice or wt mice treated with ezetimibe. SR-BI mRNA over- micelles, respectively, compared to M1). However, NBD- expression was found in all four intestinal fragments, as cholesterol uptake was totally independent of SR-BI or already observed (25-fold increase in the whole intestine), NPC1L1, indicating at least two distinct pathways for the two and was correlated to a peak increase in SR-BI protein in cholesterol analogs. This could be attributed to structural the proximal intestine(4). Interestingly, intestinal SR-BI overex- differences between the two molecules (NBD-cholesterol pression did not modify NPC1L1 expression, which increased bears two polar ends, whereas cholesterol is strictly amphiphi- along the duodenum–jejunum axis, as observed in rats(1) and lic), which could either contribute to a difference of associ- human subjects(26). This differs from the inhibition of SR-BI ation within the micelles (more at the surface for NBD- expression observed in NPC1L1-knockdown Caco-2 cells(31). Cholesterol and vitamin E intestinal uptake 7
(a) (b) (c)
0·3 0·3 0·3
* 0·2 0·2 0·2 * *
* 0·1 0·1 0·1 * H]cholesterol uptake H]cholesterol (nmol/cm intestine) 3 [
0·0 0·0 0·0
(d) (e) (f) 0·5 0·5 0·5
0·4 0·4 0·4
0·3 0·3 0·3
0·2 0·2 0·2
(nmol/cm intestine) 0·1 0·1 0·1 NBD-cholesterol uptake NBD-cholesterol
0·0 0·0 0·0
(g) (h) (i) 70 70 70
60 60 60
50 50 50
40 40 40 * * 30 30 30 * 20 20 20 Tocopherol uptake Tocopherol (nmol/cm intestine) British Journal of Nutrition 10 10 10
0 0 0 PMD PMD PMD
Duodenum Jejunum Duodenum Jejunum Duodenum Jejunum Fig. 3. Comparison of [3H]-, 22-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-23,24-bisnor-5-cholen-3-ol (NBD)-cholesterol and tocopherol uptakes along the duo- denal–jejunal axis of mouse intestine in wild-type (wt), scavenger receptor class B type I-overexpressing transgenic (iSR-BI tg) and ezetimibe-treated mice. Mice were force-fed with either [3H]- and NBD-cholesterol- or g-tocopherol-enriched emulsions. After 2 h, the first 20 cm of the mouse intestine were harvested down- stream of the biliary duct, rinsed and cut into four fragments: the duodenum (4 cm), and proximal (P, 4 cm), medium (M, 6 cm) and distal (D, 6 cm) jejunum. Results are expressed in nmol of compound/cm of each intestinal fragment, given as mean values with their standard errors represented by vertical bars. * Mean values were significantly different from those of control (wt) fragment (P#0·05). (a, d, g) wt mice (n 9); (b, e, h) wt ( ) v. iSR-BI tg mice ( ), n 4–6/group; (c, f, i) wt mice ( ) treated with ezetimibe ( ), n 4–6/group. (a–c) [3H]Cholesterol; (d–f) NBD-cholesterol and (g–i) g-tocopherol.
In contrast to what was observed on Caco-2 cells, the two to SR-BI expression in wt mice. Ezetimibe treatment led cholesterol analogues, especially [3H]cholesterol, displayed to a drastic decrease of [3H]cholesterol uptake. These results very distinct uptake profiles compared to tocopherol in confirm the major in vivo involvement of NPC1L1 in this wt mice as well as in ezetimibe-treated or iSR-BI tg mice. process(1). The significant increase in [3H]cholesterol uptake, [3H]-cholesterol uptake increased progressively along the specifically in the distal jejunum in our iSR-BI tg mice, is in duodenum–jejunum axis and decreased in the distal jejunum, agreement with other reports suggesting a moderate collateral in correlation with NPC1L1 expression. NBD-cholesterol role of scavenger receptors in cholesterol absorption(9,39) and uptake was similar in the duodenum and the proximal and with the increased absorption of cholesterol that we had pre- medium jejunum, and slightly decreased in the distal jejunum viously observed in this model(4). This increase was actually fragment. In contrast, tocopherol uptake increased very shar- more pronounced at 4 h after oral administration, i.e. during ply along the intestinal axis. None of the profiles correlated digestion and after transport and secretion into the blood(4). 8 E. Reboul et al.
SR-BI or NPC1L1. Moreover, although both NPC1L1 and CCT T CCT T SR-BI are involved in the uptake of cholesterol and vitamin E in vitro, NPC1L1 is definitely critical for the absorption of ? ? ? ? cholesterol in vivo and contributes, although to a lesser extent, to vitamin E uptake. The iSR-BI transgenic model strengthens the argument for a collateral role of SR-BI. The difference observed between Caco-2 cells and the mouse model could be partly explained by the fact that Caco-2 cells PMDpresent a different protein pattern to in vivo enterocytes. In par- (17) Duodenum Jejunum ticular, Caco-2 cells highly express both SR-BI and NPC1L1(26), whereas other lipid transporters may not be Fig. 4. Uptakes of intestinal cholesterol and vitamin E along the duodenal– (40) jejunal axis. Micellar cholesterol ( ) and vitamin E ( ) are taken up by the expressed at all . The route of lipid delivery, i.e. artificial v. enterocyte by Niemann-Pick C1-like 1 (NPC1L1, ), scavenger receptor physiological micelles, could also be important, along with class B type I (SR-BI, ) or an unknown transporter ( ) in the different intesti- the transporter locations along the intestine and inside the nal fragments, namely, the duodenum (4 cm) and proximal (P, 4 cm), medium enterocytes. (M, 6 cm) and distal (D, 6 cm) jejunum. Uptake efficiency is symbolised by more or less extended ‘ þ ’. Arrows indicate the uptake receptor involved. Thus, despite the fact that cholesterol and vitamin E share common uptake pathways through SR-BI and NPC1L1 in vitro, their uptake profiles along the intestine are highly Conversely, tocopherol absorption showed a different pattern different, suggesting that other mechanisms co-occur during 3 to [ H]-cholesterol absorption in different mice models. Ezeti- the digestion–absorption process. Further investigations are mibe treatment had a small effect on vitamin E absorption in needed to understand the delayed tocopherol absorption to the proximal to medium intestine, but induced a significant the distal part of the intestine compared to cholesterol. Finally, 30 % decrease in the distal jejunum compared to wt mice, in the identification of additional intestinal transporters of fat agreement with the maximum uptake and the high expression nutrients remains an essential issue. of NPC1L1 observed in this fragment. This confirms that NPC1L1 is also a contributor to in vivo tocopherol absorption. These findings are consistent with a previous study that reported ezetimibe-sensitive absorption of tocopherol by rat Acknowledgements (7) intestine . The overexpression of SR-BI led to a significant The present study was funded by PNRA (National program for apparent increase in g-tocopherol uptake in the proximal diet and nutrition research) project no. 5.34 ‘ABSINTE’. M. C. (6) part of the intestine, in accordance with our previous data . received financial support under PNRA no. 5.34 ‘ABSINTE’ However, when compared to the basal uptake values in wt and Z. S. received a grant from the French Ministry of Research mice (8 and 10 mg/cm for duodenum and proximal jejunum, and Higher Education. C. C., E. R. and X. C. conceived the respectively; Fig. 3(c)), these 3·2- and 2·4-fold increases in study; E. R., Z. S., A. G., M. C., R. B., M. N. and C. C. conducted
British Journal ofiSR-BI Nutrition tg correspond to 25·6 and 24·4 mg/cm for both frag- the experiments; E. R., Z. S. and C. C. analysed the data. All ments, which is much lower than the uptakes observed in authors participated in the interpretation of the results. E. R., wt medium- and distal jejunum (58 and 130 mg/cm, respect- C. C., F. T. and Z. S. wrote the report. All authors read and ively). These results show for the first time that tocopherol approved the final manuscript. The authors are grateful to intestinal absorption mainly occurs in the distal part of P. Borel and D. Lairon for helpful discussions. The authors mouse intestine. SR-BI primarily contributes to vitamin E have no conflicts of interest to declare. low-level absorption in the proximal intestine, whereas NPC1L1 principally contributes to its high-level distal absorp- tion. However, the drastic increase in tocopherol absorption found in the medium and distal jejunal fragments strongly References suggests a regulated process, almost certainly involving 1. Altmann SW, Davis HR Jr, Zhu LJ, et al. (2004) Niemann-Pick another specific unknown receptor. C1 like 1 protein is critical for intestinal cholesterol absorp- Finally, based on the experiments in Caco-2 cells and as tion. Science 303, 1201–1204. 2. Davis HR Jr & Altmann SW (2009) Niemann-Pick C1 like 1 expected(11), neither overexpression of SR-BI nor ezetimibe (NPC1L1) an intestinal sterol transporter. Biochim Biophys treatment decreased the absorption of NBD-cholesterol, show- Acta 1791, 679–683. ing that neither SR-BI nor NPC1L1 are implicated in NBD- 3. Altmann SW, Davis HR Jr, Yao X, et al. (2002) The cholesterol uptake. NBD-cholesterol absorption was even identification of intestinal scavenger receptor class B, type stimulated when the ezetimibe-dependent pathway was inhib- I (SR-BI) by expression cloning and its role in cholesterol ited. Our results further underline that the chemical modifi- absorption. Biochim Biophys Acta 1580, 77–93. cation from cholesterol to NBD-cholesterol has a real impact 4. Bietrix F, Yan D, Nauze M, et al. (2006) Accelerated lipid absorption in mice overexpressing intestinal SR-BI. J Biol in apical receptor recognition and uptake by the enterocyte. Chem 281, 7214–7219. These in vivo results, summarised in Fig. 4, refine the data 5. Beaslas O, Cueille C, Delers F, et al. (2009) Sensing of dietary obtained in Caco-2 cells. NBD-cholesterol does not appear lipids by enterocytes: a new role for SR-BI/CLA-1. PLoS One to be a suitable cholesterol tracer of the uptake process by 4, e4278. Cholesterol and vitamin E intestinal uptake 9
6. Reboul E, Klein A, Bietrix F, et al. (2006) Scavenger receptor Cell Culture: A Practical Approach, pp. 111–133 [AJ Shaw, class B type I (SR-BI) is involved in vitamin E transport editor]. Oxford: IRL Press. across the enterocyte. J Biol Chem 281, 4739–4745. 24. Cai L, Eckhardt ER, Shi W, et al. (2004) Scavenger receptor 7. Narushima K, Takada T, Yamanashi Y, et al. (2008) Niemann- class B type I reduces cholesterol absorption in cultured pick C1-like 1 mediates alpha-tocopherol transport. Mol enterocyte CaCo-2 cells. J Lipid Res 45, 253–262. Pharmacol 74, 42–49. 25. Werder M, Han CH, Wehrli E, et al. (2001) Role of scavenger 8. Labonte ED, Howles PN, Granholm NA, et al. (2007) Class B receptors SR-BI and CD36 in selective sterol uptake in the type I scavenger receptor is responsible for the high affinity small intestine. Biochemistry 40, 11643–11650. cholesterol binding activity of intestinal brush border mem- 26. Sane AT, Sinnett D, Delvin E, et al. (2006) Localization and brane vesicles. Biochim Biophys Acta 1771, 1132–1139. role of NPC1L1 in cholesterol absorption in human intestine. 9. Nguyen DV, Drover VA, Knopfel M, et al. (2009) Influence of J Lipid Res 47, 2112–2120. class B scavenger receptors on cholesterol flux across the 27. Traber MG, Goldberg I, Davidson E, et al. (1990) Vitamin E brush border membrane and intestinal absorption. J Lipid uptake by human intestinal cells during lipolysis in vitro. Res 50, 2235–2244. Gastroenterology 98, 96–103. 10. Davis HR Jr, Basso F, Hoos LM, et al. (2008) Cholesterol 28. Kiyose C, Muramatsu R, Fujiyama-Fujiwara Y, et al. (1995) homeostasis by the intestine: lessons from Niemann-Pick Biodiscrimination of alpha-tocopherol stereoisomers during C1 Like 1 (NPC1L1). Atheroscler Suppl 9, 77–81. intestinal absorption. Lipids 30, 1015–1018. 11. Adams MR, Konaniah E, Cash JG, et al. (2011) Use of NBD- 29. Gres MC, Julian B, Bourrie M, et al. (1998) Correlation cholesterol to identify a minor but NPC1L1-independent between oral drug absorption in humans and apparent cholesterol absorption pathway in mouse intestine. Am J drug permeability in TC-7 cells, a human epithelial intestinal Physiol Gastrointest Liver Physiol 300, G164–G169. cell line: comparison with the parental Caco-2 cell line. 12. Iqbal J, Anwar K & Hussain MM (2003) Multiple, indepen- Pharm Res 15, 726–733. dently regulated pathways of cholesterol transport across 30. Haikal Z, Play B, Landrier JF, et al. (2008) NPC1L1 and SR-BI the intestinal epithelial cells. J Biol Chem 278, 31610–31620. are involved in intestinal cholesterol absorption from small- 13. Anwar K, Kayden HJ & Hussain MM (2006) Transport of size lipid donors. Lipids 43, 401–408. vitamin E by differentiated Caco-2 cells. J Lipid Res 47, 31. Landrier JF, Malezet-Desmoulins C, Reboul E, et al. (2008) 1261–1273. Comparison of different vehicles to study the effect of toco- 14. Hannah VC, Ou J, Luong A, et al. (2001) Unsaturated fatty pherols on gene expression in intestinal cells. Free Radic Res acids down-regulate srebp isoforms 1a and 1c by two mech- 42, 523–530. anisms in HEK-293 cells. J Biol Chem 276, 4365–4372. 32. Gu X, Trigatti B, Xu S, et al. (1998) The efficient cellular 15. Chateau D, Pauquai T, Delers F, et al. (2005) Lipid micelles uptake of high density lipoprotein lipids via scavenger stimulate the secretion of triglyceride-enriched apolipopro- receptor class B type I requires not only receptor-mediated tein B48-containing lipoproteins by Caco-2 cells. J Cell surface binding but also receptor-specific lipid transfer Physiol 202, 767–776. mediated by its extracellular domain. J Biol Chem 273, 16. Salvini S, Charbonnier M, Defoort C, et al. (2002) Functional 26338–26348. characterization of three clones of the human intestinal 33. Nieland TJ, Penman M, Dori L, et al. (2002) Discovery Caco-2 cell line for dietary lipid processing. Br J Nutr 87, of chemical inhibitors of the selective transfer of lipids 211–217. mediated by the HDL receptor SR-BI. Proc Natl Acad Sci U 17. Reboul E, Abou L, Mikail C, et al. (2005) Lutein transport by SA99, 15422–15427.
British Journal of Nutrition Caco-2 TC-7 cells occurs partly by a facilitated process invol- 34. Nieland TJ, Shaw JT, Jaipuri FA, et al. (2008) Identification of ving the scavenger receptor class B type I (SR-BI). Biochem J the molecular target of small molecule inhibitors of HDL 387, 455–461. receptor SR-BI activity. Biochemistry 47, 460–472. 18. Reboul E, Trompier D, Moussa M, et al. (2009) ATP-binding 35. Garcia-Calvo M, Lisnock J, Bull HG, et al. (2005) The target cassette transporter A1 is significantly involved in the intesti- of ezetimibe is Niemann-Pick C1-like 1 (NPC1L1). Proc nal absorption of alpha- and gamma-tocopherol but not in Natl Acad Sci U S A 102, 8132–8137. that of retinyl palmitate in mice. Am J Clin Nutr 89, 177–184. 36. Nieland TJ, Chroni A, Fitzgerald ML, et al. (2004) Cross-inhi- 19. Ruijter JM, Ramakers C, Hoogaars WM, et al. (2009) Amplifi- bition of SR-BI- and ABCA1-mediated cholesterol transport cation efficiency: linking baseline and bias in the analysis of by the small molecules BLT-4 and glyburide. J Lipid Res quantitative PCR data. Nucleic Acids Res 37, e45. 45, 1256–1265. 20. Laemmli UK (1970) Cleavage of structural proteins during 37. Iqbal J & Hussain MM (2005) Evidence for multiple comp- the assembly of the head of bacteriophage T4. Nature 227, lementary pathways for efficient cholesterol absorption in 680–685. mice. J Lipid Res 46, 1491–1501. 21. Burnette WN (1981) ‘Western blotting’: electrophoretic trans- 38. Chen J, Li Q, Zhang Y, et al. (2010) Oleic acid decreases fer of proteins from sodium dodecyl sulfate–polyacrylamide the expression of a cholesterol transport-related protein gels to unmodified nitrocellulose and radiographic detection (NPC1L1) by the induction of endoplasmic reticulum stress with antibody and radioiodinated protein A. Anal Biochem in CaCo-2 cells. J Physiol Biochem 67, 153–163. 112, 195–203. 39. van Bennekum A, Werder M, Thuahnai ST, et al. (2005) Class 22. Bennink RJ, De Jonge WJ, Symonds EL, et al. (2003) Vali- B scavenger receptor-mediated intestinal absorption of dation of gastric-emptying scintigraphy of solids and liquids dietary beta-carotene and cholesterol. Biochemistry 44, in mice using dedicated animal pinhole scintigraphy. J Nucl 4517–4525. Med 44, 1099–1104. 40. Nassir F, Wilson B, Han X, et al. (2007) CD36 is important for 23. Artursson P, Karlsson J, Ocklind G, et al. (1996) Studying fatty acid and cholesterol uptake by the proximal but not transport processes in absorptive epithelia. In Epithelial distal intestine. J Biol Chem 282, 19493–19501.
Publication 2: La déficience en Pgp contribute à la stéatose hépatique et l’obésité chez la souris
La P-glycoprotéine (Pgp, mdr1ab) est une protéine ubiquitaire, exprimée notamment au niveau de la muqueuse intestinale, du canalicule biliaire et de l’endothélium des capillaires cérébraux. Elle est ainsi responsable de la barrière d’absorption digestive et de la barrière hémato-encéphalique. Elle joue également un rôle important dans l’efflux de nombreux xénobiotiques et notamment certains médicaments en dehors de l’organisme (Schinkel and Jonker, 2003). Elle peut également transporter des molécules endogènes telles que le cholestérol, les phospholipides, les sphingolipides (Honig et al., 2003) et une variété de stéroïdes (Aye et al., 2009). Des polymorphismes de la Pgp, dans des populations humaines, sont associés à une hypercholestérolémie (Rodrigues et al., 2005) et à une obésité (Ichihara et al., 2008). Cependant, son rôle dans l'homéostasie des lipides n'a jamais été clairement établi. L’objectif de cette étude est d’évaluer l’impact de la déficience en Pgp sur l’homéostasie lipidique dans l’organisme.
La prise alimentaire, le poids corporel et les marqueurs lipidiques dans le plasma, la bile et le foie ont été mesurés chez les souris témoins et déficientes en Pgp pendant 35 semaines. L’expression des gènes impliqués dans le métabolisme des lipides et des xénobiotiques a été également mesurée.
Les résultats ont montré pour la première fois que les souris déficientes en Pgp développent un surpoids, une hypertrophie de la masse adipeuse, une hyperinsulinémie et une hyperglycémie qui caractérisent le syndrome métabolique associé à l’obésité. Ces souris présentaient également une stéatose hépatique caractérisée par une accumulation marquée des triglycérides dans le foie. De plus, une augmentation de l’expression des gènes impliqués dans la synthèse de novo des acides gras (scd-1, fasn) et dans leur captation hépatique (cd36) ainsi que dans le métabolisme hépatique des xénobiotiques (cyp2b10, cyp3a11) a été également observée chez les souris déficientes en Pgp. Par ailleurs, la déficience en Pgp a montré une élévation du cholestérol et des acides biliaires dans la bile. Cette élévation est corrélée à une augmentation de l’expression de la « Cholesterol 7α hydrolase » (cyp7a1) qui est impliquée dans la synthèse des acides biliaires à partir du cholestérol.
95
L’ensemble de ces résultats démontre un nouveau rôle de la Pgp dans l’homéostasie des lipides in vivo. Elle pourrait être un marqueur des désordres lipidiques et l’obésité. Ces résultats peuvent aider à définir de nouvelles fonctions pour la Pgp qui pourrait représenter un facteur favorisant l’obésité.
96
P-glycoprotein Dysfunction Contributes to Hepatic Steatosis and Obesity in Mice
Magali Foucaud-Vignault1, Zeina Soayfane1,2,3,Ce´cile Me´nez1, Justine Bertrand-Michel4, Pascal Guy Pierre Martin1, Herve´ Guillou1, Xavier Collet2,3, Anne Lespine1* 1 UMR1331, INP, UPS, TOXALIM, INRA, Toulouse, France, 2 UMR 1048I, NSERM, Toulouse, France, 3 Institut de Maladies Me´taboliques et Cardiovasculaires, UPS/INSERM, Toulouse, France, 4 IFR150, Toulouse, France
Abstract Although the main role of P-glycoprotein (Pgp) is to extrude a broad range of xenochemicals and to protect the organism against xenotoxicity, it also transports a large range of endogenous lipids. Using mice lacking Pgp, we have investigated the possible involvement of Pgp in lipid homeostasis in vivo. In a long term study, we have followed the food intake, body status and lipid markers in plasma and liver of wild-type and mdr1ab-/- mice over 35 weeks. Pgp-deficient mice showed excess weight, hypertrophy of adipose mass, high insulin and glucose levels in plasma. Some of these metabolic disruptions appeared earlier in Pgp-deficient mice fed high-fat diet. Moreover, hepatosteatosis with increased expression of genes involved in liver detoxification and in de novo lipid synthesis occurred in Pgp-deficient mice. Overall, Pgp deficiency clearly induced obesity in FVB genetic background, which is known to be resistant to diet-induced obesity. These data reinforce the finding that Pgp gene could be a contributing factor and possibly a relevant marker for lipid disorder and obesity. Subsequent to Pgp deficiency, changes in body availabilities of lipids or any Pgp substrates may affect metabolic pathways that favour the occurrence of obesity. This is of special concern because people are often facing simultaneous exposition to many xenochemicals, which inhibits Pgp, and an excess in lipid dietary intake that may contribute to the high prevalence of obesity in our occidental societies.
Citation: Foucaud-Vignault M, Soayfane Z, Me´nez C, Bertrand-Michel J, Martin PGP, et al. (2011) P-glycoprotein Dysfunction Contributes to Hepatic Steatosis and Obesity in Mice. PLoS ONE 6(9): e23614. doi:10.1371/journal.pone.0023614 Editor: Marcelo G. Bonini, University of Illinois at Chicago, United States of America Received May 11, 2011; Accepted July 21, 2011; Published September 16, 2011 Copyright: ß 2011 Foucaud-Vignault et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This research has been supported by Rangueil University through Zeina Soayfane PhD MESR grant and by the Re´gion Midi-Pyre´ne´es. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected]
Introduction endogenous molecules such as cholesterol, phospholipids and sphingolipids [8] and a variety of steroids [9]. Pgp participates in The P-glycoprotein (Pgp, ABCB1) is a membrane efflux the cellular uptake of exogenous cholesterol in recombinant cells transporter that belongs to the ATP-binding cassette family, overexpressing Pgp [10]. Pgp is predominantly localised in lipid which in humans is the product of the ABCB1 gene. P-glycoprotein rafts which are cholesterol-rich membrane microdomains and it is was first identified as a factor involved in multidrug resistance in involved in cholesterol transbilayer transfer through membranes. mammalian tumor cells [1] and was subsequently found to be In addition, cholesterol content of membranes affects Pgp physiologically expressed at the apical surface of epithelial cells [2]. transport activity by modulating the ATPase activity [11-13]. In The main role of Pgp is to actively pump xenobiotics out of cells vivo, after cholesterol oral loading in Pgp-deficient mice there was and out of the organism. Its widespread tissue distribution and no change in cholesterol intestinal absorption but an increase of large substrate specificity confer to this protein a strategic role in cholesterol ester concentration in the liver [14]. However, until the protection of the tissues and of the whole body against now, no clear phenotype has been reported for Pgp-deficient xenobiotic toxicity [3]. For example, Pgp is located in the intestine mice in the absence of drug challenge [5] ruling out any and provides a solid protection by extruding many food substantial contribution of Pgp in lipid turnover in vivo.Butitis contaminants or naturally occurring dietary substrates back into noteworthy that the FVB genetic background of the available the lumen. Similarly, Pgp on the blood-brain-barrier effluxes Pgp-deficient mice is known to be resistant to diet-induced lipid compounds out of the brain thereby limiting their neurotoxicity. disorders which certainly make elusive any change in lipid By extension, it also limits the intestinal absorption and brain homeostasis [15]. penetration of drugs which are Pgp substrates, thus limiting their Indeed, studies in human populations are in favour of a link efficiency. Using Pgp-deficient mice, the pivotal role of Pgp in the between cholesterol levels and ABCB1 gene polymorphisms [16- pharmaco- and toxicokinetics of many substrate drugs such as 18]. Most interestingly, a study performed in a Japanese cohort digoxin, dexamethasone, cyclosporine or ivermectin has been revealed that a single nucleotide polymorphism on ABCB1 gene demonstrated [4-7]. was associated with obesity [19]. In addition to all these data and Besides its clear role in the transport of pharmaceuticals and in favour of some involvement of Pgp in lipid homeostasis, during contaminants, Pgp is also involved in the movement of the course of studies performed in our laboratory, we observed an
PLoS ONE | www.plosone.org 1 September 2011 | Volume 6 | Issue 9 | e23614 P-glycoprotein Deficiency Leads to Obesity in Mice intriguing accumulation of abdominal fat in the Pgp-deficient and 10% fat for normal diet; 20% protein, 35% carbohydrate, and animals. 45% fat for HFD. Animals were weighted and food intake was Given the possibility that Pgp is involved in lipid trafficking and measured all along the experiment. Three animals of each group because accumulation of abdominal fat can foreshadow a were sacrificed at 15 and at 25 weeks. Blood was withdrawn and propensity to obesity, the aim of our work was to study the plasma and liver were collected and frozen for further analysis. impact of Pgp deficiency on lipid homeostasis in the whole organism. Therefore, we have performed a long term study and Plasma analysis followed body weight change and lipid parameters in Pgp-deficient Plasma insulin was quantified by using a kit ELISA for mouse -/- (mdr1ab ) and wild-type mice. We have then measured the insulin (EUROBIO, France). Plasma glucose was determined by expression of pivotal genes involved in lipid metabolism (acox, cd36, the glucose oxidase method. The following parameters: alkaline fasn, scd-1) and xenobiotic detoxification (cyp2b10 and cyp3a11) phosphatase (ALP), alanine transaminase (ALT), aspartate trans- which can be regulated either by lipids or by xenobiotics, aminase (AST), lactate dehydrogenase (LDH), lipase, HDL respectively. For the first time, we have demonstrated that the cholesterol (HDLc) LDL cholesterol (LDLc), triglycerides and free lack of Pgp is associated with overweight and liver steatosis in mice fatty acids, were measured using a COBAS-MIRA+ analyser arguing in favour of a role for Pgp in maintaining lipid homeostasis (Service Phe´notypage, IFR150/BMT, France). and preventing obesity. Lipid analysis in the liver Materials and Methods Lipids were extracted from the liver according to Bligh and Ethics Statement Dyer [20]. Briefly, liver tissue was homogenized in 2 ml of water In vivo studies were conducted in mice under European laws on and 5 ml of chloroform-methanol (1:1, v/v). Samples were the protection of animals (86/609/EEC). Protocols are performed vortexed and centrifuged at 1500 rpm for 2 minutes at 4uC. under procedure and principal for good clinical practice (CVMP/ The lower organic phase was removed, dried under nitrogen gas, VICH 59598). The protocols for experimentation on rodents used taken up in 160 ml ethyl acetate and dried again under nitrogen in this manuscript have been approved by the local institutional gas. The dried lipid samples were dissolved again in 20 ml ethyl animal care and ethics committee which is the ‘‘Direction acetate. Triglycerides, total cholesterol and cholesterol esters were De´partementale des Services Ve´te´rinaires de Haute-Garonne’’. analyzed and quantified by gas chromatography [21] (Plateau de The specific approval number for this study approval is B31555- Lipidomique, IFR150/BMT, Toulouse). 25. Oil red O staining and histological analysis Animal housing A part of the liver was embedding in OCT in Tissue-Teck Wild-type and the Pgp knock-out mdr1ab-/- mice with a FVB (Miles, inc., Kankakee, IL), then the entire block was frozen in genetic background were obtained from Taconic (NY, USA). In isopentane prior to storage at 280uC. The histological analyses rodents, there are two Pgps encoded by abc1a and abc1b genes and were performed on serial sections (6 mm thick), fixed in 10% mdr1ab-/- mice were deficient for the two gene products [5,6]. buffered formalin, stained with oil red O and counterstained with Mice were housed at INRA’s transgenic rodent facility at 2262uC hematoxylin (original magnification X200, Plateau d’Histopatho- under 12-hour light/dark cycles. Animals sampling was designed logie Expe´rimentale, IFR150/BMT, Toulouse). to reduce the influence of interfering parameters such as litter specificity (seven to nine different litters for a ten animals group). Liver mRNA abundance Mice received a standard chow diet recommended for the For RNA extraction, a part of the large lobe of the liver was breeding and rearing of rodents (Harlan Teklad TRM Rat/ collected and immediately frozen in liquid nitrogen before storage at Mouse Diet; Harlan Teklad, Gannat, France). Water and food 280uC. Total RNA was extracted with TRIzol reagent (Invitrogen, were available ad libitum. France) from liver tissues. For real-time quantitative PCR (Q-PCR), total RNA samples (2 mg) were reverse-transcribed with SuperScript Experimental design II (Invitrogen). All assays were performed on an ABI Prism 7000 Mice of both genotypes (10–12 males and 10 females per group) (Applied Biosystems, Courtaboeuf, France) using standard PCR were weighted and the food intake was measured weekly from conditions. Primers and Taqman probes for TATA-box binding weaning to 35 weeks of age. At 25 weeks, food was withdrawn 2 hr protein tbp (NM_013684), acox (NM_015729), cd36 (NM_007643), prior to euthanasia and 5 animals of each group were anesthetized fasn (NM_007988), scd-1 (NM_009127), pltp (NM_011125), cyp7a1 by intraperitoneal administration of xylazine and ketamine (NM_007825), cyp2b10 (NM_009999), cyp3a11 (NM_007818) were cocktail (53 and 10 mg/kg bw, respectively). Blood was collected purchased from Applied Biosystems Assays-on-Demand. Primers from the orbital sinus vein. Several white adipose pads for SYBR Green assays were as follows: tbp-F, 59-ACTTCGTG- (subcutaneous inguinal, perigonadal, perirenal, mesenteric) and CAAGAAATGCTGAA-39; tbp-R, 59-GCAGTTGTCC-GTGGC- liver were then excised and weighted. At 35 weeks, the rest of the TCTCT-39; acox-F, 59-CAGACCCTGAAGAAATCATGTGG- animals (n = 5-6 per groups) were processed as described above for 39; acox-R, 59-CAGGAACATGCCCAA-GTGAAG-39; cd36-F, blood and tissue sampling. Plasma and liver were frozen in liquid 59- GTTAAACAAAGAGGTCCTTACACATACAG-39; cd36-R, nitrogen and stored at 280uC until analysis. 59- CAGTGAAGGCTCAAAGATGGC-39; fasn-F, 59-AGTCAG- CTATGAAGCAATTGTGGA-39; fasn-R, 59-CACCCAGACGC- High-fat diet study CAGTGTTC-39; scd-1-F, 59-.CCGGAGACCCCTTAGATCGA- Mice were assigned to normal diet (wild-type n = 6 and 39; scd-1-R, 59- TAGCCTGTAAAAGATTTCTGCAAACC-39; mdr1ab-/- n = 6) and high-fat diet HFD (wild-type n = 6 and pltp-F, 59- GGATTAAAGTGTCCAATGTCTCCTG-39; pltp-R, mdr1ab-/- n = 6) (DIO Research diet, Jackson Laboratory, 59- GTGGAGAAAAAGTTATACATCCTCCTG-39; cyp7a1-F, Brogaarden, Denmark) for 12 and 25 weeks. Energy contents of 59- ACATGGTGACACTTTCACTGTCTTC-39; cyp7a1-R, 59- the specific diets were (% kcals): 20% protein, 70% carbohydrate, GAACTTCTGAAAGCTTAATTGTTTTGG-39; cyp2b10-F, 59-
PLoS ONE | www.plosone.org 2 September 2011 | Volume 6 | Issue 9 | e23614 P-glycoprotein Deficiency Leads to Obesity in Mice
TTTCTGCCCTTCTCAACAGGAA-39; cyp2b10-R, 59-ATG- age for male mice, and they were morphologically undistinguish- GACGTGAAGAAAAGGAAC-AAC-39; cyp3a11-F, 59-.TCACA- able from age-matched wild-type mice (Fig. 1A and 1B). After CACACAGTTGTAGGCAG-AA-39; cyp3a11-R, 59-GTTTAC- these respective ages, growth curves showed a significant increase GAGTCCCATATCGGTAGAG-39. A pool of all complemen- in body weight for females (p,0.05) and males (p,0.001) tary DNA samples was used to generate calibration curves. All Q- mdr1ab-/- in comparison with wild-type mice. The weight PCR data were normalized by TATA-box binding protein mRNA difference appeared earlier in females, as early as 8 weeks of levels. age, than in males (18 weeks) but the difference between wild-type and Pgp-deficient mice was greater in males. Daily food intake was Statistical analyses monitored throughout the experiment and no difference in calorie -/- The experimental values are expressed as mean 6 standard intake was observed in mdr1ab males or females, compared with error of the mean (s.e.m). Statistical analyses were performed using wild-type (Fig. 1C and 1D). Given that in our experiment the a three-way factorial ANOVA model. A three-way factorial weight differences were more pronounced in male mice when ANOVA model with repeated measures was used in the case compared with females, the subsequent analyses were performed where more than one observation came from the same animal. in males. Multiple comparisons of means were performed with Tukey test. Statistical significance was accepted as p,0.05. Influence of Pgp deficiency on tissue weight in mice To get insights into the origin of the overweight phenotype in Results Pgp-deficient male mice, liver and white adipose tissue from four anatomical sites (subcutaneous inguinal, periepididymal, perirenal Body weight and food intake in wild-type versus Pgp- and mesenteric) were weighed and their relative contribution to deficient mice the body weight were calculated in 25- and 35-week old mice Mice were fed with a standard chow diet throughout the study (Table 1). Liver weight was increased in Pgp deficiency to a similar and weekly recording of body weight (bw) was performed over 35 extent as whole body weight (Fig. 2A and 2B). In the meantime, weeks. No phenotypic abnormality was observed in young Pgp- the total mass of white adipose tissues was strongly increased at the deficient mice for up to 7 weeks of age for female, and 15 weeks of two periods in Pgp-deficient mice (Table 1). At 25 weeks of age,
Figure 1. Time kinetic of body weight and food intake in wild-type versus mdr1ab-/- mice. The weights were recorded weekly from weaning to 35-weeks of age for male (Fig. 1A) or female (Fig. 1B) wild-type (open symbols) and mdr1ab-/- (close symbols) mice fed a standard chow diet. Results are means 6 s.e.m of 5 to 10 animals. Differences are considered significant when *, p,0.05; **, p,0.01; ***, p,0.001. Daily food intakes of males (Fig. 1C) and females (Fig. 1D) were calculated weekly by monitoring the total food consumption for wild-type (open symbols) and mdr1ab-/- (close symbols) mice, measured as mean food consumption for two to three mice caged together. Results are expressed per gram of body weight and are the means of 3 values per subgroup. doi:10.1371/journal.pone.0023614.g001
PLoS ONE | www.plosone.org 3 September 2011 | Volume 6 | Issue 9 | e23614 P-glycoprotein Deficiency Leads to Obesity in Mice
Table 1. Liver and adipose tissue contributions to the body weight in wild-type versus mdr1ab-/- mice.
25 weeks 35 weeks
Wild-type (n = 6) Mdr1ab-/- (n = 5) F Wild-type (n = 6) Mdr1ab-/- (n = 5) F
Weight (g) 31.960.6 43.961.0a 1.38 36.261.3 44.162.0b 1.22 Liver (% of bw) 4.9460.28 4.8760.21 0.98 4.6360.16 4.8860.21 1.05 White adipose tissue (% of bw) subcutaneous inguinal 1.0560.41 2.7260.13b 2.58 1.3560.20 4.0560.50a 2.99 perigonadal 1.8660.31 2.1860.22 1.17 2.3760.27 3.5560.17b 1.50 perirenal 0.4260.09 0.9860.02b 2.32 0.9160.18 1.2960.10 1.42 mesenteric 0.7560.06 2.0260.22a 2.69 1.8860.19 2.2660.15 1.21 Total 4.0960.65 7.9160.53b 1.94 6.5160.69 11.1560.46a 1.71
Mice were sacrificed at 25 and 35 weeks of age and discrete fat pads from five anatomical sites were dissected and weighed. WAT refers to white adipose tissue. Total WAT weight represents the sum of the data reported for the four WAT sites considered in the study. Body weight is expressed in gram and tissue weights are expressed as percentage of body weight. F is the ratio of mdr1ab-/- versus wild-type. Results are means 6 s.e.m. Statistical relevance of data is assessed by p values. ap,0.05; bp,0.01. doi:10.1371/journal.pone.0023614.t001 the contribution of the subcutaneous inguinal, perirenal, mesen- deficient mice compared with wild-type. At 35 weeks of age, the teric and periepidydimal fat pads to the bw of mdr1ab-/- male mass of all the white fat pads were increased in Pgp deficiency but mice increased by 2.6-, 2.3-, 2.7- and 1.2-fold, respectively, in Pgp- the differences in their relative contribution to the body weight
Figure 2. Morphological comparison and liver lipid content in wild type and mdr1ab-/- males. 2A. Whole body. 2B. Respective livers at 35 weeks of age. 2C. Oil red O staining of liver sections. Livers were collected from 25- or 35-week old mice and kept frozen in OCT at 280uC until analysis. 2D. Lipid content of liver. Total cholesterol (upper histogram) and triglycerides (lower histogram) in liquid-frozen liver samples from 25- and 35- week old mice, were quantified by liquid chromatography in wild-type (open bars) and mdr1ab-/- (solid bars) males. Results are expressed as means 6 s.e.m of 5 to 7 mice. Differences are considered significant when p,0.05. ***, p,0.001. doi:10.1371/journal.pone.0023614.g002
PLoS ONE | www.plosone.org 4 September 2011 | Volume 6 | Issue 9 | e23614 P-glycoprotein Deficiency Leads to Obesity in Mice between wild-type and Pgp-deficient mice were less pronounced most of the fat droplets appear bigger when compare to liver at 35 than earlier, certainly related to the increase in mass of adipose weeks where fat droplets were smaller. Normal hepatocytes were tissues which was observed with age. restricted to periportal zones while wide centrilobular areas suggested fat storage. At 25 weeks, hepatic triglyceride concentra- Analysis of enzymes, lipids and glucose in plasma tions were 10-fold greater in mdr1ab-/- livers than in wild-type and Biological parameters were measured in mice plasma and were this difference was maintained at 35 weeks (Fig. 2D, 20.263.7 and reported in Table 2. At 25 weeks, none of the plasma parameters 4.360.6 nmol/mg, respectively, p,0.001). In addition, in Pgp explored were different between Pgp-deficient compared with deficient mice at both ages, the total cholesterol content in the liver wild-type mice, apart from insulin levels, which were strongly was unchanged (Fig 2D, ns) while cholesterol ester concentration increased (0.5860.39 and 6.6262.11 ng/mL, p,0.05). At 35 tended to be higher (2-fold, ns, not shown). In addition, the total bile weeks, the alkaline phosphatase (ALP) and alanine transaminase acids and cholesterol concentrations were significantly higher in (ALT) activities were increased in Pgp-deficient mice (p,0.01 and Pgp-deficient mice compared with wild-type (Fig. 3). ns, respectively, compared with wild-type). In the mean time, aspartate transaminase (AST) activity was significantly decreased Influence of high fat diet on Pgp-deficient mice (1.5 fold, p,0.05) and lipase and lactate dehydrogenase (LDH) In order to test the impact of a high fat diet, a new study was activities were unchanged. Total cholesterol concentration in conducted with mdr1ab-/- and wild-type mice fed a high fat-diet plasma was slightly but significantly higher in mdr1ab-/- mice (HFD) from weaning to 25 weeks. No difference in body weight compared with wild-type (4.0360.13 versus 3.4660.17 mmol/L, between the two different groups fed HFD was observed during p,0.05). At the same time, HDL cholesterol was significantly the experiment suggesting that the overweight observed in Pgp- enhanced in mdr1ab-/- mice whereas no change was observed for deficient mice fed normal chow diet was maximal. By contrast, plasma LDL cholesterol level. The triglycerides tended to be wild-type mice fed HFD gained weight compared to those fed decreased in the plasma of Pgp-deficient mice while the free fatty normal chow diet. At 25 weeks, plasma glucose concentrations -/- acid levels were unchanged. Overall, in mdr1ab mice, plasma were increased in both groups fed HFD when compared to mice glucose and insulin concentrations were increased compared with fed normal diet and the increase was greater in the Pgp-deficient wild-type (1.5- and 23-fold, respectively, p,0.05). mice (2.1-fold, p,0.01) than in wild-type mice (1.5-fold, p,0.05). In the mean time, the triglycerides level in plasma were unchanged Liver morphology and composition by HFD in wild-type mice and were increased in Pgp-deficient Major hepatic abnormalities were observed at necropsy of the mice fed HFD (Table 3, p,0.05). In Pgp-deficient mice fed HFD, Pgp-deficient liver at 35 weeks, with a pale steatotic colour of the the liver showed apparent abnormalities as soon as 15 weeks and liver and a regular pattern of pale dots displayed on all lobe surfaces at 25 weeks of age. In age-matched animals fed a normal diet, no (Fig. 2B). These abnormalities, which are strongly evocative of liver abnormality was observed in wild-type mice at 25 weeks hepatic steatosis, were also observed in some of the 25-week old while some of Pgp-deficient animals displayed apparent liver Pgp-deficient livers (1 over 3). Histological analyses of neutral lipid abnormality. Lipids measurements performed in the liver showed in oil red O stained sections of frozen livers, revealed at 25 and 35 that at 15-week old, Pgp-deficient mice fed HFD tend to have weeks clear accumulation of intracellular fat droplets restricted to higher liver triglyceride concentration compared with wild-type the centrilobular area of mdr1ab-/- livers (Fig. 2C). At 25-weeks, mice (30.166.1 and 18.266.1 nmol/mg, respectively, ns). At 25
Table 2. Biomarker analysis in plasma of wild-type and mdr1ab-/- mice.
25 weeks 35 weeks
Wild-type Mdr1ab-/- F Wild-type Mdr1ab-/- F
ALP (U/L) 18.3610.3 16.065.0 0.87 4.061.5 14.061.2 b 3.50 ALT (U/L) 30.767.4 101.3633.1 3.30 76.6623.6 134.8632.1 1.76 AST (U/L) 107.7627.2 199.0639.6 1.85 530.8670.7 277.6642.7 a 0.52 LDH (U/L) 9846268 20746558 2.11 47646596 38696641 0.81 Lipase (U/L) 21.061.2 26.362.4 1.25 29.062.0 37.6610.2 1.30 Cholesterol (mmol/L) 3.2660.11 3.2360.01 0.99 3.4660.17 4.0360.13 a 1.16 HDLc (mmol/L) 3.0560.09 2.7360.14 0.89 3.1160.18 3.6760.13 a 1.18 LDLc (mmol/L) 0.1060.01 0.1060.01 1.00 0.1660.02 0.1660.02 1.00 Triglycerides (mmol/L) 0.8660.07 0.9260.04 1.07 2.1360.30 1.4660.30 0.69 Free Fatty Acid (mmol/L) 2.8860.12 3.0060.15 1.04 1.1060.05 1.1260.06 1.02 Glucose (mmol/L) 18.361.7 16.161.3 0.88 13.461.1 20.963.0 a 1.56 Insulin (ng/mL) 0.5860.39 6.6262.11a 11.4 0.1760.02 4.7361.82 a 27.8
Individual plasma samples collected at 25 and 35 weeks were analyzed. Results are expressed as means 6 S.E.M. of 5 analysis for wild-type and mdr1ab-/- mice, except for ALP analysis where only 3 samples of each group were analysed. F is the ratio of mdr1ab-/- versus wild-type. ap,0.05; bp,0.01. ALP: Alkaline phosphatase; ALT: Alanine transaminase; AST: Aspartate transaminase; LDH: Lactate dehydrogenase; HDLc: High density lipoprotein cholesterol; LDLc: Low density lipoprotein cholesterol. doi:10.1371/journal.pone.0023614.t002
PLoS ONE | www.plosone.org 5 September 2011 | Volume 6 | Issue 9 | e23614 P-glycoprotein Deficiency Leads to Obesity in Mice
Figure 3. Lipid content in bile of wild-type and mdr1ab-/- mice. Cholesterol and bile acids were quantified in bile in wild-type (open bars) and mdr1ab-/- (solid bars) 35-week old male mice. Results are expressed as means 6 s.e.m of 5 mice. Differences are considered Figure 4. Influence of high fat diet (HFD) on hepatic significant when *, p,0.05; **, p,0.01; ***, p,0.001. triglyceride concentrations in wild-type and mdr1ab-/- mice. doi:10.1371/journal.pone.0023614.g003 Mice were fed with HFD during 25 weeks. Triglycerides have been quantified in liver samples from 15- or 25-week old wild-type (open weeks of age, triglyceride concentration in the liver was higher in bars) and mdr1ab-/- (solid bars) mice. Results are expressed as nmol per both strain fed HFD compared with 15-week old mice, but the mg of liver and are means 6 s.e.m of 3 values at 15-week old and 5 at 25-week old. Differences are considered significant when *, p,0.05; increase was more pronounced in the Pgp-deficient mice than in **, p,0.01. wild-type (70.6618.8 and 31.563.7 nmol/mg tissue, respectively, doi:10.1371/journal.pone.0023614.g004 p,0.01, Fig. 4). In the mean time, a 2-fold increase in cholesterol ester concentration was measured in the liver of Pgp-deficient mice mice to normal weight and early overweight phenotype, compared with wild-type (4.4260.4 and 8.7561.04 ng/mg respectively. At 12-week of age, only the expression level of scd-1 respectively, p,0.05, not shown). was significantly increased in mdr1ab-/- mice when compared with wild-type mice (2.5-fold, p,0.01, Fig. 5A) while at 25 weeks of age, Analysis of xenobiotics and lipids target genes simultaneous and significant increases of fasn, scd-1 and cd36 -/- To gain insight into the molecular mechanisms underlying the mRNA abundance occur in mdr1ab mice. At both ages, the effects of Pgp deficiency on hepatic lipid composition, we have expression of acox was unchanged by Pgp deficiency (Fig. 5B). In examined the liver expression of several representative genes addition, in Pgp-deficient mice at 35 weeks the expression of two involved in lipid homeostasis that are controlled by nuclear genes cyp7a1 and pltp encoding cholesterol 7 alpha-hydroxylase receptors activated by endogenous cholesterol and derivatives (CYP7A), involved in bile acid formation and phospholipid (liver X receptor, LXR) or by fatty acids (peroxisome proliferator- transfer protein (PLTP), involved in cholesterol elimination were activated receptors, PPARa and PPARc). We focused on genes increased by 2.5-fold in the same way as scd-1.Given that Pgp is coding for representative enzymes or transporters involved in fatty involved in xenobiotic transport, we also explored the expression acid synthesis (stearoyl-coenzyme A desaturase, SCD-1, and fatty of the cytochrome genes cyp2b10 and cyp3a11 which are modulated acid synthase, FASn), lipid uptake (cluster of Differentiation 36, by xenosensors such as the constitutive active/androstane receptor CD36) and peroxisomal b-oxidation (fatty acyl-CoA oxidase, (CAR, NR1I3), and the pregnane X receptor (PXR, SXR, ACOX) at 12 and 25 weeks, ages corresponding for Pgp-deficient NR1I2). At 12 weeks, both genes expressions were significantly increased with a massive increase of cyp2b10 (6-fold, p,0.001, Fig. 5A). At 25 weeks both genes were 3-fold induced in Pgp- Table 3. Influence of high fat diet on plasma glucose and deficient mice when compared with wild-type mice (Fig. 5B). triglyceride concentrations in wild-type and mdr1ab-/- mice at 25 weeks of age. Discussion The toxicological and pharmacological impacts of Pgp have Wild-type Mdr1ab-/- been well established for many xenobiotic [4–7]. On the basis of its Glucose (mmol/L) Standard diet 18.361.7 16.161.3 ability to transport a large range of lipids [8,9], a role in lipid homeostasis has been evocated for Pgp but has never been clearly HFD 26.961.7 * 34.361.3 a** established in vivo. Triglyceride (mmol/L) Standard diet 0.8060.07 0.9260.04 Our study showed for the first time that the Pgp-deficient mice HFD 0.7060.03 0.9960.05 a fed a standard chow diet developed an overweight phenotype which occurred earlier and was more pronounced in males than in Mice were fed from weaning to 25 weeks of age whether with a standard chow diet or a high fat diet (HFD). Glucose and triglycerides were analysed in plasma females. Besides becoming overweight, a substantial increase of samples from wild-type and mdr1ab-/- mice. Results are expressed as means 6 white abdominal, subcutaneous and visceral adipose tissue mass s.e.m. of 3 to 5 animals. was observed with severe hyperinsulinemia which evolved to a p,0.05 when compared with wild-type. hyperglycemia. *p,0.05; **p,0.05, when compared with standard diet. Hypertrophy of visceral fat pads is considered as a predictive doi:10.1371/journal.pone.0023614.t003 factor for lipid metabolic disorders linked to obesity and our data
PLoS ONE | www.plosone.org 6 September 2011 | Volume 6 | Issue 9 | e23614 P-glycoprotein Deficiency Leads to Obesity in Mice
monogenic disruption obese mouse models (ob [22], db [23], or agouti [24]). Because the lack of Pgp did not notably influence feeding behaviour, we exclude overfeeding as the cause of the obesity in our model. Obesity occurs in many situations where genes involved in lipid homeostasis are disrupted. The liver steatosis observed here evokes up regulation of de novo lipid synthesis in the liver. Indeed, Fasn and scd-1 expressions were increased in the livers of Pgp-deficient mice and by their pivotal role in de novo fatty acids synthesis they could be major contributors of hepatosteatosis. Overexpression of scd-1 was observed in 12-week old Pgp null mice and appeared as an early event in the onset of lipid disorder. In accordance with our results, mice lacking SCD-1 are lean with significantly reduced triglyceride storage in the liver [25] and obesity is related to an increased expression of scd-1 [15,26]. Similarly, the overexpression of the well-known ubiquitous scavenger receptor CD36 in the livers of obese Pgp-deficient mice, may contribute to the onset of obesity by favouring lipid accumulation in tissues [27,28]. At the same time, the Acox gene coding for a rate-limiting enzyme in b- oxidation of fatty acids, was not modified. This suggests that fat catabolism remains stable in our model. These data are all the more interesting in that obesity occurred, as a consequence of Pgp deficiency, in a FVB genetic background which is known to be resistant to diet-induced obesity. Indeed, body weight and energy expenditure [15] or hallmark obesity genes, such as scd-1 [29], were unchanged in normal FVB mice fed high-fat diet, which is in contrast to C57BL/6 in which HFD rapidly induces an overweight condition and massive overexpres- sion of scd-1 [15]. In the same vein, obese transgenic C56BL/6ob/ ob mice had massive increased expression of scd-1 while only a moderate increase was observed in FVBob/ob [26]. It is obvious that the gene expression profile described above led to unbalanced lipid homeostasis, contributed to hepatosteatosis and to the obesity phenotype in the Pgp-deficient mice. Given that cd36, scd-1 and Fasn are overexpressed in our model and that their expressions are regulated by the nuclear receptors PPARc for cd36 [30] and LXR for scd-1 and Fasn [31], respectively, we suggest that the turn-over of activators of these nuclear receptors, i.e., fatty acid-derived ligands or cholesterol, might be affected in Pgp deficiency. Figure 5. Analysis of lipids and xenobiotics target genes The accumulation of triglycerides in the liver was concomitant expression in the liver. Relative gene expressions of scd-1, fasn, cd36, with the strong increase in concentrations of bile acids and acox, cyp2B10 and cyp3A11 were quantified in liver samples from 12- cholesterol measured in bile of 35-week old Pgp-deficient mice. week old (Fig. 5A) and 25-week old (Fig. 5B) mice by real-time time PCR. Similarly, scd-1, cyp7a1 and pltp expressions were quantified in 35-week Together with the increase of cyp7a1 expression observed in Pgp- old mice (Fig. 5C); wild-type (open bars) and mdr1ab-/- (solid bars). deficient liver, our data are in accordance with the role of the Values were normalized to TBP gene and expressed as arbitrary unit. enzyme CYP7A1 in bile acid synthesis. In the same vein, given the Values shown are means 6 s.e.m (n = 3). Differences are considered role of PLTP in HDL remodelling, the increased expression of pltp significant when p,0.05. *, p,0.05; **, p,0.01; ***, p,0.001. was consistent with the increase of HDL in plasma of Pgp-deficient doi:10.1371/journal.pone.0023614.g005 mice and attests of abnormal clearance of cholesterol. Cyp7a1 and pltp are direct targets of LXR [32,33] and our results demonstrate obtained in Pgp-deficient mice are consistent with the increased that the cholesterol metabolic pathway is altered in Pgp deficiency. propensity of people who are overweight to develop insulin In support with our data, another study performed in mdr1ab-/- resistance via the oversupply of fatty acids to tissues. In addition, mice fed HFD showed the increased levels of LXR protein and liver steatosis appeared clearly in overweight 25-week old Pgp- PLTP activity [34]. deficient mice as evidenced by the massive hepatic triglyceride Nevertheless, the main role of Pgp is to extrude a broad range of accumulation, the increases in cholesterol and biliary acid in bile, chemicals and mice lacking Pgp accumulate significantly higher and of ALP and ALT activities in plasma. plasma and tissue concentrations of Pgp substrates such as When Pgp-deficient mice were fed HFD, deregulation of glucocorticoids and xenochemicals [7] and certainly food metabolism occurred early. Plasma glucose and plasma and components. We showed that in Pgp-deficient animals, the hepatic triglycerides were increased at 15 weeks when compared expression of cyp2b10 and cyp3a11 were increased, consistent with with matched wild-type mice fed HFD, revealing that Pgp likely increases in the availability of ligands of the hepatic deficiency leads to a sensitisation to high-fat diet. xenosensors PXR and CAR [35,36]. The list of candidate stimuli Obesity is multifactorial and overeating is one of the obvious that are transported by Pgp and that can influence P-450s, causes. Indeed, hyperphagia has been observed in several through CAR and PXR activation, is long and includes exogenous
PLoS ONE | www.plosone.org 7 September 2011 | Volume 6 | Issue 9 | e23614 P-glycoprotein Deficiency Leads to Obesity in Mice regulators of dietary origin, such as pesticides [37], flavonoids [38] inhibitors, we cannot rule out that Pgp inhibition may contribute, and phytooestrogens [39], whose presence depends on the housing to some extent, to these disorders. conditions. Indeed in previous works, P-450 genes were shown to Thus, our results are relevant in the context of people having be differentially modulated in Pgp-deficient mice, depending on low Pgp activity-associated polymorphisms and being exposed the controlled animal housing conditions and the origin of the simultaneously to drugs (often used in combination), food standard chow [40]. contaminants and natural food components that can be Pgp The activation of CAR or PXR by xenobiotics may be inhibitors [47]. With such combinations, substantial inhibition of contributing to obesity in Pgp-deficient mice, especially since the the transporter activity may occur and favour the onset of lipid role of xenosensors has been expanded to the regulation of lipid metabolism disorders. Interestingly, Pgp polymorphism associated metabolism and energy expenditure. Indeed, CAR has been with a complete lack of Pgp function has previously been described shown to impact on serum triglyceride levels [41] and PXR in several canine strains [48,49] but the link between obesity and increases hepatic deposit of triglycerides [42]. In addition, they Pgp deficiency has never been investigated so far in dogs. both increase de novo hepatic lipogenesis by enhancing the Our data indicate that Pgp-deficient mice develop excess expression thyroid hormone-responsive 14 protein [43]. Whether weight, metabolic disorders, hepatic steatosis that clearly char- PXR and CAR activation, as a consequence of Pgp deficiency, is acterise obesity. The metabolic disruption appeared earlier and a direct cause of obesity and steatosis by disrupting genes was more severe in Pgp-deficient mice fed a high-fat diet. Overall, involved in lipid homeostasis or whether gene induction by Pgp deficiency reverses the resistance to obesity phenotype which xenobiotics and by lipids are two independent pathways, remains characterizes FVB mice. This is the first time that a clear obese to be determined. phenotype has been described in Pgp-deficient mice since they Interestingly, in favour of a role for Pgp in lipid metabolism in have been generated [5]. Given the key role of Pgp in controlling humans, single nucleotide polymorphisms on the Pgp coding the entrance of a broad range of compounds into the body, we gene ABCB1 have been associated with lipid metabolism disorders thus propose that subsequent to Pgp inhibition, lipids or any active in several independent studies. In hypercholesterolemic patients, compounds may be absorbed at a higher rate and modulate target gene expression, affecting metabolic pathways that favour the the haplotype G2677T and C3435T on ABCB1 is associated with occurrence of an obesity syndrome. These data reinforce the higher levels of total and LDL cholesterolemia [18]. Similarly, in findings that some polymorphisms in the Pgp gene could be a hypercholesterolemic women the ABCB1 allele G2677T/A was predisposing factor and may be a relevant marker for obesity. associated with higher levels of total and LDL cholesterol than Indeed, any decrease in Pgp function, due to simultaneous those with the more frequent allele G [17]. While in occurrence of polymorphism and chemical inhibition, may favour STANISLAS cohort, G2677T/A polymorphism was associated obesity. This can be even worse in occidental societies, where with a decrease in plasma total cholesterol but this was in healthy people are facing a dramatic excess in lipid dietary intake, which if subjects [16]. Moreover, among 95 polymorphisms of 67 combined with Pgp inhibition, may accelerate the onset of lipid candidate genes, explored in a Japanese cohort including 4252 metabolic disorders. Deciphering the mechanisms by which Pgp individuals, only a Pgp gene polymorphism was clearly and deficiency is involved in the development of obesity in mice may significantly associated with obesity. The body mass index was help reveal novel physiological functions for Pgp and elucidate greater for individuals with the Pgp gene variant 2677A/T allele factors associated with the onset of obesity. than for those with the GG genotype [19]. Although such an allele is not associated with deficient Pgp function as we would Acknowledgments have expected in accordance with our results, this study reinforces our finding of a strong link existing between Pgp and We thank Anne Bouloumie´ and Jean Galinski from the ‘‘Institut de lipid homeostasis. Me´decine Mole´culaire de Rangueil’’ for the helpful suggestions and In humans, there is no genotype described so far associated with practical help, and Faouzi Lyazrh from the ‘‘Unite´Pe´dagogique Biostatistique’’ INRA/ENVT, Toulouse for helpful contribution in a full lack of Pgp function. Nevertheless, SNPs in the Pgp gene, statistical analyses. We thank Arnaud Polizzi, for its help in molecular including synonymous SNPs, have been associated with low Pgp biology. function [44,45]. In addition, therapy is sometimes based on using drugs which are strong inhibitors of Pgp. As an example, HIV Author Contributions patients chronically treated with antiretroviral protease inhibitors Conceived and designed the experiments: MF-V ZS CM PGPM HG JB-M frequently elicit a metabolic syndrome including hyperlipidemia, XC AL. Performed the experiments: MF-V ZS CM JB-M AL. Analyzed lipodystrophy, and insulin resistance [46]. Although several the data: MF-V ZS CM PGPM HG JB-M XC AL. Contributed reagents/ mechanisms have been proposed to explain such drug-induced materials/analysis tools: PGPM HG JB-M XC. Wrote the paper: MF-V deregulations and because protease inhibitors are strong Pgp ZS HG XC AL.
References 1. Juliano RL, Ling V (1976) A surface glycoprotein modulating drug permeability 6. Schinkel AH, Smit JJ, van Tellingen O, Beijnen JH, Wagenaar E, et al. (1994) in Chinese hamster ovary cell mutants. Biochim Biophys Acta 455: 152–162. Disruption of the mouse mdr1a P-glycoprotein gene leads to a deficiency in the 2. Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I, et al. (1987) blood-brain barrier and to increased sensitivity to drugs. Cell 77: 491–502. Cellular localization of the multidrug-resistance gene product P-glycoprotein in 7. Schinkel AH, Wagenaar E, van Deemter L, Mol CA, Borst P (1995) Absence of normal human tissues. Proc Natl Acad Sci U S A 84: 7735–7738. the mdr1a P-Glycoprotein in mice affects tissue distribution and pharmacoki- 3. Schinkel AH, Jonker JW (2003) Mammalian drug efflux transporters of the ATP netics of dexamethasone, digoxin, and cyclosporin A. J Clin Invest 96: binding cassette (ABC) family: an overview. Adv Drug Deliv Rev 55: 3–29. 1698–1705. 4. Kwei GY, Alvaro RF, Chen Q, Jenkins HJ, Hop CE, et al. (1999) Disposition of 8. Honig SM, Fu S, Mao X, Yopp A, Gunn MD, et al. (2003) FTY720 stimulates ivermectin and cyclosporin A in CF-1 mice deficient in mdr1a P-glycoprotein. multidrug transporter- and cysteinyl leukotriene-dependent T cell chemotaxis to Drug Metab Dispos 27: 581–587. lymph nodes. J Clin Invest 111: 627–637. 5. Schinkel AH, Mayer U, Wagenaar E, Mol CA, van Deemter L, et al. (1997) 9. Aye IL, Singh AT, Keelan JA (2009) Transport of lipids by ABC proteins: Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug- interactions and implications for cellular toxicity, viability and function. Chem transporting) P-glycoproteins. Proc Natl Acad Sci U S A 94: 4028–4033. Biol Interact 180: 327–339.
PLoS ONE | www.plosone.org 8 September 2011 | Volume 6 | Issue 9 | e23614 P-glycoprotein Deficiency Leads to Obesity in Mice
10. Tessner TG, Stenson WF (2000) Overexpression of MDR1 in an intestinal cell 31. Ducheix S, Lobaccaro JM, Martin PG, Guillou H (2011) Liver X Receptor: an line results in increased cholesterol uptake from micelles. Biochem Biophys Res oxysterol sensor and a major player in the control of lipogenesis. Chem Phys Commun 267: 565–571. Lipids 164: 500–514. 11. Garrigues A, Escargueil AE, Orlowski S (2002) The multidrug transporter, P- 32. Chiang JY, Kimmel R, Stroup D (2001) Regulation of cholesterol 7alpha- glycoprotein, actively mediates cholesterol redistribution in the cell membrane. hydroxylase gene (CYP7A1) transcription by the liver orphan receptor Proc Natl Acad Sci U S A 99: 10347–10352. (LXRalpha). Gene 262: 257–265. 12. Gayet L, Dayan G, Barakat S, Labialle S, Michaud M, et al. (2005) Control of P- 33. Cao G, Beyer TP, Yang XP, Schmidt RJ, Zhang Y, et al. (2002) Phospholipid glycoprotein activity by membrane cholesterol amounts and their relation to transfer protein is regulated by liver X receptors in vivo. J Biol Chem 277: multidrug resistance in human CEM leukemia cells. Biochemistry 44: 39561–39565. 4499–4509. 34. Thornton SJ, Wong E, Lee SD, Wasan KM (2008) Effect of dietary fat on 13. Rothnie A, Theron D, Soceneantu L, Martin C, Traikia M, et al. (2001) The hepatic liver X receptor expression in P-glycoprotein deficient mice: implications importance of cholesterol in maintenance of P-glycoprotein activity and its for cholesterol metabolism. Lipids Health Dis 7: 21. membrane perturbing influence. Eur Biophys J 30: 430–442. 35. Kohle C, Bock KW (2009) Coordinate regulation of human drug-metabolizing 14. Luker GD, Nilsson KR, Covey DF, Piwnica-Worms D (1999) Multidrug enzymes, and conjugate transporters by the Ah receptor, pregnane X receptor resistance (MDR1) P-glycoprotein enhances esterification of plasma membrane and constitutive androstane receptor. Biochem Pharmacol 77: 689–699. cholesterol. J Biol Chem 274: 6979–6991. 36. Moore LB, Maglich JM, McKee DD, Wisely B, Willson TM, et al. (2002) 15. Hu CC, Qing K, Chen Y (2004) Diet-induced changes in stearoyl-CoA Pregnane X receptor (PXR), constitutive androstane receptor (CAR), and desaturase 1 expression in obesity-prone and -resistant mice. Obes Res 12: 1264–1270. benzoate X receptor (BXR) define three pharmacologically distinct classes of 16. Jeannesson E, Siest G, Bastien B, Albertini L, Aslanidis C, et al. (2009) nuclear receptors. Mol Endocrinol 16: 977–986. Association of ABCB1 gene polymorphisms with plasma lipid and apolipopro- 37. Casabar RC, Das PC, Dekrey GK, Gardiner CS, Cao Y, et al. (2010) tein concentrations in the STANISLAS cohort. Clin Chim Acta 403: 198–202. Endosulfan induces CYP2B6 and CYP3A4 by activating the pregnane X 17. Kajinami K, Brousseau ME, Ordovas JM, Schaefer EJ (2004) Polymorphisms in receptor. Toxicol Appl Pharmacol 245: 335–343. the multidrug resistance-1 (MDR1) gene influence the response to atorvastatin 38. Conseil G, Baubichon-Cortay H, Dayan G, Jault JM, Barron D, et al. (1998) treatment in a gender-specific manner. Am J Cardiol 93: 1046–1050. Flavonoids: a class of modulators with bifunctional interactions at vicinal ATP- 18. Rodrigues AC, Rebecchi IM, Bertolami MC, Faludi AA, Hirata MH, et al. and steroid-binding sites on mouse P-glycoprotein. Proc Natl Acad Sci U S A 95: (2005) High baseline serum total and LDL cholesterol levels are associated with 9831–9836. MDR1 haplotypes in Brazilian hypercholesterolemic individuals of European 39. Wang H, Li H, Moore LB, Johnson MD, Maglich JM, et al. (2008) The descent. Braz J Med Biol Res 38: 1389–1397. phytoestrogen coumestrol is a naturally occurring antagonist of the human 19. Ichihara S, Yamada Y, Kato K, Hibino T, Yokoi K, et al. (2008) Association of pregnane X receptor. Mol Endocrinol 22: 838–857. a polymorphism of ABCB1 with obesity in Japanese individuals. Genomics 91: 40. Schuetz EG, Umbenhauer DR, Yasuda K, Brimer C, Nguyen L, et al. (2000) 512–516. Altered expression of hepatic cytochromes P-450 in mice deficient in one or 20. Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction and more mdr1 genes. Mol Pharmacol 57: 188–197. purification. Can J Biochem Physiol 37: 911–917. 41. Maglich JM, Lobe DC, Moore JT (2009) The nuclear receptor CAR (NR1I3) 21. Vieu C, Jaspard B, Barbaras R, Manent J, Chap H, et al. (1996) Identification regulates serum triglyceride levels under conditions of metabolic stress. J Lipid and quantification of diacylglycerols in HDL and accessibility to lipase. J Lipid Res 50: 439–445. Res 37: 1153–1161. 42. Zhou J, Zhai Y, Mu Y, Gong H, Uppal H, et al. (2006) A novel pregnane X 22. Batt RA, Wilson CA, Topping DL (1978) Potentiation of hyperphagia and relief receptor-mediated and sterol regulatory element-binding protein-independent of hypothermia in the genetically obese mouse (genotype, ob/ob) by alpha- lipogenic pathway. J Biol Chem 281: 15013–15020. methyl tyrosine. Int J Obes 2: 303–307. 43. Breuker C, Moreau A, Lakhal L, Tamasi V, Parmentier Y, et al. (2010) Hepatic 23. Cox JE, Powley TL (1977) Development of obesity in diabetic mice pair-fed with expression of thyroid hormone-responsive spot 14 protein is regulated by lean siblings. J Comp Physiol Psychol 91: 347–358. constitutive androstane receptor (NR1I3). Endocrinology 151: 1653–1661. 24. Yanase T, Fan W, Kyoya K, Min L, Takayanagi R, et al. (2008) Androgens and 44. Hoffmeyer S, Burk O, von Richter O, Arnold HP, Brockmoller J, et al. (2000) metabolic syndrome: lessons from androgen receptor knock out (ARKO) mice. Functional polymorphisms of the human multidrug-resistance gene: multiple J Steroid Biochem Mol Biol 109: 254–257. sequence variations and correlation of one allele with P-glycoprotein expression 25. Ntambi JM, Miyazaki M, Stoehr JP, Lan H, Kendziorski CM, et al. (2002) Loss and activity in vivo. Proc Natl Acad Sci U S A 97: 3473–3478. of stearoyl-CoA desaturase-1 function protects mice against adiposity. Proc Natl 45. Sauna ZE, Kimchi-Sarfaty C, Ambudkar SV, Gottesman MM (2007) Silent Acad Sci U S A 99: 11482–11486. polymorphisms speak: how they affect pharmacogenomics and the treatment of 26. Haluzik M, Colombo C, Gavrilova O, Chua S, Wolf N, et al. (2004) Genetic cancer. Cancer Res 67: 9609–9612. background (C57BL/6J versus FVB/N) strongly influences the severity of diabetes and insulin resistance in ob/ob mice. Endocrinology 145: 3258–3264. 46. Giralt M, Diaz-Delfin J, Gallego-Escuredo JM, Villarroya J, Domingo P, et al. 27. Coburn CT, Knapp FF, Jr., Febbraio M, Beets AL, Silverstein RL, et al. (2000) (2010) Lipotoxicity on the basis of metabolic syndrome and lipodystrophy in Defective uptake and utilization of long chain fatty acids in muscle and adipose HIV-1-infected patients under antiretroviral treatment. Curr Pharm Des 16: tissues of CD36 knockout mice. J Biol Chem 275: 32523–32529. 3371–3378. 28. Terpstra V, van Amersfoort ES, van Velzen AG, Kuiper J, van Berkel TJ (2000) 47. Okura T, Ibe M, Umegaki K, Shinozuka K, Yamada S (2010) Effects of dietary Hepatic and extrahepatic scavenger receptors: function in relation to disease. ingredients on function and expression of P-glycoprotein in human intestinal Arterioscler Thromb Vasc Biol 20: 1860–1872. epithelial cells. Biol Pharm Bull 33: 255–259. 29. Le Lay S, Boucher J, Rey A, Castan-Laurell I, Krief S, et al. (2001) Decreased 48. Mealey KL, Bentjen SA, Gay JM, Cantor GH (2001) Ivermectin sensitivity in resistin expression in mice with different sensitivities to a high-fat diet. Biochem collies is associated with a deletion mutation of the mdr1 gene. Pharmacoge- Biophys Res Commun 289: 564–567. netics 11: 727–733. 30. Rogue A, Spire C, Brun M, Claude N, Guillouzo A (2010) Gene Expression 49. Roulet A, Puel O, Gesta S, Lepage JF, Drag M, et al. (2003) MDR1-deficient Changes Induced by PPAR Gamma Agonists in Animal and Human Liver. genotype in Collie dogs hypersensitive to the P-glycoprotein substrate PPAR Res 2010: 325183. ivermectin. Eur J Pharmacol 460: 85–91.
PLoS ONE | www.plosone.org 9 September 2011 | Volume 6 | Issue 9 | e23614
Publication 3: La déficience en Pgp diminue la triglycéridémie postprandiale chez la souris
Comme nous l’avons évoqué dans l’article 2, la déficience en Pgp induit à long terme une obésité associée à une stéatose hépatique (Foucaud-Vignault et al., 2011), ceci suggère un rôle important de la Pgp dans la prévention de l’obésité et des troubles métaboliques associées. Cependant, les effets de la déficience en Pgp sur la physiologie intestinale et le métabolisme des lipides restent à comprendre. Cette étude vise à élucider les mécanismes conduisant à ces perturbations métaboliques et à évaluer le rôle de la Pgp dans le processus d’absorption des lipides alimentaires à des stades plus précoces, avant l’installation de l’obésité.
Chez des souris témoins et déficientes en Pgp, nous avons évalué la triglycéridémie postprandiale après un gavage à l’huile de maïs et nous avons suivi le trafic général des lipides dans l’organisme. L’étude a été poursuivie par la mesure de la sécrétion hépatique et intestinale des triglycérides et de leur clairance plasmatique par la mesure de l’activité de la lipoprotéine lipase dans le plasma. La captation des acides gras par les tissus périphériques a été ensuite évaluée après un gavage avec de la trioléine radiomarquée.
L’administration intragastrique d’huile de maïs a entraîné une baisse des triglycérides plasmatiques chez les souris déficientes en Pgp par rapport aux témoins. Cette baisse postprandiale n’est pas due à une diminution de la sécrétion hépatique, mais à une diminution de la sécrétion intestinale des triglycérides et de la captation des acides gras par l’entérocyte via la diminution de l’expression de la fatp4 (fatty acid transporter protein). De plus, la déficience en Pgp n’a pas modifié l’activité plasmatique totale de la lipoprotéine lipase mais a diminué l’expression de son inhibiteur (fiaf). La captation des acides gras par le tissu adipeux est augmentée en accord avec la diminution de l’expression du fiaf.
Ces résultats ont montré que la déficience en Pgp affecte profondément la physiologie intestinale et conduit à une utilisation altérée des lipides par l’organisme. Ainsi, la Pgp pourrait contribuer à diminuer la clairance plasmatique des triglycérides et à augmenter leur captation et leur stockage dans le tissu adipeux. Ainsi, elle participerait à la prévention de l’obésité et les maladies métaboliques associées. 97
P-glycoprotein deficiency decreases postprandial triglyceride response in mice
Zeina Soayfane1,2,3, Mattéo Serino2, François Tercé4, Chantal Lebrun1, Hervé Guillou1,
Arnaud Polizzi1, Xavier Collet2,3, Anne Lespine1
1-INRA UMR1331, Université de Toulouse III, INP, UPS, TOXALIM, F-31027 Toulouse
2- INSERM, UMR 1048, F-31024 Toulouse
3-Université de Toulouse III, Institut de Maladies Métaboliques et Cardiovasculaires, F-
31432 Toulouse
4-IFR150, F-31024 Toulouse
Corresponding author:
Anne Lespine, INRA UMR1331, Université de Toulouse, INP, UPS, TOXALIM, F-31027
Toulouse, France.
Phone : 33-561285387 - Fax : 33-561285310
E-mail : [email protected] Abstract
P-glycoprotein (Pgp) deficiency in mice is associated to metabolic disorders such as hepatic steatosis, hyperglycemia and hyperinsulinemia which sign obesity. Given that obesity is linked to excess of dietary fat intake, we have evaluated the capacity of Pgp-deficient mice to absorb triglycerides. We have compared the postprandial triglyceride response in plasma after corn oil gavage in wild-type and Pgp-deficient mice and analyzed the expression of gene involved in lipid absorption and utilization in both genotypes. The experiments have been performed in 12-week old animals before obesity installation.
A massive decrease in postprandial triglyceride plasma concentration was observed in Pgp- deficient mice. Moreover, Pgp deficiency was associated with a decrease in intestinal triglyceride absorption with inhibition of the fatp4 gene expression coding for FATP4, involved in intestinal fatty acid uptake. The expression and the activity of lipoprotein lipase
(LPL), the rate-limiting enzyme for plasma triglyceride hydrolysis, were unchanged in both genotypes. However, a decrease in the fasting induced-adipose tissue (fiaf) expression, identified as LPL inhibitor was measured together with an increase in the uptake of free fatty acids by adipose tissue..
The abnormal fat absorption and increase in fatty acid uptake by adipose tissue may be the cause of the obesity observed in Pgp deficiency. We suggest that the turn over of lipids which are substrates of Pgp is altered in Pgp deficiency leading to deregulation of lipid absorption and utilization and to obesity.
Key words: P-glycoprotein; lipids; absorption; intestine; fasting-induced adipose tissue; lipoprotein clearance
Introduction
P-glycoprotein (Pgp, ABCB1) was first identified as a factor involved in multidrug resistance in mammalian tumor cells (Juliano and Ling, 1976), and has been found to be present in many biological barriers, including the villus tip of the apical brush-border membrane of gut enterocytes and the blood side of endothelial cells of the brain-blood barrier. It actively transports a variety of structurally and pharmacologically unrelated compounds out of cells and out of organisms (Mizuno et al., 2003; Raub, 2006), protecting tissues from xenobiotic toxicity. Besides the transport of contaminants, it also plays significant roles in drug absorption, distribution and clearance processes, in drug-drug and drug-food interactions
(Dahan and Altman, 2004; Raub, 2006; Takano et al., 2006; Miller et al., 2008).
Pgp can also transport different classes of lipids. Several studies have shown that cholesterol directly affects the Pgp transport activity (Rothnie et al., 2001; Gayet et al., 2005) and consequently inhibits the transport of Pgp substrates (Wang et al., 2000). Pgp is also directly involved in the cellular uptake of exogenous cholesterol in transfected cells overexpressing the transporter (Tessner and Stenson, 2000; Garrigues et al., 2002). Pgp also effluxes a variety of other steroids, such as glucocorticoids (cortisol), mineralcorticoids (aldosterone), estradiol
(Aye et al., 2009) and several phospho- and sphingolipids (Klappe et al., 2009; Chapman et al., 2011). Indeed, the secretion and the transport of the endogenous phosphatidylcholine were inhibited by Pgp inhibitors (Ernest and Bello-Reuss, 1999; Raggers et al., 2001) and ceramide reverses the efflux transport mediated by Pgp (Chapman et al., 2011).
Single nucleotide polymorphisms in the Pgp encoding ABCB1 gene in humans are associated with disturbances in lipid metabolism in several independent studies. In a Brazilian hypercholesterolemic population, G2677T and C3435T haplotypes in the ABCB1 gene were associated with elevated total cholesterol (TC) and LDL-cholesterol (LDL-C) in plasma
(Rodrigues et al., 2005). In addition, the 2677G allele of the 2677G –A/T polymorphism of ABCB1 gene has been associated with obesity in a Japanese population (Ichihara et al., 2008), revealing for the first time Pgp as a novel possible marker for obesity. In addition, in an attempt to characterize the role of Pgp in the turn-over of cholesterol, it was shown that an oral load of cholesterol led to accumulation of cholesterol ester in the liver in Pgp-deficient mice (Luker et al., 2001). Furthermore, we have shown recently that Pgp-deficient mice fed standard chow diet develop obesity characterized by body overweight, insulin resistance and hepatosteatosis (Foucaud-Vignault et al., 2011), supporting the role of Pgp in the maintenance of lipid homeostasis. Because overfeeding is one of the obvious causes of obesity and given the role of Pgp in the transport of lipids, we assume that the lack of Pgp induces deregulation of lipid uptake at the intestinal level.
In order to evaluate the capacity of the intestine to absorb dietary lipids, we have compared the postprandial triglyceridemia response after an intragastric gavage with corn oil in wild- type and in Pgp-deficient mice. Our data are in agreement with a deregulation in the uptake of lipids, and packaging and lipolysis of chylomicrons, in Pgp deficiency.
Materiel and Methods
Animal housing and ethics Statement
Wild-type and mdr1ab-/- mice with a FVB genetic background were obtained from Taconic farms (NY, USA). Mice were bred at INRA's transgenic rodent facility at 22 ± 2°C under 12- hour light/dark cycles. Animals sampling was designed to reduce the influence of interfering parameters such as litter specificity. Mice received a standard chow diet recommended for the breeding and rearing of rodents (Harlan Teklad TRM Rat/Mouse Diet; Harlan Teklad,
Gannat, France). Water and food were available ad libitum. In vivo studies were conducted in mice under European laws on the protection of animals (86/609/EEC). Protocols are performed under procedure and principal for good clinical practice and have been approved by the local institutional animal care and ethics committee (approval number B31555-25).
Postprandial triglyceride response
Experiments were carried out on 11-13-week or 22-26-week old male mice. Overnight fasted mice received 200 µl of corn oil bolus by gavage. Retro-orbital blood samples (50 µl) were drawn just before gavage (time 0) and at 0.5, 1, 2, 4 and 8 hr after gavage.
Plasma was obtained by centrifugation 10 min at 1500 g and stored at -20°C until analysis.
Plasma triglyceride kinetic after inhibition of vascular lipase activity
Overnight fasted mice received a first intravenous injection of Triton WR-1339 (10 mg/50 µl
NaCl per mouse, Sigma, Saint-Quentin, France) to block plasma lipoprotein clearance
(Borensztajn et al., 1976), followed 2 hr later by a second injection to maintain a sufficient plasma concentration, because Triton WR-1339 is rapidly taken up and catabolized in the liver lysosomes (Dugue-Pujol et al., 2006).
Similar experiment was conducted in other mice receiving an intragastric load of corn oil (200
µl per mouse) immediately after the first Triton WR-1339 injection. Blood samples were drawn before the first Triton WR-1339 injection or oil gavage (time 0) and at 0.5, 1, 2, 4 and
8 hr thereafter.
Chylomicrons isolation, sizing and lipid content
Mice were administrated 200 µl of corn oil and injected 10 mg of Triton WR-1339. Retro- orbital blood samples were drawn at 4 hr post-administration and chylomicron fraction was immediately isolated from 250 µl of plasma by centrifugation at 10000 g for 30 min at 15°C.
Particles diameters were assayed from the volume distribution patterns using dynamic light scattering techniques (Zetasizer, Malvern, Orsay, France).
Lipid and protein analysis in plasma and chylomicrons
Triglyceride concentration was measured in plasma and in chylomicrons using a commercially available kit (Thermotrace). Chylomicrons were assayed for total cholesterol and phospholipids using a commercially available assay kits (Thermotrace and Biolabo, respectively). Protein content of the chylomicron fraction was determined according to Lowry et al., (1951).
Lipid analysis in intestine and faeces
Proximal duodenum was isolated from wild-type and Pgp-deficient fasted mice and homogenized in 1 ml methanol/ EGTA 5 mM (2:1, v/v). Faeces were collected over a period of 24 hr and separated from the bedding (pools of 4 animals). Faecal samples were lyophilized, weighed and homogenized in 10 ml of methanol/ EGTA 5 mM (Sigma) (2:1, v/v). Lipids were extracted from the intestine and the faeces, according to Bligh and Dyer
(Bligh and Dyer, 1959). Briefly, 2 ml of H2O and 2.5 ml of CHCl3-methanol (1:1, v/v) were added to each sample, were vortexed and centrifuged at 1500 rpm for 2 min at 4°C. The lower
CHCl3 phase (lipid phase) was removed, dried under Nitrogen gas and taken up in 160 µl ethyl acetate and dried again under Nitrogen gas. The dried lipid samples were dissolved in 20 µl ethyl acetate. Triglyceride, total cholesterol and cholesteryl esters were analyzed by Gas
Chromatography (Vieu et al., 1996).
RNA extraction and Quantitative Real-Time PCR
Total RNA was isolated from mice liver, intestine and adipose tissue samples by using the
TRIzol reagent, according to the manufacturer’s instructions. Briefly, 1 ml of TRIzol was added to tissue in a Lysing Matrice Tube (Qbiogene, MP Biomedicals, Illkirch, France) and immediately homogenized by means of the Fast-Prep FP120 (Qbiogene,MP Biomedicals,
Illkirch, France), for 10 s. Samples were then purified with a standard phenol-chloroform extraction. Total RNA concentration and quality were determined by using the NanodropND-
1000 spectrophotometer (Labtech France, Paris, France). The isolated RNA quality was confirmed by denaturing gel electrophoresis. The reverse transcription of 2 μg of total RNA was performed, in a final volume of 20 μl, by using the High Capacity cDNA Archive kit
(Applied Biosystems) and following the purchaser’s procedure.
The quantitative real-time RT-PCR was performed on 25 ng of cDNA, in a final volume of
12.5 μl, by using Power SYBR Green PCR Master Mix and an ABI-Prism 7300 thermal cycler (Applied Biosystems, Foster City, CA) under standard PCR conditions.
The primer sequences were as follows: cyclo-F, 5’-TGGAGAGCACCAAGACAGACA-3’; cyclo-R, 5’-TGCCGGAGTCGACAATGAT-3’; tbp-F, 5’-
ACTTCGTGCAAGAAATGCTGAA-3’; tbp-R, 5’-GCAGTTGTCC-GTGGCTCTCT-3’; apoc2-F, 5’-ATAGTCCCTTCCTGCCACTACATT-3’; apoc2-R, 5’-
AGGAAGAACCGAGACCCCA-3’; apoc3-F, 5’- CAGGAGTCCGATATAGCTGTGG-3’; apoc3-R, 5’- AAGCCGGTGAACTTGTCAGTAA-3’; fiaf-F, 5’-
CAGCTCATTGGCTTGACTCC-3’; fiaf-R, 5’- GGAAAAGTCCACTGTGCCG-3’; apoa4-F,
5’- CAATGTGGTGTGGGATTACTTTAC-3’; apoa4-R, 5’- GCATCCCCAAGTTTGTCCT-
3’, fatp4-F, 5’-AGCACCTGCCCAGTCACC-3’; fatp4-R, 5’- GTGCCCGATGTGTAGATGTAGAAG-3’; apob48-F, 5’- TGCACAAACTTTGCAGGGA-
3’; apob48-R, 5’- CCCTTCTCTGATGGCCTGTA-3’; lpl-F, 5’-
ATGGCAAGCAACACAACCAG-3’, lpl-R, 5’-TGTGGAAACCTCG GGCAG-3’.
A pool of all complementary DNA samples was used to generate calibration curves. All data were normalized by TATA-box binding protein levels for liver and adipose tissue and cyclophilin for intestine and done by the comparative ΔΔCt method (Livak and Schmittgen,
2001).
Tissues [3H]triolein uptake by plasma and tissues
Overnight fasting male mice (3 wild-type and 3 mdr1ab-/-) were administrated 200 µl of corn oil containing 8 µci of [3H]triolein. The mice were returned to their individual cages to allow absorption and distribution of the lipid in peripheral tissues for 6 hr. Retro-orbital blood samples (50 µl) were drawn at 6 hr after gavage and mice were immediately euthanized under anesthesia. The small intestine (10 cm), liver, WAT (gonadal, subcutaneous inguinal), heart, soleus muscle and brain were quickly isolated and frozen in liquid nitrogen. Faeces of each mouse were also collected and frozen in liquid nitrogen. The small intestine was cut to two parts corresponding respectively to duodenum (proximal intestine, 4 cm) and jejunum (medial intestine, 6 cm). The luminal contents were flushed out with 0.9% saline solution. Liver, heart and other tissues were resuspended in 6, 2 and 1 ml of EgTA/MetOH (1:2, v/v), respectively and homogenized using an ultra-turrax homogenizer (Labomoderne, Paris, France). The lipids were extracted from plasma and tissues according to the method of Bligh and Dyer (Bligh and
Dyer, 1959). The chloroform phase was collected in a glass vial, dried under nitrogen, resuspended in 50 µl ethanol and in 3 ml of liquid scintillator. The radioactivity in each vial was measured with a scintillation counter.
Lipoprotein lipase (LPL) activity measurement in plasma
Mice were injected with heparin (3UI/mouse) and blood was collected 10 min thereafter.
Post-heparin plasma was incubated with [3H]labelled chylomicron-like emulsions prepared as previously described (Rensen et al., 1997). Briefly, emulsion particles were prepared by sonication (soniprep at 10 µm output) of 100 mg of total lipid at an egg yolk phophatidylcholine- glycerol trioleate- lysophosphatidylcholine- cholesteryl oleate-cholesterol
(Sigma, Saint-Quentin, France), weight ratio of 22.7:70:2.3:3.0:2.0 in the presence of 50 µci of [3H]triolein (Sigma, Saint-Quentin, France). Emulsions were stored at 4°C under argon and used within 3 days. [3H]labelled chylomicron-like emulsions were incubated with 5 µl of postheparin plasma (2.5 % of the incubation volume) in presence of heated-inactivated (30 min at 56°C) human serum (20%) and excess free fatty acid BSA (60 mg/ml) in 0.1 M Tris, pH 8.5 for 1 h at 37°C. Samples were performed in triplicate. One of them was incubated with
1M NaCl to inhibit LPL activity. After incubation, 50 µl samples from the total 200 µl incubation volume were added to 1.5 ml of extraction liquid (methanol-chloroform-heptane- oleic acid, 1.404:1.245:1.001:1, v/v/v/v) and 0.5 ml of 0.2 M NaOH was added to terminate lipolysis. To quantify the [3H]oleate, 0.5 ml of the aqueous phase obtained after vigorous mixing (15 s) and centrifugation (15 min at 3,600 rpm) was counted in 4.5 ml of liquid scintillation. The LPL activity was calculated as the fraction of total triacylglycerol hydrolase activity inhibited by 1 M NaCl and expressed as the amount of free fatty acid (FFA) released per hour per milliliter of plasma.
Statistical analysis
The experimental values are expressed as mean ± standard error of the mean (s.e.m).
Statistical analyses were performed using a three-way factorial ANOVA model. A three-way factorial ANOVA model with repeated measures was used in the case where more than one observation came from the same animal. Multiple comparisons of means were performed with
Tukey test. Statistical significance was accepted as p<0.05. Results
Effect of Pgp deficiency on postprandial triglyceride response
In order to determine the origin of the onset of obesity observed in Pgp-deficient mice
(Foucaud-Vignault et al., 2011), we evaluated the postprandial triglyceride response in Pgp- deficient mdr1ab-/- mice and compared with wild-type. In rodents, there are two Pgps encoded by abc1a and abc1b genes and mdr1ab-/- mice were deficient for the two gene products
(Schinkel et al., 1994; Schinkel et al., 1997). In this study, we worked on 12-week old mice.
At that age, Pgp-deficient mice showed a normal phenotype in terms of weight, liver steatosis and biological parameters. At time 0, plasma triglycerides concentrations were similar in wild-type and in Pgp-deficient mice. After oral oil gavage, a typical increase of postprandial triglyceride concentration was measured in wild-type mice. At 4 hr, the plasma triglyceride concentration was peaking and was 10-fold the basal triglyceride levels (at t0).
In Pgp-deficient mice, the plasma postprandial triglyceride peak was strongly attenuated and at 2 and 4 hr, triglyceride concentrations were twice lower when compared with wild-type
(Fig. 1A). Based on the area under the curve determined on 0-8 hr period, Pgp deficiency led to a decrease of 38% (p< 0.05) of the global postprandial triglyceride response (Fig. 1B).
Similar observation was performed in 25-week old mdr1ab-/- mice which showed an obese phenotype (not shown).
Influence of Pgp deficiency on hepatic triglycerides secretion and its intestinal absorption
The low postprandial plasma triglyceride observed in Pgp-deficient mice could be attributable to i) decrease hepatic VLDL production, ii) intestinal lipid absorption, or chlylomicron production or iii) accelerated lipolysis or clearance of triglyceride rich particles.
We first examined the secretion of VLDL from the liver by blocking the catalytic activity of lipoprotein lipolysis (LPL) in the fasted state (without lipid load) with Triton WR-1339 injection. As expected, plasma triglyceride levels were strongly increased, revealing the net hepatic triglyceride efflux through VLDL synthesis. No difference between wild-type and
Pgp-deficient mice was observed for this process (Fig. 2A).
We then determined if the decrease of the intestinal lipid absorption underlies the low postprandial plasma triglyceride in Pgp-deficient mice. We performed an oral oil gavage together with Triton WR-1339 injection. A significant decrease of triglyceride concentration was observed in plasma of Pgp-deficient mice when compared with wild-type at 4 and 8 hr
(Fig. 2B).
Influence of Pgp deficiency on chylomicrons size and lipid content
We then checked if the products of intestinal secretion, chylomicrons, were modified in Pgp- deficient mice and we characterized their size and lipid content. As shown in Table 1, the chylomicron fraction isolated from mdr1ab-/- mice contained approximately 50% less total lipid mass (sum of the total cholesterol, phospholipids and triglycerides) than those from wild-type mice in accordance with the lower postprandial plasma triglyceride levels in mdr1ab-/-mice.
The relative contribution of total cholesterol, triglycerides and phospholipids to the total lipid content was similar in chylomicron fractions in both genotypes. Nevertheless, a decrease in the contribution of protein was found in particles isolated from Pgp-deficient mice when compared with wild-type mice (1.1 ± 0.04 and 0.6 ± 0.09 %, respectively). In the mean time, particles size distributions were close in wild-type and Pgp-deficient mice with mean diameters of 184 ± 7 and 168 ± 7 nm, respectively.
Influence of Pgp on intestinal and faecal lipid content
Because Pgp-deficient mice showed a decrease in intestinal triglyceride secretion, we hypothesized that it might be due to enhanced intestinal lipid storage or excretion. We determined the lipid content in the intestine before and after oil gavage and in the faeces collected over 24 hr period from both phenotype mice fed normal diet.
Surprisingly, no difference in the free and esterified cholesterol and triglyceride content in the intestine between wild-type and Pgp-deficient mice (Table 2) which is in full agreement with the observations of neutral lipids in oil red O staining (not shown). Similarly, there was no significant difference in faecal triglyceride and cholesteryl ester content while free cholesterol tended to be decreased in Pgp-deficient mice compared with wild-type mice (Table 2).
Expression of gene affecting intestinal lipid metabolism
To examine whether Pgp deficiency affects the intestinal gene profile and thereby influences intestinal triglycerides absorption, we quantified the expression of genes involved in intestinal lipid uptake (fatp4), triglyceride synthesis and packaging (dgat, mttp) and chylomicron composition and size (apob48, apoa4) (Fig. 3).
Pgp-deficient mice showed a significant decrease in the expression of the intestinal fatp4 gene known to play a crucial role in long chain fatty acid uptake and a tendency of apob48 to decrease. No change in the intestinal expression of mttp, apoa4 and dgat2 was observed between wild-type and Pgp-deficient mice.
Increased lipid adipose tissue uptake in Pgp-deficient mice in a lipid tracer experiment
We then investigated the effect of Pgp deficiency on the uptake of triglyceride-derived free fatty acid by peripheral tissues.
Wild-type and Pgp-deficient mice received [3H]triolein by gavage. Plasma was assayed for
[3H]oleate activity during a 6 hr period after the gavage and organs were isolated and
[3H]uptake was measured. The [3H]oleate activity in plasma was mildly reduced in Pgp- deficient mice compared with wild-type mice, although statistical significance was not reached (Fig. 4A). Interestingly, Pgp deficiency induced an increase uptake of [3H]oleate- derived activity by subcutaneous inguinal white adipose tissue (WAT) by 3-fold (p< 0.01) compared with wild-type mice. Likewise, jejunum also showed a tendency for increased uptake of [3H]activity. Whereas, the radioactivity measured in faeces was not significantly decreased in Pgp-deficient mice. The uptake of [3H]oleate activity was similar in duodenum, liver, heart, muscle, brain and gonadal WAT in both genotypes (Fig. 4B).
Influence of Pgp deficiency on vascular triglyceride lipolysis activity and expression
The low postprandial plasma triglyceride and the higher uptake of fatty acid by adipose tissue may be caused by accelerated triglyceride clearance which is mediated by the activity of essentially lipoprotein lipase (LPL) and to a lesser extent of hepatic lipase (HL). In order to check if the triglyceride lipolysis was higher in Pgp deficiency, we measured the activity of lipolytic enzymes: LPL activity in postheparin plasma and its expression in adipose tissue and
HL activity in postheparin plasma. LPL activity in plasma was not different between wild- type and Pgp-deficient mice (Fig. 5A). Likewise, the abundance of LPL mRNA in adipose tissue was not changed by Pgp deficiency (Fig. 5B). Similarly, HL activity did not vary (data not shown).
Expression of gene encoding for cofactors regulating LPL activity
Because LPL activity and expression was not modified, we hypothesized that Pgp deficiency could be alter the expression of several proteins known to influence LPL activity. To determine whether this is the case, gene expression of LPL inhibitors (apoc3, anglt4 also named fiaf) and activator (apoC2) was quantified in the liver for apoc2 and apoc3 and in the adipose tissue for fiaf of wild-type and Pgp-deficient mice.
Pgp-deficient mice showed a significant decrease in the expression of LPL inhibitor, fiaf with no change in the expression of the other LPL modulators (Fig. 6). Discussion
It is now well-established that Pgp plays a central role in the toxico- and pharmacokinetics of many pharmaceuticals and contaminants (Schinkel et al., 1994; Schinkel et al., 1995;
Schinkel, 1997; Kwei et al., 1999). Pgp is also secondary involved in the transport of dietary and endogenous lipophilic molecules (Aye et al., 2009). Recently, we have reported that Pgp- deficient mice fed standard diet spontaneously develop major metabolic syndrome, e.g. hyperinsulinemia, hepatosteatosis and obesity (Foucaud-Vignault et al., 2011), in favour of a role of Pgp in lipid homeostasis. Overeating and excess of fat in the diet is one of the obvious causes of obesity. Nevertheless, in the context of normal food intake, abnormal absorption or excretion of lipids secondary to Pgp inhibition may contribute to the deregulation of lipid homeostasis. In order to decipher the mechanisms by which the lack of Pgp contributes to the deregulation of lipid metabolism, we have studied several key steps of lipid absorption and utilization in Pgp-deficient mice.
We have first evaluated the impact of the lack Pgp on the intestinal capacity to absorb dietary fat in mice. Typically, intragastric administration of corn oil resulted in a rapid increase in plasma triglycerides which was maximal at 4 hr in wild-type animals. In Pgp-deficient mice, the plasma triglyceride concentrations were dramatically reduced leading to a two-fold decrease in overall fat concentration in the plasma. This phenotype was observed in 12-week old young lean mice and was maintained in 25-week old mice when obesity was installed
(data not shown). Triglycerides from diet oil are first hydrolysed in the intestinal lumen into free fatty acid (FFA) or monoglycerides and further absorbed by enterocytes. After re- esterification in the intestinal cells, they are incorporated into triglyceride-rich lipoproteins, e.g. chylomicrons, secreted and transported via the lymph into the bloodstream. The postprandial triglyceride concentrations in plasma reflect the balance between the capacity of the intestine to absorb lipids and the capacity of the vascular lipoprotein lipase to hydrolyze the circulating triglycerides. Indeed, several central processes can potentially underlie the low postprandial triglyceridemia observed in Pgp deficiency, i.e low lipid absorption rate at the intestinal level, accelerated plasmatic clearance of chylomicrons via accelerated lipolysis by
LPL.
To differentiate between these two causes, the net contribution of intestine to triglyceride absorption was assessed by administration of oral oil load combined with the inhibition of vascular LPL activity by injection of Triton WR-1339. As expected, such treatment causes a tremendous increase in plasma triglycerides in wild-type mice due to the blockage of vascular lipolysis activity. However, in Pgp-deficient mice, the triglyceride accumulation was attenuated when compared with wild-type animals suggesting that in these conditions less triglyceride enter the vascular compartment independently of LPL lypolysis activity.. In the meantime, the hepatic VLDL-triglyceride net secretion measured in fasted animals treated with Triton WR-1339 was unchanged. This shows that hepatic secretion of VLDL is not affected in Pgp-deficient mice and suggests that intestinal triglyceride secretion into plasma compartment was impaired by Pgp deficiency. Together with chylomicron fraction analysis, our results indicate that chylomicrons of similar composition and size as in wild-type are secreted by the intestines of Pgp-deficient mice, but at a lower rate. Therefore, the low postprandial response in Pgp-deficient mice is most likely due to a low absorption rate at the intestinal level.
Several factors may contribute to the low lipid absorption observed secondary to Pgp deficiency, i.e., decrease uptake of fat by intestinal cells and/or impaired delivery from the intestine to the plasma compartment through impaired chylomicrons synthesis and/or secretion by the enterocytes.
The bile secretion is essential for ensuring regular lipid absorption process into the enterocytes. The ABC transporter named multidrug resistance MDR2 located on the hepatobiliary sinusoids, functions as a phopholipid flippase at the canalicular pole of hepatocytes and is essential for phospholipids secretion into the bile. Its absence leads to a lack of postprandial response (Voshol et al., 2000) due to delayed chylomicron production by the enterocytes as a consequence of a defect in the hepatic biliary phosholipid secretion.
In our model, the bile secretion rate and cholesterol content are not affected in Pgp-deficient mice suggesting that bile cannot be responsible for abnormal triglyceride absorption. Thus, if the lower plasma postprandial response originates from an impaired uptake of fat by intestinal cells, the triglyceride should accumulate in the intestine or in the faeces. There was no additional accumulation of lipids in the intestine of Pgp-deficient mice. In the faeces the triglyceride concentration was unchanged while the cholesterol level tended to be decreased, which suggests whether a higher uptake or a lower secretion of cholesterol by the intestine.
Thornton et al, show that mdr1ab-/- mice has an increase in faecal cholesterol, in congruent with the increase LXR expression (Thornton et al., 2008). However, these experiments have been performed in fasted animals and in regard with experiments performed with [3H]triolein after oral oil load, a decrease in radioactivity was measured in the faeces, which may reflect a higher absorption rate of triglycerides in Pgp deficiency in postprandial period. We cannot exclude that subsequently to the lack of Pgp, the intestinal re-excretion of other triglyceride- derived compounds, eg free-fatty acid , di-and monoglycerides is impaired which contribute to the lipid-associated disorder described in Pgp-deficient mice.
We thus wonder if the low postprandial response was due to an altered capacity of intestinal cells to uptake lipids and synthesize chylomicron. Lipid absorption is a three-step process and requires uptake across the luminal membrane followed by cytosolic transport and assembly into lipoproteins, which are further secreted into lymph and blood stream. These processes involved a large range of proteins. Fatty acid transport proteins are well represented in the small intestine by FATP4. Given its role in facilitating the transport of long chain free-fatty acid by the enterocytes (Stahl et al., 1999; Gimeno et al., 2003; Hall et al., 2005), the decrease of fatp4 gene expression measured in Pgp deficiency is in favor of an impaired fatty acid transport into the intestinal cells. Moreover, the resident apoB48 which is a key protein in chylomicron packaging tended to decrease in our model suggesting that chylomicrons synthesis may be affected in Pgp deficiency.
Another cause for low postprandial triglyceride response could be the higher clearance of plasma triglyceride. In our study, the activity and the gene expression of the vascular LPL, enzyme responsible for plasma chylomicrons clearance were unchanged in Pgp deficiency. In addition, the LPL physiological substrates, the plasma chylomicrons, had similar size and composition in wild-type as in Pgp-deficient mice, excluding that any substrate specificity participate to the enzyme activity regulation.
It is noteworthy that mice fed high-fat diet for three weeks have also a defective plasma postprandial triglyceride response which originates from the increase in chylomicrons clearance but not the overall fat absorption (Petit et al., 2007). Similarly to what we observed in Pgp deficiency, the post-heparin plasma LPL activity measured in vitro was unchanged.
However, an indirect induction of plasma lipoprotein lipase activity was suggested, on the basis of the gene induction of the LPL activator apoC2 measured in response to short term feeding high-fat diet (Petit et al., 2007).
In Pgp deficiency, the hepatic expression of apoC2 and apoC3 genes which encode for LPL activator APOC2 and inhibitor APOC3, respectively (Brown and Baginsky, 1972; Clarke and
Holbrook, 1985; Ebara et al., 1997; Jong et al., 2001; Shen et al., 2002) were not modified.
Nevertheless, in adipose tissues, angiopoietin-like proteins produced by angptl3
(Shimizugawa et al., 2002) and angptl4 genes, also named fiaf (Yoshida et al., 2002), involved in inhibition of LPL activity was decreased. This suggests that the inhibition of fiaf may increase the in vivo LPL activity. Indeed, it was previously shown that overexpression of recombinant fiaf shows an inhibition of LPL activity
(Yoshida et al., 2002). These data indicate that downregulation of fiaf markedly impairs plasma triglyceride clearance and accordingly decreases plasma triglyceride levels, most likely via activation of LPL activity.
Subsequently to LPL activation, the enhancement of chylomicron triglyceride lipolysis provides excess of fatty acid to peripheral tissues, which in a long-term process, leads to obesity. Indeed, high-fat diet extended for a 6-month period leads to the development of obese and diabetic phenotypes in C57Bl/6J mice (Seitz et al., 2010). Interestingly, in our model of
Pgp deficiency, the low plasma postprandial triglyceridemia occurs in lean animals fed standard diet and these animals are progressing to obesity phenotype very similar to that described in animals fed high fat-diet.
The increase in the uptake of [3H]triglyceride-derived activity measured in adipose tissue of
Pgp-deficient mice reflects the increase in the uptake of free fatty acid by the tissue and reinforce the finding that LPL activity was increased in Pgp deficiency. It is noteworthy that the increase of [3H]triglyceride-derived radioactivity occurred in subcutaneous but not in perigonadal fat pad. The hypertrophy of subcutaneous fat pad which has previously been observed in Pgp-deficient mice as an early event previous to obesity onset (Foucaud-Vignault et al., 2011) is considered as a predictive factor for lipid metabolic disorders linked to obesity.
We have provided elements showing that obesity in Pgp-deficient mice occurred via an oversupply of fatty acids to fat tissue via inhibition of fiaf. Altogether, these results indicated that LPL may be indirectly more active upon the lack of Pgp in mice and thereby, lead to increased clearance of triglyceride from the blood with a direct entry of intestinally derived fatty acid into the adipose tissue. Because Pgp-deficient mice and those fed high-fat diet have higher plasma triglyceride clearance and develop both obesity, we anticipate that similar process of lipid deregulation may occur in these two models in relation to the oversupply of free fatty acid to fat tissues.
In conclusion, our results reveal that in Pgp deficiency, several processes are altered and contribute to a low plasma postprandial triglycerides response. In one hand, the entry of triglyceride in the blood stream was decreased via the alteration of the expressions of genes involved in the lipid uptake by enterocytes, may be as a feed-back response to lipid oversupply at the intestinal level. In the other hand, the clearance of chylomicron may be increased through the down-regulation of genes encoding the inhibitor of LPL. As a result, the increased production of free-fatty acids and their uptake by adipose tissue certainly contributes to the onset of obesity observed in Pgp-deficient mice. These phenotypic alterations in intestinal lipid absorption and plasma triglyceride clearance occurred in response Pgp deficiency in mice fed a standard diet and are very similar to what is observed in mice fed high-fat diet. By analogy to high-fat diet that leads to oversupply of lipids to the organism and to obesity, we suggest that secondary to the lack of Pgp, the entrance of lipids into the intestinal cells was altered, altering the expression of genes involved in lipid homeostasis, e.g. proteins involved in the lipid uptake and chylomicron packaging in enterocytes, and altering factors modulating fatty acid production and uptake by adipose tissue. The nature of the mechanisms which are at the origin of these regulations remains unknown but given its interaction with Pgp, cholesterol turn over may be altered in Pgp deficiency and at the origin of the lipid deregulation observed.
References
Aye IL, Singh AT and Keelan JA (2009). "Transport of lipids by ABC proteins: interactions and implications for cellular toxicity, viability and function." Chem Biol Interact 180(3): 327-39. Bligh EG and Dyer WJ (1959). "A rapid method of total lipid extraction and purification." Can J Biochem Physiol 37(8): 911-7. Borensztajn J, Rone MS and Kotlar TJ (1976). "The inhibition in vivo of lipoprotein lipase (clearing-factor lipase) activity by triton WR-1339." Biochem J 156(3): 539-43. Brown WV and Baginsky ML (1972). "Inhibition of lipoprotein lipase by an apoprotein of human very low density lipoprotein." Biochem Biophys Res Commun 46(2): 375-82. Chapman JV, Gouaze-Andersson V, Karimi R, Messner MC and Cabot MC (2011). "P- glycoprotein antagonists confer synergistic sensitivity to short-chain ceramide in human multidrug-resistant cancer cells." Exp Cell Res. Clarke AR and Holbrook JJ (1985). "The mechanism of activation of lipoprotein lipase by apolipoprotein C-II. The formation of a protein-protein complex in free solution and at a triacylglycerol/water interface." Biochim Biophys Acta 827(3): 358-68. Dahan A and Altman H (2004). "Food-drug interaction: grapefruit juice augments drug bioavailability--mechanism, extent and relevance." Eur J Clin Nutr 58(1): 1-9. Dugue-Pujol S, Rousset X, Pastier D, Quang NT, Pautre V, Chambaz J, Chabert M and Kalopissis AD (2006). "Human apolipoprotein A-II associates with triglyceride-rich lipoproteins in plasma and impairs their catabolism." J Lipid Res 47(12): 2631-9. Ebara T, Ramakrishnan R, Steiner G and Shachter NS (1997). "Chylomicronemia due to apolipoprotein CIII overexpression in apolipoprotein E-null mice. Apolipoprotein CIII-induced hypertriglyceridemia is not mediated by effects on apolipoprotein E." J Clin Invest 99(11): 2672-81. Ernest S and Bello-Reuss E (1999). "Secretion of platelet-activating factor is mediated by MDR1 P-glycoprotein in cultured human mesangial cells." J Am Soc Nephrol 10(11): 2306-13. Foucaud-Vignault M, Soayfane Z, Menez C, Bertrand-Michel J, Martin P, Guillou H, Collet X and Lespine A (2011). "P-glycoprotein dysfunction contributes to hepatic steatosis and obesity in mice." PLoS One. Garrigues A, Escargueil AE and Orlowski S (2002). "The multidrug transporter, P- glycoprotein, actively mediates cholesterol redistribution in the cell membrane." Proc Natl Acad Sci U S A 99(16): 10347-52. Gayet L, Dayan G, Barakat S, Labialle S, Michaud M, Cogne S, Mazane A, Coleman AW, Rigal D and Baggetto LG (2005). "Control of P-glycoprotein activity by membrane cholesterol amounts and their relation to multidrug resistance in human CEM leukemia cells." Biochemistry 44(11): 4499-509. Gimeno RE, Hirsch DJ, Punreddy S, Sun Y, Ortegon AM, Wu H, Daniels T, Stricker- Krongrad A, Lodish HF and Stahl A (2003). "Targeted deletion of fatty acid transport protein-4 results in early embryonic lethality." J Biol Chem 278(49): 49512-6. Hall AM, Wiczer BM, Herrmann T, Stremmel W and Bernlohr DA (2005). "Enzymatic properties of purified murine fatty acid transport protein 4 and analysis of acyl-CoA synthetase activities in tissues from FATP4 null mice." J Biol Chem 280(12): 11948- 54. Ichihara S, Yamada Y, Kato K, Hibino T, Yokoi K, Matsuo H, Kojima T, Watanabe S, Metoki N, Yoshida H, Satoh K, Aoyagi Y, Yasunaga A, Park H, Tanaka M and Nozawa Y (2008). "Association of a polymorphism of ABCB1 with obesity in Japanese individuals." Genomics 91(6): 512-6. Jong MC, Rensen PC, Dahlmans VE, van der Boom H, van Berkel TJ and Havekes LM (2001). "Apolipoprotein C-III deficiency accelerates triglyceride hydrolysis by lipoprotein lipase in wild-type and apoE knockout mice." J Lipid Res 42(10): 1578-85. Juliano RL and Ling V (1976). "A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants." Biochim Biophys Acta 455(1): 152-62. Klappe K, Hummel I, Hoekstra D and Kok JW (2009). "Lipid dependence of ABC transporter localization and function." Chem Phys Lipids 161(2): 57-64. Kwei GY, Alvaro RF, Chen Q, Jenkins HJ, Hop CE, Keohane CA, Ly VT, Strauss JR, Wang RW, Wang Z, Pippert TR and Umbenhauer DR (1999). "Disposition of ivermectin and cyclosporin A in CF-1 mice deficient in mdr1a P-glycoprotein." Drug Metab Dispos 27(5): 581-7. Livak KJ and Schmittgen TD (2001). "Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method." Methods 25(4): 402-8. Lowry OH, Rosebrough NJ, Farr AL and Randall RJ (1951). "Protein measurement with the Folin phenol reagent." J Biol Chem 193(1): 265-75. Luker GD, Dahlheimer JL, Ostlund RE, Jr. and Piwnica-Worms D (2001). "Decreased hepatic accumulation and enhanced esterification of cholesterol in mice deficient in mdr1a and mdr1b P-glycoproteins." J Lipid Res 42(9): 1389-94. Miller DS, Bauer B and Hartz AM (2008). "Modulation of P-glycoprotein at the blood-brain barrier: opportunities to improve central nervous system pharmacotherapy." Pharmacol Rev 60(2): 196-209. Mizuno N, Niwa T, Yotsumoto Y and Sugiyama Y (2003). "Impact of drug transporter studies on drug discovery and development." Pharmacol Rev 55(3): 425-61. Petit V, Arnould L, Martin P, Monnot MC, Pineau T, Besnard P and Niot I (2007). "Chronic high-fat diet affects intestinal fat absorption and postprandial triglyceride levels in the mouse." J Lipid Res 48(2): 278-87. Raggers RJ, Vogels I and van Meer G (2001). "Multidrug-resistance P-glycoprotein (MDR1) secretes platelet-activating factor." Biochem J 357(Pt 3): 859-65. Raub TJ (2006). "P-glycoprotein recognition of substrates and circumvention through rational drug design." Mol Pharm 3(1): 3-25. Rensen PC, Herijgers N, Netscher MH, Meskers SC, van Eck M and van Berkel TJ (1997). "Particle size determines the specificity of apolipoprotein E-containing triglyceride- rich emulsions for the LDL receptor versus hepatic remnant receptor in vivo." J Lipid Res 38(6): 1070-84. Rodrigues AC, Rebecchi IM, Bertolami MC, Faludi AA, Hirata MH and Hirata RD (2005). "High baseline serum total and LDL cholesterol levels are associated with MDR1 haplotypes in Brazilian hypercholesterolemic individuals of European descent." Braz J Med Biol Res 38(9): 1389-97. Rothnie A, Theron D, Soceneantu L, Martin C, Traikia M, Berridge G, Higgins CF, Devaux PF and Callaghan R (2001). "The importance of cholesterol in maintenance of P- glycoprotein activity and its membrane perturbing influence." Eur Biophys J 30(6): 430-42. Schinkel AH (1997). "The physiological function of drug-transporting P-glycoproteins." Semin Cancer Biol 8(3): 161-70. Schinkel AH, Mayer U, Wagenaar E, Mol CA, van Deemter L, Smit JJ, van der Valk MA, Voordouw AC, Spits H, van Tellingen O, Zijlmans JM, Fibbe WE and Borst P (1997). "Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug- transporting) P-glycoproteins." Proc Natl Acad Sci U S A 94(8): 4028-33. Schinkel AH, Smit JJ, van Tellingen O, Beijnen JH, Wagenaar E, van Deemter L, Mol CA, van der Valk MA, Robanus-Maandag EC, te Riele HP and et al. (1994). "Disruption of the mouse mdr1a P-glycoprotein gene leads to a deficiency in the blood-brain barrier and to increased sensitivity to drugs." Cell 77(4): 491-502. Schinkel AH, Wagenaar E, van Deemter L, Mol CA and Borst P (1995). "Absence of the mdr1a P-Glycoprotein in mice affects tissue distribution and pharmacokinetics of dexamethasone, digoxin, and cyclosporin A." J Clin Invest 96(4): 1698-705. Seitz O, Schurmann C, Hermes N, Muller E, Pfeilschifter J, Frank S and Goren I (2010). "Wound healing in mice with high-fat diet- or ob gene-induced diabetes-obesity syndromes: a comparative study." Exp Diabetes Res: 476969. Shen Y, Lookene A, Nilsson S and Olivecrona G (2002). "Functional analyses of human apolipoprotein CII by site-directed mutagenesis: identification of residues important for activation of lipoprotein lipase." J Biol Chem 277(6): 4334-42. Shimizugawa T, Ono M, Shimamura M, Yoshida K, Ando Y, Koishi R, Ueda K, Inaba T, Minekura H, Kohama T and Furukawa H (2002). "ANGPTL3 decreases very low density lipoprotein triglyceride clearance by inhibition of lipoprotein lipase." J Biol Chem 277(37): 33742-8. Stahl A, Hirsch DJ, Gimeno RE, Punreddy S, Ge P, Watson N, Patel S, Kotler M, Raimondi A, Tartaglia LA and Lodish HF (1999). "Identification of the major intestinal fatty acid transport protein." Mol Cell 4(3): 299-308. Takano M, Yumoto R and Murakami T (2006). "Expression and function of efflux drug transporters in the intestine." Pharmacol Ther 109(1-2): 137-61. Tessner TG and Stenson WF (2000). "Overexpression of MDR1 in an intestinal cell line results in increased cholesterol uptake from micelles." Biochem Biophys Res Commun 267(2): 565-71. Thornton SJ, Wong E, Lee SD and Wasan KM (2008). "Effect of dietary fat on hepatic liver X receptor expression in P-glycoprotein deficient mice: implications for cholesterol metabolism." Lipids Health Dis 7: 21. Vieu C, Jaspard B, Barbaras R, Manent J, Chap H, Perret B and Collet X (1996). "Identification and quantification of diacylglycerols in HDL and accessibility to lipase." J Lipid Res 37(5): 1153-61. Voshol PJ, Minich DM, Havinga R, Elferink RP, Verkade HJ, Groen AK and Kuipers F (2000). "Postprandial chylomicron formation and fat absorption in multidrug resistance gene 2 P-glycoprotein-deficient mice." Gastroenterology 118(1): 173-82. Wang E, Casciano CN, Clement RP and Johnson WW (2000). "Cholesterol interaction with the daunorubicin binding site of P-glycoprotein." Biochem Biophys Res Commun 276(3): 909-16. Yoshida K, Shimizugawa T, Ono M and Furukawa H (2002). "Angiopoietin-like protein 4 is a potent hyperlipidemia-inducing factor in mice and inhibitor of lipoprotein lipase." J Lipid Res 43(11): 1770-2.
Figures lists
Figure 1: Effect of Pgp deficiency on postprandial triglyceride response.
A. Fasted male wild-type and mdr1ab-/- mice were given an intragastric bolus of corn oil (200
µl). Plasma triglyceride concentrations were determined before (0 hr) and at different times post-gavage (0.5, 1, 2, 4 and 8 hr). Values represent means ± SEM; n=9. * p 0.05, *** p
0.001.
B. Area under the plasma triglyceride concentration curve during 8 hr period. All mice received an intragastric bolus of corn oil (200 µl per mouse). The concentration of triglyceride was measured in the plasma over 8 hr post-gavage and the AUC represent values ± SEM, n=9. * p 0.05.
Figure 2: Influence of Pgp deficiency on hepatic secretion and intestinal absorption of triglyceride.
A. Fasted wild-type and mdr1ab-/- mice were injected intravenously with Triton WR-1339 (10 mg per mouse) for hepatic triglyceride secretion.
B. Others received an intragastric bolus of corn oil (200 µl) after Triton WR-1339 injection for intestinal triglyceride absorption.
Plasma triglyceride concentrations were determined before (0 hr) and at different times post- gavage as indicated in figure. Values represent means ± SEM; n=6 per group. * p 0.05.
Figure 3: Expression of gene involved in lipid metabolism in the intestine of wild-type and Pgp-deficient mice.
Relative gene expression was quantified by real-time PCR in the intestine of wild-type and mdr1ab-/- mice. Values were normalized to the cyclophillin gene and expressed as arbitrary units. Values shown are means ± SEM (n=6). * p 0.05.
Figure 4: Effect of Pgp deficiency on plasma lipase activity and expression
A. Postheparin plasma was obtained from wild-type and mdr1ab-/- mice and was incubated with [3H]triolein labelled chylomicron like emulsion and excess fatty acid free BSA. After 1 hr of incubation, generated fatty acid was extracted and plasma lipase activity was calculated as the amount of [3H]oleate produced per hour per mL. Values represent means ± SEM; n=7 per group.
B. Relative LPL mRNA expression was measured in the WAT of wild-type and mdr1ab-/-mice by quantitative RT-PCR and related to that TATA-Box Binding Protein. Values represent means ± SEM; n=3 per group.
Figure 5: Expression of gene involved in the regulation of lipoprotein lipase (LPL) in the liver and WAT of wild-type and Pgp-deficient mice.
Hepatic apoc2 and apoc3 and adipose fiaf mRNA levels was assayed by real-time PCR in wild-type and mdr1ab-/- mice. Values were normalized to the TATA-box binding protein
(TBP) gene in liver and expressed as arbitrary units. Values shown are means ± SEM (n=6).
* p 0.05.
Figure 6: Uptake of [3H]-labeled triolein into tissue lipids.
Fasted male wild-type and mdr1ab-/- mice were force fed 200 µl of corn oil containing
[3H]triolein by gavage and killed 6 hr thereafter. The organs (intestine, liver, heart, muscle, brain and WAT) were isolated, homogenized and counted for [3H]activity. Values represent means ± SEM; n=3 per group. * p 0.05. gWAT and scWAT, gonadal and subcutaneous white adipose tissue. Tables
Table 1: Characterization of chylomicron in term of size and lipid content
Size (nm) Protein (%) Lipid mass (mg) Total cholesterol (%) Triglycerides (%) Phospholipids (%) wild-type 184 ± 7 1.1 ± 0.04 7.2 ± 0.9 4 ± 0.2 91 ± 0.4 5 ± 0.4 mdr1ab-/- 168 ± 7 0.6 ± 0.09* 4.1 ± 0.7* 4.9 ± 0.4 88.8 ± 0.6 6.3 ± 0.4
Chylomicrons were isolated by centrifugation of 250 µl plasma collected 4 h after an intragastric bolus of corn oil load and intravenous injection of 10 mg Triton WR1339, as indicated in Materials and Methods. Free cholesterol, triglyceride and phospholipid levels were determined using commercially available enzymatic assay kits. Protein content of the chylomicron fraction was determined according to Lowry et al. Size was determined using dynamic light scattering techniques. Values represent percentage of total lipid mass that is the lipid class indicated and are given as means ± SEM; n=3 per group. * p 0.05.
Table 2: Lipid content in intestine and faeces in wild-type and mdr1ab-/- mice.
Intestine faeces wild-type mdr1ab-/- wild-type mdr1ab-/- Free cholesterol 6.2 ± 0.5 6.0 ± 0.5 1.0 ± 0.2 0.6 ± 0.1 Cholesteryl ester 0.3 ± 0.03 0.4 ± 0.02 0.6 ± 0.05 0.4 ± 0.1 Total triglycerides 3.6 ± 0.5 4.5 ± 2.2 0.6 ± 0.01 0.5 ± 0.05
Faeces were collected over a period of 24 h, lyophilized and homogenized in methanol/EGTA (2/1; v/v). Intestines were isolated from fasted wild-type and Pgp-deficient mice and homogenised in methanol/EGTA (2/1; v/v). Lipids were extracted and analyzed by Gas chromatography. Values represent means ± SEM and were expressed as µmol/g of tissue; n=3 per group for intestine and n=4 for faeces.
Figure 1
A B
18 wild-type 50
15 mdr1ab-/- 40 12 30 9 *
(mmol/l) 20
6 *** (mmol.h/h) *
3 10 Plasma triglyceride levels levels triglyceride Plasma 0 triglyceride Areaplasma of 0 0 2 4 6 8 12 weeks Time (h)
Figure 2
A 40 wild-type mdr1ab-/-
30
20 (mmol/l)
10 Plasma triglyceride levels levels triglyceride Plasma
0 0 2 4 B 120
100
80 *
60 (mmol/l) 40 *
Plasma triglyceride levels levels triglyceride Plasma 20
0 0 2 4 6 8 Time (h)
Figure 3
1,51.5 wild-type mdr1ab-/-
1
* abundance
0,50.5 mRNA
0 fatp4 mttp apob48 apoa4 dgat2
Figure 4
A B wild-type 1.5 20 1,5 mdr1ab-/-
15 1
10 abundance
0,50.5 (nmol FFA/h/ml) (nmol
5 mRNA Vascular lipolytic activity activity lipolytic Vascular
0 0 12 weeks 12 weeks
Figure 5
Liver WAT
wild-type 1.52 1.52 mdr1ab-/-
1 1
* abundance
0.51 0.51 mRNA
0 0 apoc2 apoc3 fiaf
Figure 6
A B
3 50 wild-type 5 * (39 - 48) mdr1ab-/- 40 4 2 30 3
20 2 1 **
10 1 Plasma 3H activity (dpm/ml) (dpm/ml) activity 3H Plasma 0 0 0 plasma duodenum jejunum faeces liver heart muscle brain gWAT scWAT Tissues 3H activity (nmol FFA/g tissue) (nmol activity 3H Tissues
Publication 4: Le polysorbate augmente la biodisponibilité de l’ivermectine dans le plasma en inhibant la P-glycoprotéine
Le devenir des médicaments lipophiles dans l’organisme est largement conditionné par l’environnement lipidique. Les formulations à base de lipides modifient la biodisponibilité de ces médicaments lipophiles (Charman, 2000; Gershanik and Benita, 2000; Porter et al., 2007). La biodisponibilité de la moxidectine, un médicament lipophile de la famille des lactones macrocycliques (LMs), est augmentée en présence des lipides. La stimulation de la circulation lymphatique et la synthèse de chylomicrons augmente son absorption (Bassissi et al., 2004). L’absorption de l’ivermectine, une autre LM, est augmentée chez l’homme après un repas riche en gras (Guzzo et al., 2002) et chez le lapin lorsqu’elle incoporée dans une formulation liposomale (Bassissi et al., 2006). Les LMs dont l’ivermectine sont transportées dans la circulation systémique par les lipoprotéines, notamment les HDL (Bassissi et al., 2004). De plus, l’ivermectine est un substrat de la Pgp. La déficience en Pgp chez la souris augmente la biodisponibilité de l’ivermectine dans l’organisme (Kiki-Mvouaka et al., 2010). L’effet des lipides sur la biodisponibilité de ce médicament en l’absence de la Pgp n’a pas été élucidé. Compte-tenu que l’absorption de l’ivermectine augmente d’une part en présence des formulations lipidiques et d’autre en absence de la Pgp, l’objectif de cette étude est d’évaluer le rôle de la Pgp et l’influence des lipides et des émulsifiants sur la biodisponibilité de l’ivermectine.
Trois formulations d’ivermectine ont été utilisées. La première consiste à diluer la formulation commerciale d’ivermectine dans de l’eau. La seconde contient un émulsifiant non ionique soluble dans l’eau, le polysorbate 80. La troisième consiste à solubiliser l’ivermectine dans l’huile de maïs. Ces formulations ont été administrées par voie orale à des souris témoins et déficientes en Pgp. Le dosage de l’ivermectine a été réalisé par chromatographie liquide haute performance (HPLC) dans le plasma à 0.5, 1, 2, 4, 8 et 24 h après le gavage.
Nos résultats ont montré que la formulation à base de polysorbate 80 augmente la biodisponibilité de l’ivermectine chez les souris témoins par rapport à la formulation commerciale. Par contre, le polysorbate n’a pas modifié la biodisponibilité de l’ivermectine chez les souris déficientes en Pgp. La formulation à base de d’huile n’a pas changé la
98
biodisponibilité de l’ivermectine en absence ou en présence de la Pgp. Cependant, elle a entraîné un délai dans le temps d’absorption de l’ivermectine.
En conclusion, nous avons confirmé le rôle de la Pgp dans la biodisponibilité de l’ivermectine. Le polysorbate 80 favorise l’absorption de l’ivermectine en inhibant la Pgp (Cornaire et al., 2004). L’effet du polysorbate disparaît en absence de la Pgp. Nous avons également montré que les lipides modifient la biodisponibilité de l’ivermectine en retardant son absorption. Par contre, ils n’ont pas d’effet sur la biodisponiblité de l’ivermectine dépendante de la Pgp.
99
Polysorbate increases plasma availability of ivermectin via inhibition of P- glycoprotein
Zeina Soayfane1, 2, 3, Jean-François Sutra1, Michel Alvinerie1, Anne Lespine1
1-INRA UMR1331, Université de Toulouse III, INP, UPS, TOXALIM, F-31027 Toulouse
2- INSERM, UMR 1048, F-31024 Toulouse
3-Université de Toulouse III, Institut de Maladies Métaboliques et Cardiovasculaires, F-
31432 Toulouse
Corresponding author:
Anne Lespine, INRA UMR1331, Université de Toulouse, INP, UPS, TOXALIM, F-3102
Toulouse, France.
Phone : 33-561285387 - Fax : 33-561285310
E-mail : [email protected] Abstract
The bioavailability of orally administered lipophilic drugs is modulated by lipid excipient- based formulations and P-glycoprotein (Pgp) can modulate the bioavailability of orally administrated drugs which are Pgp substrates such as ivermectin (IVM). We have investigated the effect of vehicles such as oil or emulsifier (polysorbate 80) on the plasma disposition of
IVM in wild-type and Pgp-deficient mice. Wild-type and Pgp-deficient male mice were treated orally with an aqueous, or polysorbate 80, or oil formulations of IVM (0.2 mg/kg, n=4 in each group). Blood was drawn at 0.5, 1, 2, 4, 8 and 24 hr and IVM was measured in plasma by HPLC. Polysorbate 80 IVM formulation in wild-type mice led to a significant increase
(2.5-fold) in IVM plasma concentrations and in the area under the plasma concentration-time curve (AUC) when compared with aqueous formulation. In Pgp-deficient mice compared with wild-type mice, a 2.4-fold higher IVM plasma AUC was measured with aqueous IVM while it was unchanged with polysorbate formulation. In addition in wild-type mice, oil-based IVM formulation did not modify the IVM AUC but delayed IVM absorption when compared with aqueous formulation. In Pgp-deficient mice, IVM AUC was similarly increased after aqueous or oil formulation.
Our results confirm the role of Pgp in limiting IVM intestinal absorption. Overall, they show that polysorbate formulation increases ivermectin bioavailability by counteracting the Pgp action. The change in plasma IVM kinetic profile after oil administration is independent of
Pgp.
Key words: ivermectin, polysorbate 80, lipids, P-glycoprotein, pharmacokinetics Introduction
Ivermectin (IVM) is an antiparasitic and lipophilic drug belonging to the macrocyclic lactones
(MLs) family. IVM was developed in the 1980s as a veterinary treatment against animal gastrointestinal nematodes (McKellar and Benchaoui, 1996) and has been also used in humans to treat millions of cases of onchocerciasis and strongyloidiasis (Molyneux et al.,
2003).
For drugs with systemic action such as MLs, the drug concentrations and the duration in the plasma and in tissues, where the drug target locates, are a determinant for drug efficacy.
When compared with other anthelmintics such as benzimidazoles, the disposition of MLs in the host organism is characterized by a long mean residence time (MRT) that confers to these drugs an interesting long persistence of activity against target parasites. Nevertheless, the drug kinetics in host organism is subjected to many modulations. Indeed, they are significantly changed by the administration route, the nature of the formulation and the animal species
(McKellar and Benchaoui, 1996).
The oral route is the route of choice for drug administration to humans and some species of animals. Much works have been done to increase drug bioavailability by optimizing oral administration of therapeuticals. Given that the uptake of drugs administered orally occurred in the gastrointestinal tract, optimization of oral drug administration is based on a better understanding of absorption processes.
For lipophilic drugs, the oral absorption and bioavailability is strongly modulated by the presence of lipid-emulsifiers in the formulation or by lipid given in co-administration with drug (Porter et al., 2007). Indeed, the bioavailability of IVM in humans is increased when administrated with fat diet (Guzzo et al., 2002). Similarly, IVM orally administered in the same time than oil lead to higher bioavailability in rabbit (Bassissi et al., 2006).
Similarly and as a consequence of lipophilicity, MLs absorption and bioavailability are significantly modulated by the solvent vehicle of the drug formulation (Lo et al., 1985; Wicks et al., 1993). Indeed, oral administration of doramectin, another lipophilic MLs, in a formulation containing sesame oil and ethyl oleate, lead to prolonged half-time (T1/2)of the drug in the plasma in cattle (Wicks et al., 1993).
Besides lipids, the disposition of IVM is also strongly influenced by P-glycoprotein (Pgp).
Pgp is a transmembrane protein that belongs to the ATP binding cassette (ABC) protein superfamily (Schinkel and Jonker, 2003) and is involved in the active efflux of a large number of xenobiotics including drugs such as MLs out of cells and out of organisms (Schinkel and
Jonker, 2003). Indeed, IVM strongly interacts with Pgp as a substrate and an inhibitor
(Schinkel et al., 1994; Pouliot et al., 1997; Lespine et al., 2007). Subsequently, the bioavailability of IVM is influenced by Pgp. Indeed, Pgp-deficient animals such as a subpopulation of the CF-1 mouse strain or genetically engineered mice (Schinkel et al., 1994) as well as a quite high proportion of dogs from Collie breed (Mealey et al., 2001; Mealey et al., 2003; Roulet et al., 2003), are unusually sensitive to the adverse effects of ivermectin. In addition, the lack or the inhibition of Pgp can also increase the absorption process and thus drug disposition in the circulation (Hugnet et al., 2007; Lespine et al., 2008; Kiki-Mvouaka et al., 2010). A number of excipients or surfactants such as Polysorbate 80 and Cremophor EL are commonly used in pharmaceutical formulations to improve the absorption and bioavailability of the lipophilic drugs based on their capacity of solubilizing lipids. They may also disrupt the function of Pgp and thus further enhance the bioavailability of substrate drugs
(Cornaire et al., 2000; Cornaire et al., 2004).
In this study, we have compared the disposition of IVM when orally administered in different formulations and explored the possible role of Pgp in the modulation of the drug disposition.
Therefore, we have followed the plasma concentration of IVM formulated in two oral formulations containing whether polysorbate 80 or corn oil in wild-type and in Pgp-deficient mice over 24 hr. We have then calculated the pharmacokinetic parameters. This work contribute to a better understanding of the absorption processes of lipophilic drugs and help in proposing formulations that will optimize drug availability and efficacy. Materiel and Methods
Chemicals
Ivermectin, trifluoroacetic anhydride, and N-methyl imidazole of analytical reagent grade were purchased from Sigma-Aldrich Chimie (St. Quentin Fallavier, France). Acetonitrile and methanol [high-performance liquid chromatography (HPLC) grade] were obtained from
Thermo Fisher Scientific (Loughborough, UK). Glacial acetic acid (10%) was obtained from
Merck (Clevenot, Chelles, France). PIC B7 low UV reagent was purchased from Waters
(Guyancourt, France). Solid-phase extraction was done using Sulpelclean LC18 cartridges
(100 mg, 1 ml) obtained from Supelco (Bellefonte, PA).
Animals
Mdr1ab-/- mice homozygous for disruption of P-glycoprotein genes abcb1a and abcb1b
(Schinkel et al., 1994; Schinkel et al., 1997) and wild-type mice FVB background were obtained from Taconic farms (NY, USA) and bred at INRA’s transgenic rodent facility at 22
± 2°C under 12 hours light/dark cycles. Experiments were carried out on 11-13 week old male mice. They received ad libitum a standard chow diet and normal water. All procedures adhered to the Guide to the Care and Use of Experimental Animal Care (Canadian Council on
Animal Care, 1984), and the protocol was approved by the local animal ethics committee.
Formulation Drug Preparation
For the oral drug kinetics, three formulations of ivermectin were used (Table 1). Two solutions were prepared from commercial ivermectin (0.08% Oramec; Merial): briefly, stock solution was diluted in water for the aqueous formulation or in an excipient containing 8% polysorbate 80 for the polysorbate-based formulation, to a final concentration of 0.003% and
200 µl corresponding to 0.2 mg/kg b.w. were administrated to each mouse by gavage. The lipid-based formulation was prepared by diluting stock solution of 5 mM ivermectin (in dimethyl sulfoxide) in corn oil to a final concentration of 0.003% and 200 µl corresponding to
0.2 mg/kg b.w. were administrated to each mouse by gavage.
Drug administration for plasma kinetic
Overnight fasted wild-type and Pgp-deficient mice received 200 µl of aqueous-, polysorbate- or oil-based formulation of ivermectin by gavage. Retro-orbital blood samples (50 µl) were collected over 24 h after drug administration at 0.5, 1, 2, 4, 8 and 24 hr post-gavage. Plasma was obtained by centrifugation 10 min at 1500 g and stored at -20°C until analysis.
Drug Extraction and Analytical Procedures
Plasma ivermectin concentrations were determined by HPLC with fluorescence detection according to previously described and validated methods (Alvinerie et al., 1998; Sutra et al.,
1998; Lifschitz et al., 2000). Briefly, plasma were homogenized in acetonitrile (1:1, v/v)
Samples were centrifuged at 2000g, and the supernatant was applied to a Supelco C18 cartridge (Supelco) by using automated solidphase extraction. The extraction recovery for the ivermectin in plasma was 0.95. The eluate was evaporated, and the dry extract was processed to obtain a fluorophore derivative by dissolving it in 1, N-methylimidazole and trifluoroacetic anhydride solutions. Samples were injected into the HPLC system [PU980 pump (Jasko,
Tokyo, Japan), 360 automatic injector (Kontron, Paris, France), and RF-551 fluorescence detector (Shimadzu, Kyoto, Japan)]. A Supelcosil LC18 column (250 Χ 4.6 mm, 5 µm;
Supelco) was used with acetic acid (0.2% in water)-methanol-acetonitrile (4:40:56, v/v/v) as the mobile phase.
Pharmacokinetic Analysis
Data were analyzed using a compartmental approach with version 4.2 of the Kinetica computer program (InnaPhase, Philadelphia, PA). A two exponential equation resulted in the best-fit concentration-time curves and was used to describe the plasma availability kinetics of ivermectin (mono-compartmental model). The terminal absorption half-time (T1/2 ka) and elimination half-time (T1/2 kel) were calculated as in ln2ka and ln2kel, respectively. The areas under the plasma concentration-time curves (AUC) from t0 to t24 h were calculated using the linear trapezoidal rule. The mean residence time (MRT) after oral administration of the drug was calculated using the linear trapezoidal rule without extrapolation to infinity (from 0 to 24 h) using the formula: MRT = AUMC/AUC48 h, where AUMC is the area under the momentum curve. The maximal concentrations (Cmax) and time of maximal occurrence (Tmax) were read from the plotted concentration-time curve for each mouse.
Statistical Analysis
The experimental values are expressed as the mean ± SEM. Statistical analyses were performed using a three-way factorial analysis of variance model. A three-way factorial analysis of variance model with repeated measures was used when more than one observation came from the same animal. Multiple comparisons of means were performed with Tukey’s test. Statistical significance was accepted as p < 0.05. Results and Discussion
Formulations of ivermectin
Improving the bioavailability of oral drugs remains a major challenge in human and veterinary medecine. It is well admitted that formulations impact the drug bioavailability. For lipophilic drugs including MLs, lipid oral co-administration largely impact on their bioavailability. In order to test the impact of formulation on the bioavailability of ivermectin, we have studied three different formulations essentially based on water solubilization, polysorbate 80 or oil (Table 1). For all the formulations, the amount of ivermectin was checked before administration by HPLC measurement. The concentration of ivermectin was
0.03 ± 0.005 mg/ml (0.003%), homogenous for the 3 formulations and stable within 2 weeks.
Effect of polysorbate 80-based formulation on the absorption of ivermectin
Mice were treated orally with a single dose of whether the aqueous or polysorbate formulation of ivermectin (IVM) at 0.2 mg/kg. The plasma concentration of ivermectin was two-fold higher in mice receiving the polysorbate-based formulation when compared to aqueous formulation (Fig. 1A). This was observed until 24 hr, the last time of the experiment, revealing that the polysorbate has a long term effect on the plasma IVM concentration.
Subsequently to the higher drug concentration measured in plasma, the area under the plasma plasma concentration-time curve (AUC 0-24hr) was two-fold higher in mice receiving polysorbate-based formulation when compared with those treated with aqueous formulation
(931 ± 92 vs 374 ± 46 ng.h/ml, respectively, p<0.001). Likewise, the maximal concentration
(Cmax) of IVM in polysorbate-based formulation was significantly higher when compared with aqueous formulation (Table 2). These results indicate that the polysorbate enhance the bioavailability and increase the absorption rate of ivermectin.
Similar extend of increase in plasma ivermectin concentration has been reported in Pgp- deficient mice (Kiki-Mvouaka et al., 2010) or in animals treated with inhibitors of Pgp such as verapamil, ketoconazole or loperamide (Hugnet et al., 2007; Lifschitz et al., 2010; Antonic et al., 2011) or in human co-treated with ivermectin and azithromycin, an antibiotic which is also a Pgp inhibitor (Amsden et al., 2007). Given that polysorbate 80 is known to block Pgp function (Bogman et al., 2003), the increase of ivermectin in plasma of mice receiving polysorbate-based formulation may be due to the concomitant inhibition of Pgp by polysorbate. In order to verify this point, we have administrated orally aqueous- or polysorbate-based formulation in Pgp-deficient mice (mdr1ab-/-). These mice are knock-out for the 2 genes that encode for the 2 Pgp proteins present in rodents (mdr1a and 1b). After treatment with oral aqueous formulation, the plasma concentrations of ivermectin were higher in Pgp-deficient mice when compared with wild-type animals, leading to AUC of 876 ± 42 and 374 ± 46 ng.h/ml, respectively (p<0.001). This is in full agreement with a previous study reporting that the absence of Pgp in mice led to two-fold increase in ivermectin AUC (Kiki-
Mvouaka et al., 2010). Indeed, the role of Pgp in effluxing the drug in the intestinal lumen was demonstrated. When Pgp-deficient mice were treated with polysorbate IVM formulation, no change was observed in the kinetic of plasma IVM concentration when compared in Pgp- deficient mice treated with aqueous formulation (Fig. 1B). In addition, the AUC was in the same range for the two formulations (Table 2). Our data demonstrate that the polysorbate increase bioavailability of ivermectin by inhibiting Pgp activity. Indeed, polysorbate is known to profoundly disturb membrane stability, and given that Pgp activity depends on integrity of the surrounding membrane microdomains (Rege et al., 2002), any alteration of the membrane leads to inactivate the transporter. However, it is interesting to note that the maximal plasma concentration of IVM in the presence of polysorbate was higher than those observed for aqueous formulation in Pgp-deficient mice (Table 2). This result may be due to the possible involvement of other MultiDrug Transporters (MDR) which are inhibited by polysorbate such as Multidrug Resistance-associated Protein (MRP) and Breast Cancer Resistance Protein (BCRP) known to transport macrocyclic lactones (Lespine et al., 2006; Perez et al., 2009;
Jani et al., 2011).
Effect of lipid-based formulation on the absorption of ivermectin
For lipophilic compounds, lipid formulations are also able to dramatically change the drug availability (Porter et al., 2007). It was shown that fat diet have a significant effect with a decrease in the clearance of lipophilic compounds such as halofantrine and amiodarone
(Brocks and Wasan, 2002; Shayeganpour et al., 2005). Simply due to their high hydrophobicity and their binding to circulating lipoprotein (Bassissi et al., 2004), macrocyclic lactones (MLs) should mostly partition in the cellular membrane and also in the lipophilic organelles such as lipid droplets. As a consequence, the cellular MLs uptake is influenced by lipid environnement. It has been shown that lipid co-administration with macrocyclic lactones was associated with an increase in drug AUC in humans (Guzzo et al.,2002), in rabbit
(Bassissi et al., 2004) or in dog (Lespine et al., 2006). Indeed, ivermectin with the liposomal formulation containing cholesterol and phospholipids is rapidly absorbed and attained higher maximum plasma concentration in rabbit when compared with commercial ivermectin formulation. Whereas, there is no difference in term of exposure of the rabbit to the drug as indicated by the same AUC value between these two formulations (Bassissi et al., 2006). The availability of ivermectin in the presence of lipid-based formulation in mice has never been investigated.
Wild-type mice received a single dose of corn oil-based ivermectine formulation at 0.2 mg/kg.
The plasma concentration of ivermectin tended to be decreased in the absorption phase from 0 to 4 hr in the presence of oil when compared with mice receiving aqueous formulation.
However, the plasma concentration of the drug did not vary between these two formulations in the elimination phase from 4 to 24 hr (Fig. 2A). Co-administration with oil increased significantly the Tmax and the half-life of absorption of ivermectin (T1/2Ka) by 3.5- and 8-fold, respectively, revealing that the absorption of ivermectin was delayed in the presence of oil
(Table 3). This may be due to complexity of the intestinal absorption process e.g. lipoprotein formation and secretion by enterocytes in force-fed mice. Whereas, the half-life of elimination of IVM (T1/2Kel), in the presence of oil-based formulation, tended to be decrease in wild-type mice and significantly decreased in Pgp-deficient mice. However, the area under the plasma plasma concentration-time curve of ivermectin when given in oil-based formulation were comparable to those of ivermectin AUC in the presence of aqueous formulation in wild-type
(315 ± 86 vs 374 ± 46 ng.h/ml, respectively) and in Pgp-deficient mice (857 ± 38 vs 876 ± 42 ng.h/ml, respectively) (Table 3). These results were comparable with those of Bassissi et al, where the bioavailability of ivermectin was not modified in liposomal or in commercial aqueous ivermectin formulation (Bassissi et al., 2006). By contrast to that observed with the polysorbate-based formulation in wild-type mice, the ivermectin AUC was unchanged by oil- based formulation when compared with aqueous formulation. Taken together, our results indicate that lipid-based formulation did not modulate the bioavailability of ivermectin but delayed the intestinal absorption of the drug in a Pgp-independent mechanism.
Altogether, our results indicate that Pgp restricts the bioavailability of ivermectin in aqueous formulation. When solubilized in polysorbate, the bioavailability of the drug was increase due to Pgp inhibition. The effect of oil on ivermectin absorption is independent of Pgp in our experimental conditions.
Altogether, these results demonstrate that polysorbate is a relevant agent to be used for sustainable inhibition of Pgp in order to enhance the concentration of ivermectin, or of any
Pgp substrate drug, in plasma.
References
Amsden GW, Gregory TB, Michalak CA, Glue P and Knirsch CA (2007). "Pharmacokinetics of azithromycin and the combination of ivermectin and albendazole when administered alone and concurrently in healthy volunteers." Am J Trop Med Hyg 76(6): 1153-7. Antonic J, Grabnar I, Milcinski L, Skibin A, Sussinger A, Pogacnik M and Cerkvenik-Flajs V (2011). "Influence of P-glycoprotein inhibition on secretion of ivermectin and doramectin by milk in lactating sheep." Vet Parasitol 179(1-3): 159-66. Bassissi F, Lespine A and Alvinerie M (2006). "Assessment of a liposomal formulation of ivermectin in rabbit after a single subcutaneous administration." Parasitol Res 98(3): 244-9. Bassissi MF, Alvinerie M and Lespine A (2004). "Macrocyclic lactones: distribution in plasma lipoproteins of several animal species including humans." Comp Biochem Physiol C Toxicol Pharmacol 138(4): 437-44. Bassissi MF, Lespine A and Alvinerie M (2004). "Enhancement of oral moxidectin bioavailability in rabbits by lipid co-administration." Parasitol Res 94(3): 188-92. Bogman K, Erne-Brand F, Alsenz J and Drewe J (2003). "The role of surfactants in the reversal of active transport mediated by multidrug resistance proteins." J Pharm Sci 92(6): 1250-61. Brocks DR and Wasan KM (2002). "The influence of lipids on stereoselective pharmacokinetics of halofantrine: Important implications in food-effect studies involving drugs that bind to lipoproteins." J Pharm Sci 91(8): 1817-26. Cornaire G, Woodley J, Hermann P, Cloarec A, Arellano C and Houin G (2004). "Impact of excipients on the absorption of P-glycoprotein substrates in vitro and in vivo." Int J Pharm 278(1): 119-31. Cornaire G, Woodley JF, Saivin S, Legendre JY, Decourt S, Cloarec A and Houin G (2000). "Effect of polyoxyl 35 castor oil and Polysorbate 80 on the intestinal absorption of digoxin in vitro." Arzneimittelforschung 50(6): 576-9. Guzzo CA, Furtek CI, Porras AG, Chen C, Tipping R, Clineschmidt CM, Sciberras DG, Hsieh JY and Lasseter KC (2002). "Safety, tolerability, and pharmacokinetics of escalating high doses of ivermectin in healthy adult subjects." J Clin Pharmacol 42(10): 1122-33. Hugnet C, Lespine A and Alvinerie M (2007). "Multiple oral dosing of ketoconazole increases dog exposure to ivermectin." J Pharm Pharm Sci 10(3): 311-8. Jani M, Makai I, Kis E, Szabo P, Nagy T, Krajcsi P and Lespine A (2011). "Ivermectin interacts with human ABCG2." J Pharm Sci 100(1): 94-7. Kiki-Mvouaka S, Menez C, Borin C, Lyazrhi F, Foucaud-Vignault M, Dupuy J, Collet X, Alvinerie M and Lespine A (2010). "Role of P-glycoprotein in the disposition of macrocyclic lactones: A comparison between ivermectin, eprinomectin, and moxidectin in mice." Drug Metab Dispos 38(4): 573-80. Lespine A, Alvinerie M, Vercruysse J, Prichard RK and Geldhof P (2008). "ABC transporter modulation: a strategy to enhance the activity of macrocyclic lactone anthelmintics." Trends Parasitol 24(7): 293-8. Lespine A, Chanoit G, Bousquet-Melou A, Lallemand E, Bassissi FM, Alvinerie M and Toutain PL (2006). "Contribution of lymphatic transport to the systemic exposure of orally administered moxidectin in conscious lymph duct-cannulated dogs." Eur J Pharm Sci 27(1): 37-43. Lespine A, Dupuy J, Orlowski S, Nagy T, Glavinas H, Krajcsi P and Alvinerie M (2006). "Interaction of ivermectin with multidrug resistance proteins (MRP1, 2 and 3)." Chem Biol Interact 159(3): 169-79. Lespine A, Martin S, Dupuy J, Roulet A, Pineau T, Orlowski S and Alvinerie M (2007). "Interaction of macrocyclic lactones with P-glycoprotein: structure-affinity relationship." Eur J Pharm Sci 30(1): 84-94. Lifschitz A, Suarez VH, Sallovitz J, Cristel SL, Imperiale F, Ahoussou S, Schiavi C and Lanusse C (2010). "Cattle nematodes resistant to macrocyclic lactones: comparative effects of P-glycoprotein modulation on the efficacy and disposition kinetics of ivermectin and moxidectin." Exp Parasitol 125(2): 172-8. Lo PK, Fink DW, Williams JB and Blodinger J (1985). "Pharmacokinetic studies of ivermectin: effects of formulation." Vet Res Commun 9(4): 251-68. McKellar QA and Benchaoui HA (1996). "Avermectins and milbemycins." J Vet Pharmacol Ther 19(5): 331-51. Mealey KL, Bentjen SA, Gay JM and Cantor GH (2001). "Ivermectin sensitivity in collies is associated with a deletion mutation of the mdr1 gene." Pharmacogenetics 11(8): 727- 33. Mealey KL, Northrup NC and Bentjen SA (2003). "Increased toxicity of P-glycoprotein- substrate chemotherapeutic agents in a dog with the MDR1 deletion mutation associated with ivermectin sensitivity." J Am Vet Med Assoc 223(10): 1453-5, 1434. Molyneux DH, Bradley M, Hoerauf A, Kyelem D and Taylor MJ (2003). "Mass drug treatment for lymphatic filariasis and onchocerciasis." Trends Parasitol 19(11): 516- 22. Perez M, Blazquez AG, Real R, Mendoza G, Prieto JG, Merino G and Alvarez AI (2009). "In vitro and in vivo interaction of moxidectin with BCRP/ABCG2." Chem Biol Interact 180(1): 106-12. Porter CJ, Trevaskis NL and Charman WN (2007). "Lipids and lipid-based formulations: optimizing the oral delivery of lipophilic drugs." Nat Rev Drug Discov 6(3): 231-48. Pouliot JF, L'Heureux F, Liu Z, Prichard RK and Georges E (1997). "Reversal of P- glycoprotein-associated multidrug resistance by ivermectin." Biochem Pharmacol 53(1): 17-25. Rege BD, Kao JP and Polli JE (2002). "Effects of nonionic surfactants on membrane transporters in Caco-2 cell monolayers." Eur J Pharm Sci 16(4-5): 237-46. Roulet A, Puel O, Gesta S, Lepage JF, Drag M, Soll M, Alvinerie M and Pineau T (2003). "MDR1-deficient genotype in Collie dogs hypersensitive to the P-glycoprotein substrate ivermectin." Eur J Pharmacol 460(2-3): 85-91. Schinkel AH and Jonker JW (2003). "Mammalian drug efflux transporters of the ATP binding cassette (ABC) family: an overview." Adv Drug Deliv Rev 55(1): 3-29. Schinkel AH, Mayer U, Wagenaar E, Mol CA, van Deemter L, Smit JJ, van der Valk MA, Voordouw AC, Spits H, van Tellingen O, Zijlmans JM, Fibbe WE and Borst P (1997). "Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug- transporting) P-glycoproteins." Proc Natl Acad Sci U S A 94(8): 4028-33. Schinkel AH, Smit JJ, van Tellingen O, Beijnen JH, Wagenaar E, van Deemter L, Mol CA, van der Valk MA, Robanus-Maandag EC, te Riele HP and et al. (1994). "Disruption of the mouse mdr1a P-glycoprotein gene leads to a deficiency in the blood-brain barrier and to increased sensitivity to drugs." Cell 77(4): 491-502. Shayeganpour A, Jun AS and Brocks DR (2005). "Pharmacokinetics of Amiodarone in hyperlipidemic and simulated high fat-meal rat models." Biopharm Drug Dispos 26(6): 249-57. Wicks SR, Kaye B, Weatherley AJ, Lewis D, Davison E, Gibson SP and Smith DG (1993). "Effect of formulation on the pharmacokinetics and efficacy of doramectin." Vet Parasitol 49(1): 17-26.
Figure lists:
Figure 1: Comparison of concentration-time profile of orally administrated IVM in aqueous and polysorbate 80 formulations.
Wild-type (A) and Pgp-deficient mice (B) received by gavage (200 µl) a single oral dose of
IVM (0.2mg/kg b.wt.) in polysorbate-based formulation and compared to those received IVM in aqueous formulation. Blood was collected at 0.5, 1, 2, 4, 8 and 24 hr after gavage. IVM concentration was measured in plasma by HPLC as described under Materials and Methods.
Values are means ± SEM. (n = 4 animals/condition).
Figure 2: Comparison of concentration-time profile of orally administrated IVM in aqueous and lipid formulations
Wild-type (A) and Pgp-deficient mice (B) received by gavage (200 µl) a single oral dose of
IVM (0.2 mg/kg b.wt.) in oil-based formulation and compared to those received IVM in aqueous formulation. Blood was collected at 0.5, 1, 2, 4, 8 and 24 hr after gavage. IVM concentration was measured in plasma by HPLC as described under Materials and Methods.
Values are means ± SEM. (n = 4 animals/condition). Tables
Table 1: Composition of three types of IVM formulations used in mice experiments
Aqueous, polysorbate 80 and oily formulation of IVM were prepared as follows:
aqueous polysorbate 80 oil 7.5 µl (6 µg of 7.5 µl (6 µg of ivermectin (oramec 0.08%) IVM) IVM) 1.4 µl (6 µg of ivermectin (5mM in DMSO) IVM) polysorbate 80 16 µl propylen glycol 40 µl benzyl alcohol 6 µl disodium phosphate anhydrous 0.2 µl sodium dihydrogen phosphate monohydrate 1.8 µl corn oil (qsp) 200 µl Water (qsp) 200 µl 200 µl
Table 2: Influence of polysorbate on the pharmacokinetic parameters of IVM in the plasma of wild-type and Pgp-deficient mice.
ratio aqueous polysorbate 80 polysorbate/aqueous
wild-type mice AUC (ng*h/ml) 374.6 ± 46.3 931.2 ± 92*** 2.5 Cmax (ng/ml) 28.9 ± 4.6 72.6 ± 5.5*** Tmax (h) 2.4 ± 0.4 2.7 ± 0.1
T1/2Ka (h) 0.6 ± 0.1 0.7 ± 0.1
T1/2Kel (h) 9.4 ± 0.7 11.1 ± 3.1 MRT (h) 9.3 ± 0.2 9.1 ± 0.4
mdr1ab-/- mice AUC (ng*h/ml) 876.1 ± 42.5 1008.7 ± 55.3 1.1 Cmax (ng/ml) 54.4 ± 4.7 74.3 ± 5* Tmax (h) 2.6 ± 0.1 3.1 ± 0.2
T1/2Ka (h) 0.5 ± 0.02 0.9 ± 0.1
T1/2Kel (h) 12.9 ± 1.2 9.3 ± 0.8 MRT (h) 10.3 ± 0.4 9.6 ± 0.1
Wild-type and Pgp-deficient mice were treated orally with ivermectin (0.2 mg/kg bw) with aqueous or polysorbate 80 formulations. Blood was collected at 0.5, 1, 2, 4, 8 and 24 hr after gavage and IVM was measured in plasma by HPLC. AUC: area under the plasma concentration-time curve, Cmax: Calculated peak plasma concentration, Tmax: time to reach
Cmax: T1/2Ka: half-life of absorption, T1/2Kel: half-life of elimination, MRT: mean residence time. Value are means ± SEM. (n = 4 animals/condition) *p<0.05, ***p<0.001 when compared with aqueous formulation Table 3: Influence of oil on the pharmacokinetic parameters of IVM in the plasma of wild-type and Pgp-deficient mice.
aqueous oil ratio oil/aqueous
wild-type mice AUC (ng*h/ml) 374.6 ± 46.3 315.5 ± 86 0.8 Cmax (ng/ml) 28.9 ± 4.6 20.3 ± 6.2 Tmax (h) 2.4 ± 0.4 8.3 ± 1.1***
T1/2Ka (h) 0.6 ± 0.1 4.9 ± 0.4***
T1/2Kel (h) 9.4 ± 0.7 5.1 ± 0.4 MRT (h) 9.3 ± 0.2 11.3 ± 0.6
mdr1ab-/- mice AUC (ng*h/ml) 876.1 ± 42.5 857.9 ± 38.7 0.9 Cmax (ng/ml) 54.4 ± 4.7 66.3 ± 3.1 Tmax (h) 2.6 ± 0.1 5.5 ± 0.6***
T1/2Ka (h) 0.5 ± 0.02 3.6 ± 0.6***
T1/2Kel (h) 12.9 ± 1.2 4.2 ± 0.3*** MRT (h) 10.3 ± 0.4 9.7 ± 0.4
Wild-type and Pgp-deficient mice were treated orally with ivermectin (IVM, 0.2 mg/kg bw.) in aqueous or corn oil formulation. Blood was collected at 0.5, 1, 2, 4, 8 and 24 hr after gavage and IVM was measured in plasma by HPLC. AUC: area under the plasma concentration-time curve, Cmax: Calculated peak plasma concentration, Tmax: time to reach
Cmax: T1/2Ka: half-life of absorption, T1/2Kel: half-life of elimination, MRT: mean residence time. Value are means ± SEM. (n = 4 animals/condition). ***p<0.001 when compared with aqueous formulation
Figure 1
A B
1000 IVM IVM IVM + polysorbate 1000 IVM + polysorbate
100 *** ***
*** *** 100 (ng/ml) (ng/ml)
10 10 Plasma IVM concentration Plasma 1 1 0 4 8 12 16 20 24 0 4 8 12 16 20 24 Time (h) Time (h)
Figure 2
A B
1000 IVM IVM IVM + oil 1000 IVM + oil
100
100 (ng/ml) (ng/ml)
10 10 Plasma IVM concentration Plasma 1 1 0 4 8 12 16 20 24 0 4 8 12 16 20 24 Time (h) Time (h)
Discussion générale
100
Discussion générale 2011
L’absorption des lipides (cholestérol et triglycérides), des micronutriments (vitamines) et des médicaments lipophiles est un processus complexe qui n’est pas clairement élucidé. Une absorption altérée des lipides peut aboutir à des troubles métaboliques importants conduisant à diverses pathologies dont notamment les maladies cardiovasculaires qui sont actuellement des problèmes de santé publique. Dans ce contexte, nous avons recherché les mécanismes qui régissent l’absorption du cholestérol et des micronutriments lipidiques, notamment la vitamine E, tout au long de l’intestin et en fonction de la teneur du milieu en lipides. Par ailleurs, l’absorption intestinale des médicaments lipophiles suit celle des lipides alimentaires et est stimulée en présence de lipides. Certains de ces médicaments lipophiles sont transportés par la P-glycoprotéine (Pgp), un transporteur d’efflux de la famille des protéines « ATP-Binding Cassette » (ABC) et dont le rôle dans le processus d’absorption des lipides est peu connu. Nous avons recherché l’implication de la Pgp dans l’homéostasie des lipides et les mécanismes d’absorption globale des lipides dans l’organisme. Nous avons aussi exploré le rôle des lipides dans l’absorption des médicaments lipophiles médiée par la Pgp en prenant comme modèle l’ivermectine, une lactone macrocyclique (LM) antiparasitaire lipophile.
Implication de NPC1L1 et SR-B1 dans l’absorption intestinale du cholestérol
Nos résultats confirment que l’absorption du cholestérol est augmentée en présence de l’acide oléique dans les micelles. Ceci est en accord avec de précédents travaux montrant que les micelles mixtes contenant des AGLC stimulent l’absorption du cholestérol et la sécrétion des lipoprotéines riches en triglycérides, les chylomicrons (Chateau et al., 2005; Iqbal and Hussain, 2005). De plus, dans notre étude, l’absorption du cholestérol fait intervenir le transporteur NPC1L1 in vitro sur des cellules Caco-2 et in vivo tout au long de l’intestin. Nos résultats sont en accord avec ceux de Narushima et ses collaborateurs, qui ont montré que l’absorption du cholestérol à partir de micelles mixtes est augmentée dans les cellules Caco-2 surexprimant NPC1L1, et que l’inhibition de NPC1L1 par l’ézétimibe chez la souris entraîne une diminution de l’absorption du cholestérol (Narushima et al., 2008). De plus, la déficience de
101
Discussion générale 2011
NPC1L1 chez la souris montre également une réduction significative de l’absorption intestinale du cholestérol et certains phytostérols (Davis et al., 2004). Cette déficience en NPC1L1 réduit la sécrétion intestinale des HDL via la diminution de l’expression du transporteur ABCA1. Par contre, elle augmente la synthèse endogène du cholestérol, ce qui permet le maintien du taux cellulaire du cholestérol (Davis et al., 2004). De plus, l’invalidation de NPC1L1 par des siARN resulte en l’augmentation de l’expression et de l’activité de la HMG-CoA reductase, l’enzyme limitante dans la synthèse du cholestérol (Sane et al., 2006). Le rôle de SR-B1 dans l’absorption du cholestérol n’est pas encore clairement établi. Certaines études ont montré son implication dans l’absorption du cholestérol alors que d’autres s’y opposent. Nos résultats ont montré que l’absorption du cholestérol fait intervenir SR-B1 in vitro dans les cellules Caco-2 et in vivo dans le jéjunum distal chez la souris surexprimant SR-B1. Ces résultats sont en accord avec d’autres équipes où l’inhibition chimique ou par un anticorps contre SR-B1 entraîne une diminution de l’absorption du cholestérol micellaire dans les vésicules préparées à partir des membranes de bordure en brosse (« Brush Border Membrane », BBM) ou dans les cellules CHO transfectées par SR-B1 (Werder et al., 2001; Altmann et al., 2002). De plus, l’étude de Bietrix et ses collaborateurs réalisée chez les souris surexprimant SR-B1 a montré que ce transporteur est impliqué au niveau de jéjunum médian et distal (Bietrix et al., 2006). Par contre, plusieurs études convergent vers la non implication de SR-B1 dans l’absorption du cholestérol dans les cellules CHO surexprimant SR-B1 (Cai et al., 2004) et chez les souris déficientes en SR-B1 (Altmann et al., 2002; Nguyen et al., 2009). Nous avons également montré in vitro que les transporteurs NPC1L1 et SR-B1 sont impliqués dans l’absorption du cholestérol en suivant une voie commune vers les chylomicrons. En accord avec une voie commune pour les deux transporteurs, Labonte et ses collaborateurs ont montré que les souris déficientes en NPC1L1 sont sensibles à l’ézétimibe vis-à-vis de l’absorption du cholestérol (Labonte et al., 2007). Ainsi, l’ézétimibe pourrait aussi inhiber SR-B1 (Altmann et al., 2002), suggérant un rôle de SR-B1 dans l’absorption du cholestérol. Ceci n’exclut pas la participation d’autres transporteurs qui peuvent aussi être inhibés par l’ézétimibe. L’ensemble de ces résultats suggère fortement que NPC1L1 et SR-B1 coopèrent pour absorber le cholestérol. Nous avons montré que comme pour le cholestérol, le NBD-cholestérol, un dérivé fluorescent du cholestérol, est plus absorbé dans les cellules incubées avec des micelles 102
Discussion générale 2011
contenant de l’acide oléique. Par contre, son absorption ne fait intervenir aucun de ces deux transporteurs, en accord avec l’étude d’Adams et ses collaborateurs, qui ont démontré que le NBD-cholestérol est pris en charge par la muqueuse intestinale, estérifié et transporté vers la circulation sanguine indépendemment de NPC1L1 (Adams et al., 2011). Cette différence d’absorption entre le cholestérol et le NBD-cholestérol pourrait être due à une incorporation différente dans les micelles. En effet, le NBD-cholestérol possède deux extrémités polaires qui pourraient orienter la molécule plutôt vers la surface des micelles, alors que pour le cholestérol qui est amphiphile, la molécule est plus enfouie dans les micelles. Mais par ailleurs, il est fort probable qu’il y ait aussi une différence de reconaissance par NPC1L1 et SR-B1. En effet, le domaine de liaison des transporteurs NPC1L1 et SR-B1 est hydrophobe (Gu et al., 1998; Davis and Altmann, 2009), donc plus adapté à recevoir le cholestérol que le NBD-cholestérol.
Implication de NPC1L1 et SR-B1 dans l’absorption intestinale du tocophérol
Nous avons confirmé que l’absorption du tocophérol, comme celle du cholestérol, est plus importante en présence de l’acide oléique et fait intervenir SR-B1 et NPC1L1 selon une voie commune vers les chylomicrons. En faveur de ces résultats, plusieurs études ont montré que l’absorption intestinale de la vitamine E augmente avec l’augmentation de la concentration en acide oléique et en acides biliaires dans les micelles (Traber et al., 1990; Anwar et al., 2006). Les travaux de Reboul et ses collaborateurs ont montré que l’inhibition chimique ou par un anticorps contre SR-B1 diminue l’absorption du tocophérol dans les cellules Caco-2 (Reboul et al., 2006). De plus, Narushima et ses collaborateurs ont montré que l’absorption du tocophérol est augmentée dans les cellules surexprimant NPC1L1 et diminuée chez les souris traitées à l’ézétimibe (Narushima et al., 2008). Nous avons aussi montré que l’absorption du tocophérol implique NPC1L1 dans le jéjunum distal et est corrélée avec son niveau d’expression. De plus, SR-B1 est aussi impliqué dans le duodénum et le jéjunum proximal. Cependant, une partie de l’absorption du tocophérol n’a pas pu être expliquée par ces deux transporteurs, ce qui suggère l’implication d’autre(s) transporteur(s) au niveau du jéjunum.
103
Discussion générale 2011
P-glycoprotéine : son rôle dans l’homéostasie des lipides
La Pgp est un transporteur impliqué dans l’efflux de nombreux xénobiotiques. Plusieurs études ont montré qu’elle est aussi impliquée dans le transport et la régulation d’une variété de composés lipidiques tels que le cholestérol (Luker et al., 2000; Tessner and Stenson, 2000; Garrigues et al., 2002), les stéroïdes (Leveille-Webster and Arias, 1995) et les sphingolipides (Eckford and Sharom, 2005; Chapman et al., 2011). Par ailleurs, il a été démontré que le polymorphisme de la Pgp est associé à des désordres métaboliques tels qu’une augmentation de la cholestérolémie chez une population japonaise (Rodrigues et al., 2005) et une obésité chez une population brésilienne (Ichihara et al., 2008). De plus, un lien entre le diabète et la Pgp a été établi : le niveau d’expression de la Pgp dans le cortex cérébral des souris diabétiques est atténué (Kamei et al., 2005). De plus, une étude récente a montré que la perméabilité intestinale des substrats de la Pgp est diminuée chez les rats diabétiques (Neerati et al., 2011). Il existe donc un lien entre la Pgp et l’homéostasie des lipides, mais aucun phénotype n’a été décrit jusqu’alors en absence de la Pgp.
Lien entre la Pgp, l’obésité et le métabolisme du cholestérol
L’obésité est multifactorielle et la suralimentation est l’une de ses causes évidentes (Collins et al., 2004; Liu et al., 2004). Elle est également génétique comme c’est le cas des souris ob/ob (Batt et al., 1978) ou db/db (Cox and Powley, 1977). Nous avons récemment montré que la Pgp pourrait être impliquée dans le développement de l’obésité (Foucaud- Vignault et al., 2011). Les souris déficientes en Pgp et soumises à un régime alimentaire normal pendant 35 semaines développent une obésité associée à d’autres troubles métaboliques tels que l’hyperglycémie, l’hyperinsulinémie et la stéatose hépatique. Ces observations sont d’autant plus intéressantes que les souris utilisées ont le fond génétique FVB connu pour être résistant à l’obésité induite par l’alimentation (Hu et al., 2004). Ainsi, dans ce modèle, l’absence de la Pgp est capble de réverser le phénotype non-obèse. L'obésité se manifeste dans de nombreuses situations où les gènes impliqués dans l'homéostasie lipidique sont perturbés. La stéatose hépatique, l’une des conséquences de l’obésité, se traduit par une accumulation de triglycérides dans le foie. Cette accumulation est due à une augmentation de la synthèse endogène des triglycérides et/ou à une augmentation 104
Discussion générale 2011
de leur absorption par le foie. Dans le cas où la Pgp est absente, une augmentation de l’expression de la « fatty acid synthase » (fasn), la « stearoyl-CoA desaturase » (scd-1) et le « fatty acid transporter » (CD36) a été montrée, en accord avec une augmentation de la synthèse de novo et la captation des triglycérides par le foie. De même, il a été montré qu’une altération de l’un de ces gènes pourrait aboutir à l’obésité et/ou à la stéatose hépatique. Les souris déficientes en scd-1 sont maigres et montrent une diminution des triglycérides hépatiques (Ntambi et al., 2002; Dobrzyn et al., 2004). L’expression hépatique de scd-1 est induite chez les souris ob/ob (Haluzik et al., 2004). D’autres études ont montré que l’induction hépatique de cd36 pourrait aussi contribuer à l'obésité (Coburn et al., 2000; Terpstra et al., 2000). Compte-tenu que scd-1 et fasn sont régulés par le récepteur nucléaire « Liver X Receptor » (LXR) (Ducheix et al., 2011) et cd36 par le « Peroxisome Proliferator-Activated Receptor gamma» (PPARγ) (Rogue et al., 2010), nous suggérons que le turn-over des ligands de ces récepteurs nucléaires tels que le cholestérol et les oxystérols pourrait être affecté en l’absence de la Pgp dans le sens d’une augmentation de leur taux cellulaire. En accord avec nos résulats, PPARγ est activé en présence d’un régime « High fat diet » (HFD) (Tontonoz et al., 1994; Memon et al., 2000; Herzig et al., 2003) et chez les souris diabétiques et obèses (Memon et al., 2000; Matsusue et al., 2008) induisant l’expression des gènes impliqués dans la captation et le stockage des acides gras. Le contrôle des facteurs de transcription métaboliques devrait être un processus coordonné puisque dans la plupart des cas, de multiples facteurs sont impliqués dans la régulation de plusieurs gènes impliqués dans le métabolisme des lipides. En effet, le facteur nucléaire hépatocytaire 4 (HNF4) est d’un interêt particulier, étant donné sa fonction cruciale dans le maintien du phénotype des hépatocytes (Li et al., 2000; Kyrmizi et al., 2006) ainsi que son rôle dans la régulation de plusieurs gènes impliqués dans la gluconéogenèse, la synthèse des acides biliaires (Hayhurst et al., 2001; Rhee et al., 2003; Inoue et al., 2004; Inoue et al., 2006). L’inactivation spécifique au niveau foie du HNF4 conduit à une hépatomégalie et un dépôt anormal des triglycérides et des acides gras dans le foie (Hayhurst et al., 2001; Martinez-Jimenez et al., 2010). De plus, un régime riche en lipides induit l’expression de CD36, PPARα et PPARγ chez les souris déficientes en hnf4, montrant ainsi son rôle important dans la régulation du métabolisme des acides gras (Martinez-Jimenez et al., 2010). Dans notre modèle de souris déficientes en Pgp, il serait interessant d’évaluer l’expression hépatique de HNF4, étant donné qu’une activation des cibles de PPARα et PPARγ a été observée. 105
Discussion générale 2011
La déficience en Pgp augmente la concentration du cholestérol total et des HDL (HDL-C) et l’expression de la « phospholipid transfer protein » pltp dans le foie. La PLTP est impliquée dans le remodelage des HDL et la clairance du cholestérol (Samyn et al., 2009). La PLTP est activée par LXR (Cao et al., 2002), en accord avec l’augmentation de son expression dans notre modèle déficient en Pgp. Ces résultats sont en accord avec ceux de (Thornton et al., 2008). Le cholestérol et les acides biliaires dans la bile sont augmentés dans notre modèle et associés à l’induction de l’expression de la « cholesterol 7α hydroxylase » (cyp7a1) qui est impliquée dans la synthèse des acides biliaires à partir du cholestérol. Ce gène est aussi régulé par LXR (Chiang et al., 2001), suggérant une perturbation également dans le métabolisme du cholestérol et des acides biliaires.
Lien entre la Pgp et le métabolisme des xénobiotiques
De nombreux xénobiotiques sont efflués par la Pgp en dehors de la cellule et de l’organisme. Ainsi, l’absence de la Pgp contribue certainement à perturber les mécanismes de protection de l’organisme contre ces xénobiotiques. Nous avons montré une induction de l’expression des gènes impliqués dans le métabolisme des xénobiotiques, cyp2b10 et cyp3a11 chez les souris déficientes en Pgp. Ces gènes sont régulés par les récepteurs nucléaires « Pregnane X Receptor » (PXR) et « Constitutive Androstane Receptor » (CAR), respectivement (Moore et al., 2002; Kohle and Bock, 2009). Ceci montre que les concentrations des activateurs potentiels de ces récepteurs sont augmentées en absence de la Pgp, en accord avec son rôle de transport d’efflux. Ces modifications peuvent être à l’origine de l’obésité installée chez les souris déficientes en Pgp. En effet, un rôle de ces récepteurs dans le métabolisme des lipides a été établi. L’induction du récepteur CAR chez les souris nourries avec un régime gras conduit à une augmentation de la triglycéridémie (Maglich et al., 2009). De plus, la surexpression de PXR entraîne une accumulation des triglycérides dans le foie et une augmentation de cd36 et des enzymes impliquées dans la synthèse de novo des acides gras (Zhou et al., 2006). L’ensemble de ces résultats suggère que des perturbations dans le métabolisme des xénobiotiques pourraient aussi contribuer à l’obésité et la stéatose hépatique dans notre modèle de déficience en Pgp.
106
Discussion générale 2011
Altération du processus d’absorption intestinale en absence de la Pgp
L’obésité est souvent liée à une augmentation de la lipémie postprandiale (Potts et al., 1995; Picard et al., 2002; van Wijk et al., 2003; Eleftheriadou et al., 2008). Cependant, dans notre modèle de souris obèses, la triglycéridémie postprandiale est fortement atténuée. Il est intéressant de noter que le régime riche en gras diminue la triglycéridémie postprandiale chez la souris (Petit et al., 2007). Par analogie, l’absence de la Pgp pourrait reproduire un excès de gras dans l’alimentation. Parmi les mécanismes explorés, nous avons montré que les souris déficientes en Pgp avaient une diminution de l’absorption intestinale des lipides et de la sécrétion plasmatique des chylomicrons. Ces résultats sont en à mettre en parallèle avec ceux de Voshol et ses collaborateurs, qui ont montré que la baisse de la triglycéridémie postprandiale chez les souris déficientes en mdr2 est due à une diminution de la sécrétion des chylomicrons de la cellule intestinale vers le compartiement sanguin (Voshol et al., 2000). En effet, MDR2 est un transporteur ABC localisé dans les canalicules hépatobiliaires et essentiel pour la sécrétion des phospholipides dans la bile. Une perfusion d’acides biliaires restaure la baisse de la triglycéridémie postprandiale chez les souris déficientes en mdr2 (Voshol et al., 2000). Dans notre modèle de souris déficientes en Pgp, la sécrétion biliaire est inchangée (Thornton et al., 2008), suggérant que la bile ne serait pas responsable de l’absorption altérée des triglycérides. Parmi les acteurs impliqués dans l’absorption des lipides, nous avons montré une diminution de l’expression intestinale de fatp4 et une tendance de l’apoB48 à la baisse en absence de la Pgp. Ces gènes sont impliqués dans la captation entérocytaire des acides gras et dans le compactage et la sécrétion des chylomicrons, respectivement (Gimeno et al., 2003; Xie et al., 2006; Sandoval et al., 2010). Ces résultats pourraient expliquer l’altération au niveau du transport intestinal des lipides, et nous permettent de suggérer que la voie de synthèse des chylomicrons est affectée dans notre modèle de souris déficientes en Pgp (figure 26).
107
Discussion générale 2011
Entérocyte Plasma
AG DG Absorption des acides gras CM
fatp4
mttp
apob48 CM CM
RE apob48 mRNA Lymphe
Figure 26 : Diminution de la sécrétion intestinale des triglycérides en absence de la Pgp La déficience en Pgp diminue la captation des acides gras par l’entérocyte par fatp4. Ils sont ensuite estérifiés en triglycérides et transférés à l’apoB48 grâce à la mttp. La diminution de l’apoB48 entraine une altération dans le compactage des chylomicrons et une diminution de leur sécrétion dans la lymphe puis dans le plasma. AG : acides gras ; DG : diglycérides ; RE : réticulum endoplasmique ; CM : chyomicrons ; mttp : microsomal triglyceride transfer protein ; apoB : apolipoprotéine B
Augmentation de la clairance plasmatique des lipides en absence de la Pgp
Nous avons ensuite montré que la baisse de la triglycéridémie postprandiale chez les souris déficientes en Pgp est due à une captation importante par le tissu adipeux des acides gras, produits d’hydrolyse des triglycérides par la lipoprotéine lipase (LPL). L’expression et l’activité de la LPL sont inchangées chez les souris déficientes en Pgp. Cependant, l’activité de la LPL est régulée par de nombreux cofacteurs que nous avons explorés. L’étude de Petit et ses collaborateurs a montré que la baisse de la triglycéridémie postprandiale à la suite d’un régime riche en gras est due à une augmentation de la clairance plasmatique des triglycérides stimulée par l’induction de l’apoC2 (Petit et al., 2007), un gène impliqué dans l’activation de la LPL (Clarke and Holbrook, 1985; Shen et al., 2002). Cependant, dans notre modèle, les expressions hépatique et intestinale de l’apoC2 sont inchangées.
108
Discussion générale 2011
D’autres facteurs sont impliqués dans l’inhibition de l’activité de la LPL tels que l’apoC3 (Ebara et al., 1997; Jong et al., 2001) et le « fasting induced-adipose tissue factor» (fiaf) (Yoshida et al., 2002). L’expression de l’apoC3 est inchangée alors que celle du fiaf est diminuée chez les souris déficientes en Pgp. Cette étude fait apparaître le fiaf comme central dans la protection contre l’obésité. Il a été démontré que la suppression du fiaf induit une activation de la LPL dans les adipocytes et stimule le stockage des triglycérides (Backhed et al., 2004). De plus, la surexpression du fiaf induit une hypertriglycéridémie postprandiale chez la souris accompagnée d’une réduction de la masse adipeuse (Mandard et al., 2006). Dans cette étude, les auteurs ont montré que l’activité de la LPL est inchangée chez les souris surexprimant fiaf. Par contre, l’augmentation de l’expression d’une autre lipase produite par le tissu adipeux, l’ « adipose triglyceride lipase » (ATGL) provoque une accumulation des acides gras dans le plasma et par la suite une diminution de leur captation par le tissu adipeux et les autres tissus périphériques (Mandard et al., 2006). D’autres études ont montré que le fiaf active les voies qui sont impliqués dans la β- oxydation des acides gras dans leurs tissus périphériques. Il s’agit des voies « AMP activated protein-kinase » (AMPK) et « PPARγ co-activateur 1α » (PGC-1α) (Mandard et al., 2006; Backhed et al., 2007). De plus, le fiaf est régulé par les récepteurs nucléaires PPARα et PPARγ, qui sont impliqués dans le métabolisme des lipides dans le foie et le tissu adipeux, respectivement (Kersten et al., 2000; Yoon et al., 2000). Les souris surexprimant fiaf ont une expression augmentée de PPARα (Mandard et al., 2006), qui induit l’expresstion de certains gènes impliqués dans la voie d’oxydation des acides gras (Puigserver et al., 1998; Mandard et al., 2004). Ces résultats pourraient permettre d’établir un lien entre le niveau d’expression et d’activité du fiaf à la réponse postprandiale des triglycérides. L’ensemble de ces études montrent que le fiaf pourrait être une cible pour le traitement des dyslipidémies et de l’obésité. La figure 27 récapitule le mécanisme aboutissant à l’altération de la réponse postprandiale en absence de la Pgp.
109
Discussion générale 2011
Entérocyte Plasma
LPL AG TG fiaf CM
AG
Tissu apideux
Figure 27 : Augmentation de la clairance plasmatique des triglycérides en absence de la Pgp L’activation indirecte de la LPL (ou d’autres lipases) via l’inhibition du fiaf augmente la clairance plasmatique des produits d’hydrolyse des triglycérides, les acides gras (AG) vers les tissus périphériques dont le tissu adipeux. CM : chylomicrons ; AG : acides gras ; LPL : lipoprotéine lipase ; fiaf : fasting-induced adipose factor
Le tableau 7 récapitule quelques résultats obtenus sur des souris de différents génotypes ayant des lipémies postprandiales altérées, ainsi que les explications possibles à l’origine du problème.
110
Discussion générale 2011
, 2006 ,
, 2005 ,
, 2009 ,
, 2000 ,
et al.
, 2007 ,
etal.
et al.
et al.
et al.
Mandard
Le May Le
Westerterp
Voshol
Petit références
Explications proposées Explications
augmentede l'oxydation ces derniers dans tissu le adipeux
L'augmentationdes triglycérides et des acides gras dans plasma le
adipeuseAGTL
Le fiaf, étant un inhibiteur de la LPL, stimule l'activité de la lipasede la l'activité stimule étant unfiaf, LPL, inhibiteurde Le la
lipoprotéinesnouvellement synthétisées
Activationen faveur dud'une récepteur captation LDLr hépatique des
deschylomicrons
Augmentationlipolysede vasculairela plasmatiqueetclairance de la
favorisecaptation la de ces derniers parles tissus périphériques
La LPL hydrolyse LPL des La triglycérides en acides gras dans etplasma le
sécrétionretardée des chylomicrons
L'absencedes phospholipides pourraitcause être la biliaires de cette
à uneà plasmatiqueclairance élevée des acides gras
Augmentationlipolysede plasmatiquela des triglycérides aboutissant
cd36
,
apoa4
,
mttp
,
fatp4
Résultats
Génotypes associés Génotypes
augmenté
apoc2/C3
l'expression des PGC-1α et PPARα dans et PPARα tissu le l'expressiondes adipeux) PGC-1α
Augmentationβ-oxydationde la des acides gras (augmentation de
Augmentationdans detissu lipasel'expressionde le AGTL la adipeux
Expression etExpression activité inchangées LPL de la
Sécrétioninchangée hépatique des VLDL
Augmentationdes acides gras plasmatiques
Augmentationpostprandiale triglycéridémie de la leschez souris fiaf+/+
Augmentationdes lipidesdans après foie gavage le le
Sécrétiondes chylomicronsplus delarge taille
Baisse du flux lymphatique de 20% et de l'apoB48 et apoB100 et apoB100 lymphatiqueet de deBaissel'apoB48 20% du flux
Excrétion fécale inchangée fécale Excrétion
Diminution du contenu Diminution duodénal en lipides
Baisse de la triglycéridémie postprandiale Baissetriglycéridémie de la leschez souris psck9-/-
Augmentationcaptationde la des acides gras tissu parle adipeux
Augmentationlipoprotéinedede la l'activité lipase (LPL)
Sécrétiondiminuée hépatique des VLDL
Sécrétionintestinale des triglycérides inchangée
Baisse de la triglycéridémie posprandiale Baissetriglycéridémie de les chez la souris apoc1-/-
desacides biliaires
Restaurationbaissepostprandialede la triglycéridémie de la en présence
Accumulationdes triglycérides dans l'entérocyte
chylomicronsdans circulationsanguine la
Baissesécrétionde la intestinale des triglycérides:sécrétion retardée des
Baisse de la triglycéridémie posprandiale Baissetriglycéridémie de les chez la souris mdr2-/-
Ratio Ratio
Augmentationde capacité absorptive de l'intestin
Expression intestinaleExpression augmentée des gènes
Sécrétioninchangée hépatique des VLDL Baisse de la triglycéridémie postprandiale Baissetriglycéridémie de la leschez souris soumises au HFD : Quelques exemples de dyslipémies postprandiales décrites dans la littérature décrites dans postprandiales Quelques de dyslipémies exemples :
7
(gavage en µl) en (gavage
Volume d'huile Volume
d'huile d'olive d'huile
350 µl µl 350
d'huile d'olive d'huile
200 µl 200
d'huile d'olive d'huile
200 µl 200
d'huile d'olive d'huile
200 µl 200
d'huile 500 µl 500
Tableau
régime
Génotype ou ou Génotype
fiaf+/+
pcsk9-/-
apoe-/-apoc1-/-
mdr2-/-
3 semaines 3
HFD (High fatdiet) (High HFD
Animal
fond génétique fond
FVB
C57BL6
C57BL6 FVB B6D2F1 111
Discussion générale 2011
Rôle de la Pgp dans l’absorption et la biodisponibilité des médicaments lipophiles : effets des formulations lipidiques
La biodisponilibté des médicaments lipophiles est fortement modulée par la présence des formulations à base d’émulsifiants (Bogman et al., 2003) et de lipides (Porter et al., 2007). Nous avons montré qu’une formulation à base de polysorbate 80, un émulsifiant non ionique soluble dans l’eau et utilisé utilisé comme agent de dispersion, augmente la biodisponibilité de l’ivermectine comparée à une formulation aqueuse. Nous avons également montré que le polysorbate n’a pas d’effet sur la biodisponibilité de l’ivermectine en absence de la Pgp. Ces résultats confirment que le polysorbate inhibe la Pgp, en accord avec (Cornaire et al., 2004). Nous avons aussi confirmé que la déficience en Pgp chez la souris augmente la biodisponibilité de l’ivermectine lorsqu’elle est formulée dans une solution aqueuse, en accord avec les résultats de (Kiki-Mvouaka et al., 2010). Le rôle des émulsifiants dans l’inactivation de la fonction des transporteurs MDR et l’amélioration de la biodisponibilité des médicaments lipophiles a été déjà établi (Bogman et al., 2003). Par ailleurs, la biodisponibilité de l’ivermectine augmente chez les animaux traités par des inhibiteurs de la Pgp tels que le vérapamil, le kétoconazole et le lopéramide (Hugnet et al., 2007; Lifschitz et al., 2010; Antonic et al., 2011). Etant donné que le polysorbate bloque la fonction de la Pgp (Bogman et al., 2003; Cornaire et al., 2004), l’augmentation plasmatique de l’ivermectine chez les souris ayant reçu la formulation à base de polysorbate est due à une inhibition de la Pgp par cet émulsifiant. Par ailleurs, plusieurs études ont montré le rôle des formulations à base de lipides dans l’amélioration de l’absorption des médicaments lipophiles, dont les lactones macrocycliques (Charman, 2000; Gershanik and Benita, 2000; Porter et al., 2007). Bassissi et ses collaborateurs ont montré que la co-administration de la moxidectine avec l’huile de tournesol augmente la biodisponibilité du médicament chez le lapin (Bassissi et al., 2004). Le rôle d’un repas riche en gras dans l’amélioration de la biodisponibilité de l’ivermectine a été bien établi chez l’homme (Guzzo et al., 2002). De plus, la fomulation liposomale augmente l’absorption de l’ivermectine (Bassissi et al., 2006). Dans notre cas, la formulation à base d’huile n’a pas modifié la biodisponibilité de l’ivermectine médiée par la Pgp, mais a retardé son absorption chez les souris témoins et la souris déficientes en Pgp par rapport à la formulation aqueuse.
112
Discussion générale 2011
Ceci montre la non-implication de la Pgp dans l’absorption intestinale retardée de l’ivermectine.
113
Perspectives et Conclusion
114
Perspectives et Conclusions 2011
Si nos résultats présentés ici amènent des éléments nouveaux dans les mécanismes d’absorption des lipides, certaines questions restent posées. Des expériences complémentaires sont nécessaires pour compléter les travaux présentés dans ce manuscrit.
Rôle des Scavengers récepteurs dans l’absorption du cholestérol et de la vitamine E
Les mécanismes d’absorption du cholestérol et du tocophérol à partir des micelles biliaires mixtes contenant de l’acide oléique font intervenir les transporteurs NPC1L1 et SR- B1. Par contre, ces transporteurs ne sont pas impliqués dans l’absorption de ces composés lipophiles en absence de l’acide oléique dans les micelles. De plus, les mécanismes d’absorption du NBD-cholestérol ne sont toujours pas. On peut penser que son absorption se fait par une simple diffusion passive du fait de sa moins grande lipophilie, comparée au cholestérol. De même, le(s) transporteur(s) responsable(s) de l’absorption du tocophérol dans le jéjunum médian et distal ne sont pas connus. Plusieurs études ont montré que le transporteur CD36, de la famille des Scavangers récepteurs, est impliqué dans l’absorption intestinale du cholestérol (Chapitre 3, section C.2.3). De plus, des polymorphismes de CD36 chez les humains peuvent moduler la concentration plasmatique du tocophérol, ce qui indique que CD36 pourrait donc être impliqué dans l’absorption intestinale de la vitamine E (Lecompte et al., 2011). Compte-tenu du rôle que peut exercer CD36 en tant que transporteur de lipides et de micronutriments lipidiques, il serait intéressant d’étudier son rôle dans : - l’absorption du cholestérol et du tocophérol dans les micelles simples, en l’absence de l’acide oléique, en utilisant des approches in vitro. - l’absorption du NBD-cholestérol dans les micelles simples et mixtes - l’absorption du tocophérol in vivo dans le jéjunum médian et distal
Mécanismes de l’obésité chez les souris déficientes en Pgp
En ce qui concerne l’étude sur le rôle de la Pgp dans l’homéostasie des lipides, des premiers résultats ont permis d’expliquer en partie l’origine de l’obésité et de la baisse de la triglycéridémie postprandiale chez les souris déficientes en Pgp. Cependant, les mécanismes
115
Perspectives et Conclusions 2011
aboutissant à ces perturbations métaboliques restent à élucider. Différentes approches seront intéressantes à mettre en place pour conforter le rôle de la Pgp dans le métabolisme général des lipides.
Pgp et régulation des enzymes lipolytiques
Le tissu adipeux exprime, en plus de la lipoprotéine lipase (LPL), d’autres lipases l’« adipose triglyceride lipase » (ATGL) qui coopère la lipase hormono-sensible (HSL) (Zimmermann et al., 2004). Nous proposons dans un premier temps de vérifier si l’absence de la Pgp a un impact sur l’activité de ces lipases dans le tissu adipeux. Ceci nous permettrait de mieux comprendre l’origine de l’obésité chez les souris déficientes en Pgp puisque ces enzymes contribuent à diminuer le stock de lipides dans le tissu adipeux.
Pgp et microflore intestinale
Compte-tenu de la baisse de l’expression du fiaf dans le tissu adipeux des souris déficientes en Pgp et pour mieux comprendre le développement de l’obésité chez ces souris, une recherche approfondie sur la flore intestinale serait interéssante. En effet, la flore intestinale a été identifiée comme un facteur contribuant au développement de l’obésité chez la souris et chez l’homme (Ley et al., 2006; Turnbaugh et al., 2006). Les souris obèses (ob/ob) montrent un changement dans l’écologie de la flore intestinale et une signature bactérienne a été décrite pour la flore intestinale chez les obèses (homme et souris) (Ley et al., 2005; Ley et al., 2006). De plus, les souris axéniques, n’ayant pas de flore intestinale, ne développent pas l’obésité et ont une masse adipeuse moins importante que les souris normales. Chez ces souris axéniques, une induction du fiaf est observée au niveau de l’intestin avec une activation des voies de la β-oxydation des acides gras dans les tissus périphériques : la voie AMPK dans le foie et le muscle squeletique et de la voie mitochondriale Pgc1α (Backhed et al., 2007). Ainsi, nous proposons d’étudier les profils métagénomiques des souris déficientes en Pgp et des souris témoins et de rechercher les mécanismes impliquant les voies AMPK et Pgc1α. Il sera également intéresant d’identifier les populations bactériennes associées au phénotype obèse chez la souris déficiente en Pgp. Ces éléments nous permettront d’établir un
116
Perspectives et Conclusions 2011
lien entre les modifications de la flore bactérienne et le développement de l’obésité en absence de la Pgp.
Polymorphisme de la Pgp et obésité
Il a été démontré que l’haplotype G2677A/T de la Pgp est significativement associé à l’obésité dans une population japonaise (Ichihara et al., 2008). De plus, d’autres haplotypes dans une population brésilienne (G2677T et C3435T) sur le gène ABCB1 sont associés à un taux élevé du cholestérol total et du LDL-cholestérol (Rodrigues et al., 2005). Il serait intéressant de vérifier si des polymorphismes de la Pgp sont associés à des troubles dans le métabolisme des lipides dans notre population occidentale. Ainsi, la Pgp pourrait s’ajouter aux marqueurs de l’obésité déjà connus.
Pgp et métabolisme du cholestérol
L’obésité observée chez les souris déficientes en Pgp pourrait avoir pour origine une dysrégulation du métabolisme du cholestérol. En effet, le turn over des acides biliaires est modifié (Foucaud-Vignault et al., 2011). De plus, nous avons montré que le cholestérol fécal tend à baisser chez la souris déficiente en Pgp (publication 3). Ceci suggère une perturbation du processus d’absorption du cholestérol par un mécanisme non encore élucidé. Nous proposons de réaliser une surcharge orale en cholestérol et suivre le processus de son absorption dans l’intestin et les autres tissus. Cette approche est en cours de réalisation par la technique du « TransIntestinal Cholesterol Excretion » (TICE) par l’équipe de Philippe Costet, en collaboration. Ces expériences nous permettront de vérifier le rôle de la Pgp dans l’excrétion intestinale du cholestérol.
Etude de l’absorption des médicaments lipophiles
Pour ce qui est des études se rapportant à l’absorption des médicaments lipophiles, il serait intéressant de rechercher le rôle des transporteurs de lipides, NPC1L1 et SR-B1, dans l’amélioration de la biodisponibilité de l’ivermectine, en utilisant les approches in vitro dans les cellules Caco-2 et in vivo chez les souris surexprimant SR-B1 ou traitées à l’ézétimibe (inhibiteur de NPC1L1). 117
Perspectives et Conclusions 2011
De plus, il serait aussi intéressant d’introduire ces médicaments dans des micelles simples ou mixtes et de comparer si la présence de l’acide oléique pourrait modifier leur absorption dans les cellules Caco-2. Les mécanismes par lesquels la formulation lipidique modifie l’absorption de l’ivermectine ne sont pas connus. La stimulation de la synthèse et la sécrétion des chylomicrons en présence des lipides pourrait être un facteur qui modulerait la biodisponibilité de l’ivermectine lors de son incorporation dans les chylomicrons. Nous proposons d’étudier le niveau d’expression des gènes impliqués dans la synthèse intestinale des chylomicrons (MTTP, apoB48) après un gavage avec une formulation lipidique d’ivermectine. Il serait également intéressant de rechercher la contribution des transporteurs des lipides (FATP4, CD36) dans le transport de l’ivermectine lorsqu’elle est formulée dans de l’huile. Comprendre les mécanismes fins d’absorption intestinale des médicaments permetterait d’améliorer leur biodisponibilité lorsqu’ils sont administrés par voie orale.
En conclusion, nous avons ici contribué à mieux comprendre certains mécanismes qui sont impliqués dans l’absorption intestinale des composés lipophiles, lipides alimentaires ou médicaments, tout en focalisant notre intérêt sur le rôle des certains transporteurs de lipides et de médicaments (NPC1L1, SR-B1 et Pgp). De plus, ces travaux permettront de définir des formulations à base de lipides (huile, acides gras) ou d’émulsifiants pour améliorer l’absorption et la biodisponibilité des lipides alimentaires (cholestérol, triglycérides), des vitamines liposolubles et des médicaments lipophiles.
118
Références
119
Références 2011
Abumrad NA, el-Maghrabi MR, Amri EZ, Lopez E and Grimaldi PA (1993). "Cloning of a rat adipocyte membrane protein implicated in binding or transport of long-chain fatty acids that is induced during preadipocyte differentiation. Homology with human CD36." J Biol Chem 268(24): 17665-8. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH and Krieger M (1996). "Identification of scavenger receptor SR-BI as a high density lipoprotein receptor." Science 271(5248): 518-20. Adams MR, Konaniah E, Cash JG and Hui DY (2011). "Use of NBD-Cholesterol to Identify a Minor but NPC1L1-Independent Cholesterol Absorption Pathway in Mouse Intestine." Am J Physiol Gastrointest Liver Physiol. Agellon LB, Toth MJ and Thomson AB (2002). "Intracellular lipid binding proteins of the small intestine." Mol Cell Biochem 239(1-2): 79-82. Alpers DH, Strauss AW, Ockner RK, Bass NM and Gordon JI (1984). "Cloning of a cDNA encoding rat intestinal fatty acid binding protein." Proc Natl Acad Sci U S A 81(2): 313-7. Altmann SW, Davis HR, Jr., Yao X, Laverty M, Compton DS, Zhu LJ, Crona JH, Caplen MA, Hoos LM, Tetzloff G, Priestley T, Burnett DA, Strader CD and Graziano MP (2002). "The identification of intestinal scavenger receptor class B, type I (SR-BI) by expression cloning and its role in cholesterol absorption." Biochim Biophys Acta 1580(1): 77-93. Altmann SW, Davis HR, Jr., Zhu LJ, Yao X, Hoos LM, Tetzloff G, Iyer SP, Maguire M, Golovko A, Zeng M, Wang L, Murgolo N and Graziano MP (2004). "Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption." Science 303(5661): 1201-4. Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan I and Gottesman MM (1999). "Biochemical, cellular, and pharmacological aspects of the multidrug transporter." Annu Rev Pharmacol Toxicol 39: 361-98. Ambudkar SV, Kimchi-Sarfaty C, Sauna ZE and Gottesman MM (2003). "P-glycoprotein: from genomics to mechanism." Oncogene 22(47): 7468-85. Amigo L, Zanlungo S, Miquel JF, Glick JM, Hyogo H, Cohen DE, Rigotti A and Nervi F (2003). "Hepatic overexpression of sterol carrier protein-2 inhibits VLDL production and reciprocally enhances biliary lipid secretion." J Lipid Res 44(2): 399-407.
120
Références 2011
Anderson RA, Joyce C, Davis M, Reagan JW, Clark M, Shelness GS and Rudel LL (1998). "Identification of a form of acyl-CoA:cholesterol acyltransferase specific to liver and intestine in nonhuman primates." J Biol Chem 273(41): 26747-54. Antonic J, Grabnar I, Milcinski L, Skibin A, Sussinger A, Pogacnik M and Cerkvenik-Flajs V (2011). "Influence of P-glycoprotein inhibition on secretion of ivermectin and doramectin by milk in lactating sheep." Vet Parasitol 179(1-3): 159-66. Anwar K, Iqbal J and Hussain MM (2007). "Mechanisms involved in vitamin E transport by primary enterocytes and in vivo absorption." J Lipid Res 48(9): 2028-38. Anwar K, Kayden HJ and Hussain MM (2006). "Transport of vitamin E by differentiated Caco-2 cells." J Lipid Res 47(6): 1261-73. Armand M (2007). "Lipases and lipolysis in the human digestive tract: where do we stand?" Curr Opin Clin Nutr Metab Care 10(2): 156-64. Artursson P, Karlsson J, Ocklind G and al. e (1996). "Studying transport processes in absorptive epithelia. "Epithelial cell culture: a practical approach"." Shaw, A.J., IRL Press at oxford university press, Oxford, England, 248 pp: 111-133. Aye IL, Singh AT and Keelan JA (2009). "Transport of lipids by ABC proteins: interactions and implications for cellular toxicity, viability and function." Chem Biol Interact 180(3): 327-39. Backhed F, Ding H, Wang T, Hooper LV, Koh GY, Nagy A, Semenkovich CF and Gordon JI (2004). "The gut microbiota as an environmental factor that regulates fat storage." Proc Natl Acad Sci U S A 101(44): 15718-23. Backhed F, Manchester JK, Semenkovich CF and Gordon JI (2007). "Mechanisms underlying the resistance to diet-induced obesity in germ-free mice." Proc Natl Acad Sci U S A 104(3): 979-84. Balakrishnan A and Polli JE (2006). "Apical sodium dependent bile acid transporter (ASBT, SLC10A2): a potential prodrug target." Mol Pharm 3(3): 223-30. Bansal MP, Cook RG, Danielson KG and Medina D (1989). "A 14-kilodalton selenium- binding protein in mouse liver is fatty acid-binding protein." J Biol Chem 264(23): 13780-4. Barlowe C, Orci L, Yeung T, Hosobuchi M, Hamamoto S, Salama N, Rexach MF, Ravazzola M, Amherdt M and Schekman R (1994). "COPII: a membrane coat formed by Sec proteins that drive vesicle budding from the endoplasmic reticulum." Cell 77(6): 895- 907. 121
Références 2011
Barter PJ, Brewer HB, Jr., Chapman MJ, Hennekens CH, Rader DJ and Tall AR (2003). "Cholesteryl ester transfer protein: a novel target for raising HDL and inhibiting atherosclerosis." Arterioscler Thromb Vasc Biol 23(2): 160-7. Bassissi F, Lespine A and Alvinerie M (2006). "Assessment of a liposomal formulation of ivermectin in rabbit after a single subcutaneous administration." Parasitol Res 98(3): 244-9. Bassissi MF, Alvinerie M and Lespine A (2004). "Macrocyclic lactones: distribution in plasma lipoproteins of several animal species including humans." Comp Biochem Physiol C Toxicol Pharmacol 138(4): 437-44. Bassissi MF, Alvinerie M, Martin PG, Perret B and Lespine A (2006). "Influence of dyslipidemia on moxidectin distribution in plasma lipoproteins and on its pharmacokinetics." Pharm Res 23(11): 2672-80. Bassissi MF, Lespine A and Alvinerie M (2004). "Enhancement of oral moxidectin bioavailability in rabbits by lipid co-administration." Parasitol Res 94(3): 188-92. Batt RA, Wilson CA and Topping DL (1978). "Potentiation of hyperphagia and relief of hypothermia in the genetically obese mouse (genotype, ob/ob) by alpha-methyl tyrosine." Int J Obes 2(3): 303-7. Baum CL, Reschly EJ, Gayen AK, Groh ME and Schadick K (1997). "Sterol carrier protein-2 overexpression enhances sterol cycling and inhibits cholesterol ester synthesis and high density lipoprotein cholesterol secretion." J Biol Chem 272(10): 6490-8. Bays H (2002). "Ezetimibe." Expert Opin Investig Drugs 11(11): 1587-604. Benet LZ and Cummins CL (2001). "The drug efflux-metabolism alliance: biochemical aspects." Adv Drug Deliv Rev 50 Suppl 1: S3-11. Benet LZ, Cummins CL and Wu CY (2004). "Unmasking the dynamic interplay between efflux transporters and metabolic enzymes." Int J Pharm 277(1-2): 3-9. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J, Kwiterovich P, Shan B, Barnes R and Hobbs HH (2000). "Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters." Science 290(5497): 1771-5. Besnard P, Niot I, Poirier H, Clement L and Bernard A (2002). "New insights into the fatty acid-binding protein (FABP) family in the small intestine." Mol Cell Biochem 239(1- 2): 139-47. Bi X, Corpina RA and Goldberg J (2002). "Structure of the Sec23/24-Sar1 pre-budding complex of the COPII vesicle coat." Nature 419(6904): 271-7. 122
Références 2011
Bietrix F, Yan D, Nauze M, Rolland C, Bertrand-Michel J, Comera C, Schaak S, Barbaras R, Groen AK, Perret B, Terce F and Collet X (2006). "Accelerated lipid absorption in mice overexpressing intestinal SR-BI." J Biol Chem 281(11): 7214-9. Binder HJ, Stange G, Murer H, Stieger B and Hauri HP (1986). "Sodium-proton exchange in colon brush-border membranes." Am J Physiol 251(3 Pt 1): G382-90. Blomhoff R, Green MH, Green JB, Berg T and Norum KR (1991). "Vitamin A metabolism: new perspectives on absorption, transport, and storage." Physiol Rev 71(4): 951-90. Bloom B, Chaikoff IL and Reinhardt (1951). "Intestinal lymph as pathway for transport of absorbed fatty acids of different chain lengths." Am J Physiol 166(2): 451-5. Bodo A, Bakos E, Szeri F, Varadi A and Sarkadi B (2003). "The role of multidrug transporters in drug availability, metabolism and toxicity." Toxicol Lett 140-141: 133- 43. Bodzioch M, Orso E, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ and Schmitz G (1999). "The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease." Nat Genet 22(4): 347-51. Bogman K, Erne-Brand F, Alsenz J and Drewe J (2003). "The role of surfactants in the reversal of active transport mediated by multidrug resistance proteins." J Pharm Sci 92(6): 1250-61. Bookstein C, DePaoli AM, Xie Y, Niu P, Musch MW, Rao MC and Chang EB (1994). "Na+/H+ exchangers, NHE-1 and NHE-3, of rat intestine. Expression and localization." J Clin Invest 93(1): 106-13. Bookstein C, Xie Y, Rabenau K, Musch MW, McSwine RL, Rao MC and Chang EB (1997). "Tissue distribution of Na+/H+ exchanger isoforms NHE2 and NHE4 in rat intestine and kidney." Am J Physiol 273(5 Pt 1): C1496-505. Borgnia MJ, Eytan GD and Assaraf YG (1996). "Competition of hydrophobic peptides, cytotoxic drugs, and chemosensitizers on a common P-glycoprotein pharmacophore as revealed by its ATPase activity." J Biol Chem 271(6): 3163-71. Borst P, Zelcer N and van Helvoort A (2000). "ABC transporters in lipid transport." Biochim Biophys Acta 1486(1): 128-44. Bradley A (1987). "Production and analysis of chimeric mice. In Teratocarcinomas and embryonic stem cells: A practical approach (ed. E.J. Robertson)." IRL Press, Oxford, UK: pp. 113–151. 123
Références 2011
Brayden DJ and Griffin J (2008). "Avermectin transepithelial transport in MDR1- and MRP- transfected canine kidney monolayers." Vet Res Commun 32(1): 93-106. Brodin B, Nielsen CU, Steffansen B and Frokjaer S (2002). "Transport of peptidomimetic drugs by the intestinal Di/tri-peptide transporter, PepT1." Pharmacol Toxicol 90(6): 285-96. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest J, Jr. and Hayden MR (1999). "Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency." Nat Genet 22(4): 336-45. Brown JM, Bell TA, 3rd, Alger HM, Sawyer JK, Smith TL, Kelley K, Shah R, Wilson MD, Davis MA, Lee RG, Graham MJ, Crooke RM and Rudel LL (2008). "Targeted depletion of hepatic ACAT2-driven cholesterol esterification reveals a non-biliary route for fecal neutral sterol loss." J Biol Chem 283(16): 10522-34. Brunham LR, Kruit JK, Iqbal J, Fievet C, Timmins JM, Pape TD, Coburn BA, Bissada N, Staels B, Groen AK, Hussain MM, Parks JS, Kuipers F and Hayden MR (2006). "Intestinal ABCA1 directly contributes to HDL biogenesis in vivo." J Clin Invest 116(4): 1052-62. Buhman KK, Accad M, Novak S, Choi RS, Wong JS, Hamilton RL, Turley S and Farese RV, Jr. (2000). "Resistance to diet-induced hypercholesterolemia and gallstone formation in ACAT2-deficient mice." Nat Med 6(12): 1341-7. Buhman KK, Smith SJ, Stone SJ, Repa JJ, Wong JS, Knapp FF, Jr., Burri BJ, Hamilton RL, Abumrad NA and Farese RV, Jr. (2002). "DGAT1 is not essential for intestinal triacylglycerol absorption or chylomicron synthesis." J Biol Chem 277(28): 25474-9. Cai L, Eckhardt ER, Shi W, Zhao Z, Nasser M, de Villiers WJ and van der Westhuyzen DR (2004). "Scavenger receptor class B type I reduces cholesterol absorption in cultured enterocyte CaCo-2 cells." J Lipid Res 45(2): 253-62. Cai SF, Kirby RJ, Howles PN and Hui DY (2001). "Differentiation-dependent expression and localization of the class B type I scavenger receptor in intestine." J Lipid Res 42(6): 902-9. Caliph SM, Charman WN and Porter CJ (2000). "Effect of short-, medium-, and long-chain fatty acid-based vehicles on the absolute oral bioavailability and intestinal lymphatic 124
Références 2011
transport of halofantrine and assessment of mass balance in lymph-cannulated and non-cannulated rats." J Pharm Sci 89(8): 1073-84. Calvo D, Gomez-Coronado D, Suarez Y, Lasuncion MA and Vega MA (1998). "Human CD36 is a high affinity receptor for the native lipoproteins HDL, LDL, and VLDL." J Lipid Res 39(4): 777-88. Cao G, Beyer TP, Yang XP, Schmidt RJ, Zhang Y, Bensch WR, Kauffman RF, Gao H, Ryan TP, Liang Y, Eacho PI and Jiang XC (2002). "Phospholipid transfer protein is regulated by liver X receptors in vivo." J Biol Chem 277(42): 39561-5. Cao J, Cheng L and Shi Y (2007). "Catalytic properties of MGAT3, a putative triacylgycerol synthase." J Lipid Res 48(3): 583-91. Cao J, Hawkins E, Brozinick J, Liu X, Zhang H, Burn P and Shi Y (2004). "A predominant role of acyl-CoA:monoacylglycerol acyltransferase-2 in dietary fat absorption implicated by tissue distribution, subcellular localization, and up-regulation by high fat diet." J Biol Chem 279(18): 18878-86. Cao J, Lockwood J, Burn P and Shi Y (2003). "Cloning and functional characterization of a mouse intestinal acyl-CoA:monoacylglycerol acyltransferase, MGAT2." J Biol Chem 278(16): 13860-6. Carstea ED, Morris JA, Coleman KG, Loftus SK, Zhang D, Cummings C, Gu J, Rosenfeld MA, Pavan WJ, Krizman DB, Nagle J, Polymeropoulos MH, Sturley SL, Ioannou YA, Higgins ME, Comly M, Cooney A, Brown A, Kaneski CR, Blanchette-Mackie EJ, Dwyer NK, Neufeld EB, Chang TY, Liscum L, Strauss JF, 3rd, Ohno K, Zeigler M, Carmi R, Sokol J, Markie D, O'Neill RR, van Diggelen OP, Elleder M, Patterson MC, Brady RO, Vanier MT, Pentchev PG and Tagle DA (1997). "Niemann-Pick C1 disease gene: homology to mediators of cholesterol homeostasis." Science 277(5323): 228-31. Cases S, Novak S, Zheng YW, Myers HM, Lear SR, Sande E, Welch CB, Lusis AJ, Spencer TA, Krause BR, Erickson SK and Farese RV, Jr. (1998). "ACAT-2, a second mammalian acyl-CoA:cholesterol acyltransferase. Its cloning, expression, and characterization." J Biol Chem 273(41): 26755-64. Cases S, Smith SJ, Zheng YW, Myers HM, Lear SR, Sande E, Novak S, Collins C, Welch CB, Lusis AJ, Erickson SK and Farese RV, Jr. (1998). "Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis." Proc Natl Acad Sci U S A 95(22): 13018-23. 125
Références 2011
Chaikoff IL, Bloom B, Stevens BP, Reinhardt WO and Dauben WG (1951). "Pentadecanoic acid-5-C14; its absorption and lymphatic transport." J Biol Chem 190(2): 431-5. Chan DC, Watts GF, Barrett PH, O'Neill FH and Thompson GR (2003). "Plasma markers of cholesterol homeostasis and apolipoprotein B-100 kinetics in the metabolic syndrome." Obes Res 11(4): 591-6. Chanderbhan R, Noland BJ, Scallen TJ and Vahouny GV (1982). "Sterol carrier protein2. Delivery of cholesterol from adrenal lipid droplets to mitochondria for pregnenolone synthesis." J Biol Chem 257(15): 8928-34. Chang CC, Huh HY, Cadigan KM and Chang TY (1993). "Molecular cloning and functional expression of human acyl-coenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells." J Biol Chem 268(28): 20747-55. Chapman JV, Gouaze-Andersson V, Karimi R, Messner MC and Cabot MC (2011). "P- glycoprotein antagonists confer synergistic sensitivity to short-chain ceramide in human multidrug-resistant cancer cells." Exp Cell Res. Chardon L, Sassolas A, Dingeon B, Michel-Calemard L, Bovier-Lapierre M, Moulin P and Lachaux A (2009). "Identification of two novel mutations and long-term follow-up in abetalipoproteinemia: a report of four cases." Eur J Pediatr 168(8): 983-9. Charman WN (2000). "Lipids, lipophilic drugs, and oral drug delivery-some emerging concepts." J Pharm Sci 89(8): 967-78. Chateau D, Pauquai T, Delers F, Rousset M, Chambaz J and Demignot S (2005). "Lipid micelles stimulate the secretion of triglyceride-enriched apolipoprotein B48- containing lipoproteins by Caco-2 cells." J Cell Physiol 202(3): 767-76. Cheng D, Iqbal J, Devenny J, Chu CH, Chen L, Dong J, Seethala R, Keim WJ, Azzara AV, Lawrence RM, Pelleymounter MA and Hussain MM (2008). "Acylation of acylglycerols by acyl coenzyme A:diacylglycerol acyltransferase 1 (DGAT1). Functional importance of DGAT1 in the intestinal fat absorption." J Biol Chem 283(44): 29802-11. Chiang JY, Kimmel R and Stroup D (2001). "Regulation of cholesterol 7alpha-hydroxylase gene (CYP7A1) transcription by the liver orphan receptor (LXRalpha)." Gene 262(1- 2): 257-65. Cladaras C, Hadzopoulou-Cladaras M, Nolte RT, Atkinson D and Zannis VI (1986). "The complete sequence and structural analysis of human apolipoprotein B-100: relationship between apoB-100 and apoB-48 forms." Embo J 5(13): 3495-507. 126
Références 2011
Clarke AR and Holbrook JJ (1985). "The mechanism of activation of lipoprotein lipase by apolipoprotein C-II. The formation of a protein-protein complex in free solution and at a triacylglycerol/water interface." Biochim Biophys Acta 827(3): 358-68. Clearfield MB (2003). "A novel therapeutic approach to dyslipidemia." J Am Osteopath Assoc 103(1 Suppl 1): S16-20. Coburn CT, Knapp FF, Jr., Febbraio M, Beets AL, Silverstein RL and Abumrad NA (2000). "Defective uptake and utilization of long chain fatty acids in muscle and adipose tissues of CD36 knockout mice." J Biol Chem 275(42): 32523-9. Collins S, Martin TL, Surwit RS and Robidoux J (2004). "Genetic vulnerability to diet- induced obesity in the C57BL/6J mouse: physiological and molecular characteristics." Physiol Behav 81(2): 243-8. Conrad PA, Smart EJ, Ying YS, Anderson RG and Bloom GS (1995). "Caveolin cycles between plasma membrane caveolae and the Golgi complex by microtubule-dependent and microtubule-independent steps." J Cell Biol 131(6 Pt 1): 1421-33. Cornaire G, Woodley J, Hermann P, Cloarec A, Arellano C and Houin G (2004). "Impact of excipients on the absorption of P-glycoprotein substrates in vitro and in vivo." Int J Pharm 278(1): 119-31. Cox JE and Powley TL (1977). "Development of obesity in diabetic mice pair-fed with lean siblings." J Comp Physiol Psychol 91(2): 347-58. Cummins CL, Jacobsen W and Benet LZ (2002). "Unmasking the dynamic interplay between intestinal P-glycoprotein and CYP3A4." J Pharmacol Exp Ther 300(3): 1036-45. Dallas S, Miller DS and Bendayan R (2006). "Multidrug resistance-associated proteins: expression and function in the central nervous system." Pharmacol Rev 58(2): 140-61. Danielson PB (2002). "The cytochrome P450 superfamily: biochemistry, evolution and drug metabolism in humans." Curr Drug Metab 3(6): 561-97. Dano K (1973). "Active outward transport of daunomycin in resistant Ehrlich ascites tumor cells." Biochim Biophys Acta 323(3): 466-83. Davidson NO and Shelness GS (2000). "APOLIPOPROTEIN B: mRNA editing, lipoprotein assembly, and presecretory degradation." Annu Rev Nutr 20: 169-93. Davies JP, Levy B and Ioannou YA (2000). "Evidence for a Niemann-pick C (NPC) gene family: identification and characterization of NPC1L1." Genomics 65(2): 137-45.
127
Références 2011
Davies JP, Scott C, Oishi K, Liapis A and Ioannou YA (2005). "Inactivation of NPC1L1 causes multiple lipid transport defects and protects against diet-induced hypercholesterolemia." J Biol Chem 280(13): 12710-20. Davis HR, Jr. and Altmann SW (2009). "Niemann-Pick C1 Like 1 (NPC1L1) an intestinal sterol transporter." Biochim Biophys Acta 1791(7): 679-83. Davis HR, Jr., Zhu LJ, Hoos LM, Tetzloff G, Maguire M, Liu J, Yao X, Iyer SP, Lam MH, Lund EG, Detmers PA, Graziano MP and Altmann SW (2004). "Niemann-Pick C1 Like 1 (NPC1L1) is the intestinal phytosterol and cholesterol transporter and a key modulator of whole-body cholesterol homeostasis." J Biol Chem 279(32): 33586-92. de Vogel-van den Bosch HM, de Wit NJ, Hooiveld GJ, Vermeulen H, van der Veen JN, Houten SM, Kuipers F, Muller M and van der Meer R (2008). "A cholesterol-free, high-fat diet suppresses gene expression of cholesterol transporters in murine small intestine." Am J Physiol Gastrointest Liver Physiol 294(5): G1171-80. Dean M, Hamon Y and Chimini G (2001). "The human ATP-binding cassette (ABC) transporter superfamily." J Lipid Res 42(7): 1007-17. Debry P, Nash EA, Neklason DW and Metherall JE (1997). "Role of multidrug resistance P- glycoproteins in cholesterol esterification." J Biol Chem 272(2): 1026-31. Devault A and Gros P (1990). "Two members of the mouse mdr gene family confer multidrug resistance with overlapping but distinct drug specificities." Mol Cell Biol 10(4): 1652- 63. Didier A and Loor F (1996). "The abamectin derivative ivermectin is a potent P-glycoprotein inhibitor." Anticancer Drugs 7(7): 745-51. Dobrzyn P, Dobrzyn A, Miyazaki M, Cohen P, Asilmaz E, Hardie DG, Friedman JM and Ntambi JM (2004). "Stearoyl-CoA desaturase 1 deficiency increases fatty acid oxidation by activating AMP-activated protein kinase in liver." Proc Natl Acad Sci U S A 101(17): 6409-14. Drover VA, Ajmal M, Nassir F, Davidson NO, Nauli AM, Sahoo D, Tso P and Abumrad NA (2005). "CD36 deficiency impairs intestinal lipid secretion and clearance of chylomicrons from the blood." J Clin Invest 115(5): 1290-7. Drover VA, Nguyen DV, Bastie CC, Darlington YF, Abumrad NA, Pessin JE, London E, Sahoo D and Phillips MC (2008). "CD36 mediates both cellular uptake of very long chain fatty acids and their intestinal absorption in mice." J Biol Chem 283(19): 13108- 15. 128
Références 2011
Ducheix S, Lobaccaro JM, Martin PG and Guillou H (2011). "Liver X Receptor: an oxysterol sensor and a major player in the control of lipogenesis." Chem Phys Lipids. Dupuy J, Escudero E, Eeckhoutte C, Sutra JF, Galtier P and Alvinerie M (2001). "In vitro metabolism of 14C-moxidectin by hepatic microsomes from various species." Vet Res Commun 25(5): 345-54. Dupuy J, Lespine A, Sutra JF and Alvinerie M (2006). "The interaction between moxidectin and MDR transporters in primary cultures of rat hepatocytes." J Vet Pharmacol Ther 29(2): 107-11. Ebara T, Ramakrishnan R, Steiner G and Shachter NS (1997). "Chylomicronemia due to apolipoprotein CIII overexpression in apolipoprotein E-null mice. Apolipoprotein CIII-induced hypertriglyceridemia is not mediated by effects on apolipoprotein E." J Clin Invest 99(11): 2672-81. Eckford PD and Sharom FJ (2005). "The reconstituted P-glycoprotein multidrug transporter is a flippase for glucosylceramide and other simple glycosphingolipids." Biochem J 389(Pt 2): 517-26. Eleftheriadou I, Grigoropoulou P, Katsilambros N and Tentolouris N (2008). "The effects of medications used for the management of diabetes and obesity on postprandial lipid metabolism." Curr Diabetes Rev 4(4): 340-56. Eneroth A, Astrom E, Hoogstraate J, Schrenk D, Conrad S, Kauffmann HM and Gjellan K (2001). "Evaluation of a vincristine resistant Caco-2 cell line for use in a calcein AM extrusion screening assay for P-glycoprotein interaction." Eur J Pharm Sci 12(3): 205- 14. Farese RV, Jr., Cases S and Smith SJ (2000). "Triglyceride synthesis: insights from the cloning of diacylglycerol acyltransferase." Curr Opin Lipidol 11(3): 229-34. Field FJ, Born E and Mathur SN (1997). "Effect of micellar beta-sitosterol on cholesterol metabolism in CaCo-2 cells." J Lipid Res 38(2): 348-60. Field FJ, Born E, Murthy S and Mathur SN (1998). "Caveolin is present in intestinal cells: role in cholesterol trafficking?" J Lipid Res 39(10): 1938-50. Field FJ and Mathur SN (1983). "beta-sitosterol: esterification by intestinal acylcoenzyme A: cholesterol acyltransferase (ACAT) and its effect on cholesterol esterification." J Lipid Res 24(4): 409-17.
129
Références 2011
Field FJ, Watt K and Mathur SN (2007). "Ezetimibe interferes with cholesterol trafficking from the plasma membrane to the endoplasmic reticulum in CaCo-2 cells." J Lipid Res 48(8): 1735-45. Fleisher D, Li C, Zhou Y, Pao LH and Karim A (1999). "Drug, meal and formulation interactions influencing drug absorption after oral administration. Clinical implications." Clin Pharmacokinet 36(3): 233-54. Fogh JaTG (1975). "New human tumor cell lines. In Fogh editor, Human Tumor Cells In Vitro." Plenum Press, New York: 115 - 141. Fojo A, Lebo R, Shimizu N, Chin JE, Roninson IB, Merlino GT, Gottesman MM and Pastan I (1986). "Localization of multidrug resistance-associated DNA sequences to human chromosome 7." Somat Cell Mol Genet 12(4): 415-20. Foucaud-Vignault M, Soayfane Z, Menez C, Bertrand-Michel J, Martin P, Guillou H, Collet X and Lespine A (2011). "P-glycoprotein dysfunction contributes to hepatic steatosis and obesity in mice." PLoS One. Frolov A, Cho TH, Billheimer JT and Schroeder F (1996). "Sterol carrier protein-2, a new fatty acyl coenzyme A-binding protein." J Biol Chem 271(50): 31878-84. Fujimoto K, Cardelli JA and Tso P (1992). "Increased apolipoprotein A-IV in rat mesenteric lymph after lipid meal acts as a physiological signal for satiation." Am J Physiol 262(6 Pt 1): G1002-6. Garcia-Calvo M, Lisnock J, Bull HG, Hawes BE, Burnett DA, Braun MP, Crona JH, Davis HR, Jr., Dean DC, Detmers PA, Graziano MP, Hughes M, Macintyre DE, Ogawa A, O'Neill K A, Iyer SP, Shevell DE, Smith MM, Tang YS, Makarewicz AM, Ujjainwalla F, Altmann SW, Chapman KT and Thornberry NA (2005). "The target of ezetimibe is Niemann-Pick C1-Like 1 (NPC1L1)." Proc Natl Acad Sci U S A 102(23): 8132-7. Garcia-Martinez C, Marotta M, Moore-Carrasco R, Guitart M, Camps M, Busquets S, Montell E and Gomez-Foix AM (2005). "Impact on fatty acid metabolism and differential localization of FATP1 and FAT/CD36 proteins delivered in cultured human muscle cells." Am J Physiol Cell Physiol 288(6): C1264-72. Garrigues A, Escargueil AE and Orlowski S (2002). "The multidrug transporter, P- glycoprotein, actively mediates cholesterol redistribution in the cell membrane." Proc Natl Acad Sci U S A 99(16): 10347-52.
130
Références 2011
Gershanik T and Benita S (2000). "Self-dispersing lipid formulations for improving oral absorption of lipophilic drugs." Eur J Pharm Biopharm 50(1): 179-88. Gershkovich P and Hoffman A (2005). "Uptake of lipophilic drugs by plasma derived isolated chylomicrons: linear correlation with intestinal lymphatic bioavailability." Eur J Pharm Sci 26(5): 394-404. Gertow K, Bellanda M, Eriksson P, Boquist S, Hamsten A, Sunnerhagen M and Fisher RM (2004). "Genetic and structural evaluation of fatty acid transport protein-4 in relation to markers of the insulin resistance syndrome." J Clin Endocrinol Metab 89(1): 392-9. Gimeno RE, Hirsch DJ, Punreddy S, Sun Y, Ortegon AM, Wu H, Daniels T, Stricker- Krongrad A, Lodish HF and Stahl A (2003). "Targeted deletion of fatty acid transport protein-4 results in early embryonic lethality." J Biol Chem 278(49): 49512-6. Goldstein LJ, Galski H, Fojo A, Willingham M, Lai SL, Gazdar A, Pirker R, Green A, Crist W, Brodeur GM and et al. (1989). "Expression of a multidrug resistance gene in human cancers." J Natl Cancer Inst 81(2): 116-24. Gordon JI, Alpers DH, Ockner RK and Strauss AW (1983). "The nucleotide sequence of rat liver fatty acid binding protein mRNA." J Biol Chem 258(5): 3356-63. Goti D, Hrzenjak A, Levak-Frank S, Frank S, van der Westhuyzen DR, Malle E and Sattler W (2001). "Scavenger receptor class B, type I is expressed in porcine brain capillary endothelial cells and contributes to selective uptake of HDL-associated vitamin E." J Neurochem 76(2): 498-508. Gottesman MM and Pastan I (1993). "Biochemistry of multidrug resistance mediated by the multidrug transporter." Annu Rev Biochem 62: 385-427. Graf GA, Li WP, Gerard RD, Gelissen I, White A, Cohen JC and Hobbs HH (2002). "Coexpression of ATP-binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface." J Clin Invest 110(5): 659-69. Greene DJ, Skeggs JW and Morton RE (2001). "Elevated triglyceride content diminishes the capacity of high density lipoprotein to deliver cholesteryl esters via the scavenger receptor class B type I (SR-BI)." J Biol Chem 276(7): 4804-11. Greenwalt DE, Scheck SH and Rhinehart-Jones T (1995). "Heart CD36 expression is increased in murine models of diabetes and in mice fed a high fat diet." J Clin Invest 96(3): 1382-8.
131
Références 2011
Griffin J, Fletcher N, Clemence R, Blanchflower S and Brayden DJ (2005). "Selamectin is a potent substrate and inhibitor of human and canine P-glycoprotein." J Vet Pharmacol Ther 28(3): 257-65. Grober J, Laurell H, Blaise R, Fabry B, Schaak S, Holm C and Langin D (1997). "Characterization of the promoter of human adipocyte hormone-sensitive lipase." Biochem J 328 ( Pt 2): 453-61. Grober J, Lucas S, Sorhede-Winzell M, Zaghini I, Mairal A, Contreras JA, Besnard P, Holm C and Langin D (2003). "Hormone-sensitive lipase is a cholesterol esterase of the intestinal mucosa." J Biol Chem 278(8): 6510-5. Grundy SM and Metzger AL (1972). "A physiological method for estimation of hepatic secretion of biliary lipids in man." Gastroenterology 62(6): 1200-17. Gu X, Trigatti B, Xu S, Acton S, Babitt J and Krieger M (1998). "The efficient cellular uptake of high density lipoprotein lipids via scavenger receptor class B type I requires not only receptor-mediated surface binding but also receptor-specific lipid transfer mediated by its extracellular domain." J Biol Chem 273(41): 26338-48. Guzzo CA, Furtek CI, Porras AG, Chen C, Tipping R, Clineschmidt CM, Sciberras DG, Hsieh JY and Lasseter KC (2002). "Safety, tolerability, and pharmacokinetics of escalating high doses of ivermectin in healthy adult subjects." J Clin Pharmacol 42(10): 1122-33. Haikal Z, Play B, Landrier JF, Giraud A, Ghiringhelli O, Lairon D and Jourdheuil-Rahmani D (2008). "NPC1L1 and SR-BI are involved in intestinal cholesterol absorption from small-size lipid donors." Lipids 43(5): 401-8. Hall AM, Wiczer BM, Herrmann T, Stremmel W and Bernlohr DA (2005). "Enzymatic properties of purified murine fatty acid transport protein 4 and analysis of acyl-CoA synthetase activities in tissues from FATP4 null mice." J Biol Chem 280(12): 11948- 54. Haluzik M, Colombo C, Gavrilova O, Chua S, Wolf N, Chen M, Stannard B, Dietz KR, Le Roith D and Reitman ML (2004). "Genetic background (C57BL/6J versus FVB/N) strongly influences the severity of diabetes and insulin resistance in ob/ob mice." Endocrinology 145(7): 3258-64. Hanhoff T, Lucke C and Spener F (2002). "Insights into binding of fatty acids by fatty acid binding proteins." Mol Cell Biochem 239(1-2): 45-54.
132
Références 2011
Hauser H, Dyer JH, Nandy A, Vega MA, Werder M, Bieliauskaite E, Weber FE, Compassi S, Gemperli A, Boffelli D, Wehrli E, Schulthess G and Phillips MC (1998). "Identification of a receptor mediating absorption of dietary cholesterol in the intestine." Biochemistry 37(51): 17843-50. Hayashi AA, Webb J, Choi J, Baker C, Lino M, Trigatti B, Trajcevski KE, Hawke TJ and Adeli K (2011). "Intestinal SR-BI is upregulated in insulin-resistant states and is associated with overproduction of intestinal apoB48-containing lipoproteins." Am J Physiol Gastrointest Liver Physiol 301(2): G326-37. Hayashi H, Fujimoto K, Cardelli JA, Nutting DF, Bergstedt S and Tso P (1990). "Fat feeding increases size, but not number, of chylomicrons produced by small intestine." Am J Physiol 259(5 Pt 1): G709-19. Hayes KC (1974). "Retinal degeneration in monkeys induced by deficiencies of vitamin E or A." Invest Ophthalmol 13(7): 499-510. Hayhurst GP, Lee YH, Lambert G, Ward JM and Gonzalez FJ (2001). "Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis." Mol Cell Biol 21(4): 1393-403. Helgerud P, Petersen LB and Norum KR (1982). "Acyl CoA:retinol acyltransferase in rat small intestine: its activity and some properties of the enzymic reaction." J Lipid Res 23(4): 609-18. Hernell O, Staggers JE and Carey MC (1990). "Physical-chemical behavior of dietary and biliary lipids during intestinal digestion and absorption. 2. Phase analysis and aggregation states of luminal lipids during duodenal fat digestion in healthy adult human beings." Biochemistry 29(8): 2041-56. Herrmann T, Buchkremer F, Gosch I, Hall AM, Bernlohr DA and Stremmel W (2001). "Mouse fatty acid transport protein 4 (FATP4): characterization of the gene and functional assessment as a very long chain acyl-CoA synthetase." Gene 270(1-2): 31- 40. Herzig S, Hedrick S, Morantte I, Koo SH, Galimi F and Montminy M (2003). "CREB controls hepatic lipid metabolism through nuclear hormone receptor PPAR-gamma." Nature 426(6963): 190-3. Higgins CF and Gottesman MM (1992). "Is the multidrug transporter a flippase?" Trends Biochem Sci 17(1): 18-21.
133
Références 2011
Hoeg JM, Sviridov DD, Tennyson GE, Demosky SJ, Jr., Meng MS, Bojanovski D, Safonova IG, Repin VS, Kuberger MB, Smirnov VN and et al. (1990). "Both apolipoproteins B- 48 and B-100 are synthesized and secreted by the human intestine." J Lipid Res 31(10): 1761-9. Hoffman NE (1970). "The relationship between uptake in vitro of oleic acid and micellar solubilization." Biochim Biophys Acta 196(2): 193-203. Hollander D (1981). "Intestinal absorption of vitamins A, E, D, and K." J Lab Clin Med 97(4): 449-62. Hollander D, Muralidhara KS and Zimmerman A (1978). "Vitamin D-3 intestinal absorption in vivo: influence of fatty acids, bile salts, and perfusate pH on absorption." Gut 19(4): 267-72. Holm C, Osterlund T, Laurell H and Contreras JA (2000). "Molecular mechanisms regulating hormone-sensitive lipase and lipolysis." Annu Rev Nutr 20: 365-93. Honig SM, Fu S, Mao X, Yopp A, Gunn MD, Randolph GJ and Bromberg JS (2003). "FTY720 stimulates multidrug transporter- and cysteinyl leukotriene-dependent T cell chemotaxis to lymph nodes." J Clin Invest 111(5): 627-37. Hu CC, Qing K and Chen Y (2004). "Diet-induced changes in stearoyl-CoA desaturase 1 expression in obesity-prone and -resistant mice." Obes Res 12(8): 1264-70. Hugnet C, Lespine A and Alvinerie M (2007). "Multiple oral dosing of ketoconazole increases dog exposure to ivermectin." J Pharm Pharm Sci 10(3): 311-8. Hui DY and Howles PN (2005). "Molecular mechanisms of cholesterol absorption and transport in the intestine." Semin Cell Dev Biol 16(2): 183-92. Hussain MM (2000). "A proposed model for the assembly of chylomicrons." Atherosclerosis 148(1): 1-15. Hussain MM and Bakillah A (2008). "New approaches to target microsomal triglyceride transfer protein." Curr Opin Lipidol 19(6): 572-8. Hussain MM, Fatma S, Pan X and Iqbal J (2005). "Intestinal lipoprotein assembly." Curr Opin Lipidol 16(3): 281-5. Hussain MM, Iqbal J, Anwar K, Rava P and Dai K (2003). "Microsomal triglyceride transfer protein: a multifunctional protein." Front Biosci 8: s500-6. Hussain MM, Kedees MH, Singh K, Athar H and Jamali NZ (2001). "Signposts in the assembly of chylomicrons." Front Biosci 6: D320-31.
134
Références 2011
Hussain MM, Strickland DK and Bakillah A (1999). "The mammalian low-density lipoprotein receptor family." Annu Rev Nutr 19: 141-72. Ibrahimi A, Bonen A, Blinn WD, Hajri T, Li X, Zhong K, Cameron R and Abumrad NA (1999). "Muscle-specific overexpression of FAT/CD36 enhances fatty acid oxidation by contracting muscle, reduces plasma triglycerides and fatty acids, and increases plasma glucose and insulin." J Biol Chem 274(38): 26761-6. Ichihara S, Yamada Y, Kato K, Hibino T, Yokoi K, Matsuo H, Kojima T, Watanabe S, Metoki N, Yoshida H, Satoh K, Aoyagi Y, Yasunaga A, Park H, Tanaka M and Nozawa Y (2008). "Association of a polymorphism of ABCB1 with obesity in Japanese individuals." Genomics 91(6): 512-6. Ichihashi T, Kinoshita H, Takagishi Y and Yamada H (1992). "Effect of oily vehicles on absorption of mepitiostane by the lymphatic system in rats." J Pharm Pharmacol 44(7): 560-4. Ikuma M, Kashgarian M, Binder HJ and Rajendran VM (1999). "Differential regulation of NHE isoforms by sodium depletion in proximal and distal segments of rat colon." Am J Physiol 276(2 Pt 1): G539-49. Illingworth DR (1993). "Lipoprotein metabolism." Am J Kidney Dis 22(1): 90-7. Inoue Y, Yu AM, Inoue J and Gonzalez FJ (2004). "Hepatocyte nuclear factor 4alpha is a central regulator of bile acid conjugation." J Biol Chem 279(4): 2480-9. Inoue Y, Yu AM, Yim SH, Ma X, Krausz KW, Inoue J, Xiang CC, Brownstein MJ, Eggertsen G, Bjorkhem I and Gonzalez FJ (2006). "Regulation of bile acid biosynthesis by hepatocyte nuclear factor 4alpha." J Lipid Res 47(1): 215-27. Iqbal J, Anwar K and Hussain MM (2003). "Multiple, independently regulated pathways of cholesterol transport across the intestinal epithelial cells." J Biol Chem 278(34): 31610-20. Iqbal J and Hussain MM (2005). "Evidence for multiple complementary pathways for efficient cholesterol absorption in mice." J Lipid Res 46(7): 1491-501. Iqbal J and Hussain MM (2009). "Intestinal lipid absorption." Am J Physiol Endocrinol Metab 296(6): E1183-94. Iqbal J, Rudel LL and Hussain MM (2008). "Microsomal triglyceride transfer protein enhances cellular cholesteryl esterification by relieving product inhibition." J Biol Chem 283(29): 19967-80.
135
Références 2011
Iyer SP, Yao X, Crona JH, Hoos LM, Tetzloff G, Davis HR, Jr., Graziano MP and Altmann SW (2005). "Characterization of the putative native and recombinant rat sterol transporter Niemann-Pick C1 Like 1 (NPC1L1) protein." Biochim Biophys Acta 1722(3): 282-92. Jeannesson E, Siest G, Bastien B, Albertini L, Aslanidis C, Schmitz G and Visvikis-Siest S (2009). "Association of ABCB1 gene polymorphisms with plasma lipid and apolipoprotein concentrations in the STANISLAS cohort." Clin Chim Acta 403(1-2): 198-202. Ji Y, Jian B, Wang N, Sun Y, Moya ML, Phillips MC, Rothblat GH, Swaney JB and Tall AR (1997). "Scavenger receptor BI promotes high density lipoprotein-mediated cellular cholesterol efflux." J Biol Chem 272(34): 20982-5. Johnstone RW, Ruefli AA and Smyth MJ (2000). "Multiple physiological functions for multidrug transporter P-glycoprotein?" Trends Biochem Sci 25(1): 1-6. Jong MC, Rensen PC, Dahlmans VE, van der Boom H, van Berkel TJ and Havekes LM (2001). "Apolipoprotein C-III deficiency accelerates triglyceride hydrolysis by lipoprotein lipase in wild-type and apoE knockout mice." J Lipid Res 42(10): 1578-85. Kajinami K, Brousseau ME, Ordovas JM and Schaefer EJ (2004). "Polymorphisms in the multidrug resistance-1 (MDR1) gene influence the response to atorvastatin treatment in a gender-specific manner." Am J Cardiol 93(8): 1046-50. Kamei J, Hirano S, Miyata S, Saitoh A and Onodera K (2005). "Effects of first- and second- generation histamine-H1-receptor antagonists on the pentobarbital-induced loss of the righting reflex in streptozotocin-induced diabetic mice." J Pharmacol Sci 97(2): 266- 72. Kaminsky LS and Zhang QY (2003). "The small intestine as a xenobiotic-metabolizing organ." Drug Metab Dispos 31(12): 1520-5. Kane JP (1983). "Apolipoprotein B: structural and metabolic heterogeneity." Annu Rev Physiol 45: 637-50. Karwatsky J, Lincoln MC and Georges E (2003). "A mechanism for P-glycoprotein-mediated apoptosis as revealed by verapamil hypersensitivity." Biochemistry 42(42): 12163-73. Kersten S, Mandard S, Tan NS, Escher P, Metzger D, Chambon P, Gonzalez FJ, Desvergne B and Wahli W (2000). "Characterization of the fasting-induced adipose factor FIAF, a novel peroxisome proliferator-activated receptor target gene." J Biol Chem 275(37): 28488-93. 136
Références 2011
Khoo SM, Edwards GA, Porter CJ and Charman WN (2001). "A conscious dog model for assessing the absorption, enterocyte-based metabolism, and intestinal lymphatic transport of halofantrine." J Pharm Sci 90(10): 1599-607. Khoo SM, Shackleford DM, Porter CJ, Edwards GA and Charman WN (2003). "Intestinal lymphatic transport of halofantrine occurs after oral administration of a unit-dose lipid-based formulation to fasted dogs." Pharm Res 20(9): 1460-5. Kiki-Mvouaka S, Menez C, Borin C, Lyazrhi F, Foucaud-Vignault M, Dupuy J, Collet X, Alvinerie M and Lespine A (2010). "Role of P-glycoprotein in the disposition of macrocyclic lactones: A comparison between ivermectin, eprinomectin, and moxidectin in mice." Drug Metab Dispos 38(4): 573-80. Kim MK and Shim CK (2006). "The transport of organic cations in the small intestine: current knowledge and emerging concepts." Arch Pharm Res 29(7): 605-16. Kim RB (2003). "Organic anion-transporting polypeptide (OATP) transporter family and drug disposition." Eur J Clin Invest 33 Suppl 2: 1-5. Kiyasu JY, Bloom B and Chaikoff IL (1952). "The portal transport of absorbed fatty acids." J Biol Chem 199(1): 415-9. Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta AK, Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda N, Salen G and Patel SB (2004). "A mouse model of sitosterolemia: absence of Abcg8/sterolin-2 results in failure to secrete biliary cholesterol." BMC Med 2: 5. Knight BL (2004). "ATP-binding cassette transporter A1: regulation of cholesterol efflux." Biochem Soc Trans 32(Pt 1): 124-7. Kohle C and Bock KW (2009). "Coordinate regulation of human drug-metabolizing enzymes, and conjugate transporters by the Ah receptor, pregnane X receptor and constitutive androstane receptor." Biochem Pharmacol 77(4): 689-99. Kruh GD and Belinsky MG (2003). "The MRP family of drug efflux pumps." Oncogene 22(47): 7537-52. Kumar NS and Mansbach CM (1997). "Determinants of triacylglycerol transport from the endoplasmic reticulum to the Golgi in intestine." Am J Physiol 273(1 Pt 1): G18-30. Kumar NS and Mansbach CM, 2nd (1999). "Prechylomicron transport vesicle: isolation and partial characterization." Am J Physiol 276(2 Pt 1): G378-86. Kwei GY, Alvaro RF, Chen Q, Jenkins HJ, Hop CE, Keohane CA, Ly VT, Strauss JR, Wang RW, Wang Z, Pippert TR and Umbenhauer DR (1999). "Disposition of ivermectin and 137
Références 2011
cyclosporin A in CF-1 mice deficient in mdr1a P-glycoprotein." Drug Metab Dispos 27(5): 581-7. Kyrmizi I, Hatzis P, Katrakili N, Tronche F, Gonzalez FJ and Talianidis I (2006). "Plasticity and expanding complexity of the hepatic transcription factor network during liver development." Genes Dev 20(16): 2293-305. Labonte ED, Howles PN, Granholm NA, Rojas JC, Davies JP, Ioannou YA and Hui DY (2007). "Class B type I scavenger receptor is responsible for the high affinity cholesterol binding activity of intestinal brush border membrane vesicles." Biochim Biophys Acta 1771(9): 1132-9. Lagakos WS, Gajda AM, Agellon L, Binas B, Choi V, Mandap B, Russnak T, Zhou YX and Storch J (2011). "Different functions of intestinal and liver-type fatty acid-binding proteins in intestine and in whole body energy homeostasis." Am J Physiol Gastrointest Liver Physiol 300(5): G803-14. Laugerette F, Passilly-Degrace P, Patris B, Niot I, Febbraio M, Montmayeur JP and Besnard P (2005). "CD36 involvement in orosensory detection of dietary lipids, spontaneous fat preference, and digestive secretions." J Clin Invest 115(11): 3177-84. Lavie Y, Fiucci G, Czarny M and Liscovitch M (1999). "Changes in membrane microdomains and caveolae constituents in multidrug-resistant cancer cells." Lipids 34 Suppl: S57- 63. Lawn RM, Wade DP, Garvin MR, Wang X, Schwartz K, Porter JG, Seilhamer JJ, Vaughan AM and Oram JF (1999). "The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway." J Clin Invest 104(8): R25- 31. Le Beyec J, Chauffeton V, Kan HY, Janvier PL, Cywiner-Golenzer C, Chatelet FP, Kalopissis AD, Zannis V, Chambaz J, Pincon-Raymond M and Cardot P (1999). "The -700/-310 fragment of the apolipoprotein A-IV gene combined with the -890/-500 apolipoprotein C-III enhancer is sufficient to direct a pattern of gene expression similar to that for the endogenous apolipoprotein A-IV gene." J Biol Chem 274(8): 4954-61. Lecompte S, Szabo de Edelenyi F, Goumidi L, Maiani G, Moschonis G, Widhalm K, Molnar D, Kafatos A, Spinneker A, Breidenassel C, Dallongeville J, Meirhaeghe A and Borel P (2011). "Polymorphisms in the CD36/FAT gene are associated with plasma vitamin E concentrations in humans." Am J Clin Nutr 93(3): 644-51.
138
Références 2011
Lespine A, Chanoit G, Bousquet-Melou A, Lallemand E, Bassissi FM, Alvinerie M and Toutain PL (2006). "Contribution of lymphatic transport to the systemic exposure of orally administered moxidectin in conscious lymph duct-cannulated dogs." Eur J Pharm Sci 27(1): 37-43. Lespine A, Dupuy J, Alvinerie M, Comera C, Nagy T, Krajcsi P and Orlowski S (2009). "Interaction of macrocyclic lactones with the multidrug transporters: the bases of the pharmacokinetics of lipid-like drugs." Curr Drug Metab 10(3): 272-88. Lespine A, Dupuy J, Orlowski S, Nagy T, Glavinas H, Krajcsi P and Alvinerie M (2006). "Interaction of ivermectin with multidrug resistance proteins (MRP1, 2 and 3)." Chem Biol Interact 159(3): 169-79. Lespine A, Martin S, Dupuy J, Roulet A, Pineau T, Orlowski S and Alvinerie M (2007). "Interaction of macrocyclic lactones with P-glycoprotein: structure-affinity relationship." Eur J Pharm Sci 30(1): 84-94. Leveille-Webster CR and Arias IM (1995). "The biology of the P-glycoproteins." J Membr Biol 143(2): 89-102. Levin MS (1993). "Cellular retinol-binding proteins are determinants of retinol uptake and metabolism in stably transfected Caco-2 cells." J Biol Chem 268(11): 8267-76. Levy E, Menard D, Delvin E, Stan S, Mitchell G, Lambert M, Ziv E, Feoli-Fonseca JC and Seidman E (2001). "The polymorphism at codon 54 of the FABP2 gene increases fat absorption in human intestinal explants." J Biol Chem 276(43): 39679-84. Levy E, Menard D, Suc I, Delvin E, Marcil V, Brissette L, Thibault L and Bendayan M (2004). "Ontogeny, immunolocalisation, distribution and function of SR-BI in the human intestine." J Cell Sci 117(Pt 2): 327-37. Levy E, Spahis S, Sinnett D, Peretti N, Maupas-Schwalm F, Delvin E, Lambert M and Lavoie MA (2007). "Intestinal cholesterol transport proteins: an update and beyond." Curr Opin Lipidol 18(3): 310-8. Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD and Gordon JI (2005). "Obesity alters gut microbial ecology." Proc Natl Acad Sci U S A 102(31): 11070-5. Ley RE, Turnbaugh PJ, Klein S and Gordon JI (2006). "Microbial ecology: human gut microbes associated with obesity." Nature 444(7122): 1022-3. Li J, Ning G and Duncan SA (2000). "Mammalian hepatocyte differentiation requires the transcription factor HNF-4alpha." Genes Dev 14(4): 464-74.
139
Références 2011
Lifschitz A, Suarez VH, Sallovitz J, Cristel SL, Imperiale F, Ahoussou S, Schiavi C and Lanusse C (2010). "Cattle nematodes resistant to macrocyclic lactones: comparative effects of P-glycoprotein modulation on the efficacy and disposition kinetics of ivermectin and moxidectin." Exp Parasitol 125(2): 172-8. Lin MC, Arbeeny C, Bergquist K, Kienzle B, Gordon DA and Wetterau JR (1994). "Cloning and regulation of hamster microsomal triglyceride transfer protein. The regulation is independent from that of other hepatic and intestinal proteins which participate in the transport of fatty acids and triglycerides." J Biol Chem 269(46): 29138-45. Litman T, Druley TE, Stein WD and Bates SE (2001). "From MDR to MXR: new understanding of multidrug resistance systems, their properties and clinical significance." Cell Mol Life Sci 58(7): 931-59. Liu M, Shen L, Liu Y, Woods SC, Seeley RJ, D'Alessio D and Tso P (2004). "Obesity induced by a high-fat diet downregulates apolipoprotein A-IV gene expression in rat hypothalamus." Am J Physiol Endocrinol Metab 287(2): E366-70. Lo YL (2003). "Relationships between the hydrophilic-lipophilic balance values of pharmaceutical excipients and their multidrug resistance modulating effect in Caco-2 cells and rat intestines." J Control Release 90(1): 37-48. Lu S, Yao Y, Cheng X, Mitchell S, Leng S, Meng S, Gallagher JW, Shelness GS, Morris GS, Mahan J, Frase S, Mansbach CM, Weinberg RB and Black DD (2006). "Overexpression of apolipoprotein A-IV enhances lipid secretion in IPEC-1 cells by increasing chylomicron size." J Biol Chem 281(6): 3473-83. Lu S, Yao Y, Meng S, Cheng X and Black DD (2002). "Overexpression of apolipoprotein A- IV enhances lipid transport in newborn swine intestinal epithelial cells." J Biol Chem 277(35): 31929-37. Luciani MF, Denizot F, Savary S, Mattei MG and Chimini G (1994). "Cloning of two novel ABC transporters mapping on human chromosome 9." Genomics 21(1): 150-9. Luker GD, Pica CM, Kumar AS, Covey DF and Piwnica-Worms D (2000). "Effects of cholesterol and enantiomeric cholesterol on P-glycoprotein localization and function in low-density membrane domains." Biochemistry 39(29): 8692. Maglich JM, Lobe DC and Moore JT (2009). "The nuclear receptor CAR (NR1I3) regulates serum triglyceride levels under conditions of metabolic stress." J Lipid Res 50(3): 439-45.
140
Références 2011
Mandard S, Muller M and Kersten S (2004). "Peroxisome proliferator-activated receptor alpha target genes." Cell Mol Life Sci 61(4): 393-416. Mandard S, Zandbergen F, van Straten E, Wahli W, Kuipers F, Muller M and Kersten S (2006). "The fasting-induced adipose factor/angiopoietin-like protein 4 is physically associated with lipoproteins and governs plasma lipid levels and adiposity." J Biol Chem 281(2): 934-44. Mardones P, Quinones V, Amigo L, Moreno M, Miquel JF, Schwarz M, Miettinen HE, Trigatti B, Krieger M, VanPatten S, Cohen DE and Rigotti A (2001). "Hepatic cholesterol and bile acid metabolism and intestinal cholesterol absorption in scavenger receptor class B type I-deficient mice." J Lipid Res 42(2): 170-80. Mardones P, Strobel P, Miranda S, Leighton F, Quinones V, Amigo L, Rozowski J, Krieger M and Rigotti A (2002). "Alpha-tocopherol metabolism is abnormal in scavenger receptor class B type I (SR-BI)-deficient mice." J Nutr 132(3): 443-9. Martin GG, Danneberg H, Kumar LS, Atshaves BP, Erol E, Bader M, Schroeder F and Binas B (2003). "Decreased liver fatty acid binding capacity and altered liver lipid distribution in mice lacking the liver fatty acid-binding protein gene." J Biol Chem 278(24): 21429-38. Martinez-Jimenez CP, Kyrmizi I, Cardot P, Gonzalez FJ and Talianidis I (2010). "Hepatocyte nuclear factor 4alpha coordinates a transcription factor network regulating hepatic fatty acid metabolism." Mol Cell Biol 30(3): 565-77. Masuda D, Hirano K, Oku H, Sandoval JC, Kawase R, Yuasa-Kawase M, Yamashita Y, Takada M, Tsubakio-Yamamoto K, Tochino Y, Koseki M, Matsuura F, Nishida M, Kawamoto T, Ishigami M, Hori M, Shimomura I and Yamashita S (2009). "Chylomicron remnants are increased in the postprandial state in CD36 deficiency." J Lipid Res 50(5): 999-1011. Matsusue K, Kusakabe T, Noguchi T, Takiguchi S, Suzuki T, Yamano S and Gonzalez FJ (2008). "Hepatic steatosis in leptin-deficient mice is promoted by the PPARgamma target gene Fsp27." Cell Metab 7(4): 302-11. McIntosh MP, Batey AJ, Porter CJ, Charman WN and Coker SJ (2003). "Desbutylhalofantrine: evaluation of QT prolongation and other cardiovascular effects after intravenous administration in vivo." J Cardiovasc Pharmacol 41(3): 406-13.
141
Références 2011
Mealey KL, Bentjen SA, Gay JM and Cantor GH (2001). "Ivermectin sensitivity in collies is associated with a deletion mutation of the mdr1 gene." Pharmacogenetics 11(8): 727- 33. Meegalla RL, Billheimer JT and Cheng D (2002). "Concerted elevation of acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) activity through independent stimulation of mRNA expression of DGAT1 and DGAT2 by carbohydrate and insulin." Biochem Biophys Res Commun 298(3): 317-23. Memon RA, Tecott LH, Nonogaki K, Beigneux A, Moser AH, Grunfeld C and Feingold KR (2000). "Up-regulation of peroxisome proliferator-activated receptors (PPAR-alpha) and PPAR-gamma messenger ribonucleic acid expression in the liver in murine obesity: troglitazone induces expression of PPAR-gamma-responsive adipose tissue- specific genes in the liver of obese diabetic mice." Endocrinology 141(11): 4021-31. Merino G, Real R, Baro MF, Gonzalez-Lobato L, Prieto JG, Alvarez AI and Marques MM (2009). "Natural allelic variants of bovine ATP-binding cassette transporter ABCG2: increased activity of the Ser581 variant and development of tools for the discovery of new ABCG2 inhibitors." Drug Metab Dispos 37(1): 5-9. Metherall JE, Li H and Waugh K (1996). "Role of multidrug resistance P-glycoproteins in cholesterol biosynthesis." J Biol Chem 271(5): 2634-40. Milger K, Herrmann T, Becker C, Gotthardt D, Zickwolf J, Ehehalt R, Watkins PA, Stremmel W and Fullekrug J (2006). "Cellular uptake of fatty acids driven by the ER-localized acyl-CoA synthetase FATP4." J Cell Sci 119(Pt 22): 4678-88. Moestrup SK and Kozyraki R (2000). "Cubilin, a high-density lipoprotein receptor." Curr Opin Lipidol 11(2): 133-40. Moore LB, Maglich JM, McKee DD, Wisely B, Willson TM, Kliewer SA, Lambert MH and Moore JT (2002). "Pregnane X receptor (PXR), constitutive androstane receptor (CAR), and benzoate X receptor (BXR) define three pharmacologically distinct classes of nuclear receptors." Mol Endocrinol 16(5): 977-86. Moreau H, Gargouri Y, Lecat D, Junien JL and Verger R (1988). "Screening of preduodenal lipases in several mammals." Biochim Biophys Acta 959(3): 247-52. Mulligan JD, Flowers MT, Tebon A, Bitgood JJ, Wellington C, Hayden MR and Attie AD (2003). "ABCA1 is essential for efficient basolateral cholesterol efflux during the absorption of dietary cholesterol in chickens." J Biol Chem 278(15): 13356-66.
142
Références 2011
Murphy EJ and Schroeder F (1997). "Sterol carrier protein-2 mediated cholesterol esterification in transfected L-cell fibroblasts." Biochim Biophys Acta 1345(3): 283- 92. Nakamura T, Sakaeda T, Horinouchi M, Tamura T, Aoyama N, Shirakawa T, Matsuo M, Kasuga M and Okumura K (2002). "Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects." Clin Pharmacol Ther 71(4): 297-303. Napoli JL (1999). "Interactions of retinoid binding proteins and enzymes in retinoid metabolism." Biochim Biophys Acta 1440(2-3): 139-62. Narushima K, Takada T, Yamanashi Y and Suzuki H (2008). "Niemann-pick C1-like 1 mediates alpha-tocopherol transport." Mol Pharmacol 74(1): 42-9. Nassir F, Wilson B, Han X, Gross RW and Abumrad NA (2007). "CD36 is important for fatty acid and cholesterol uptake by the proximal but not distal intestine." J Biol Chem 282(27): 19493-501. Nauli AM, Nassir F, Zheng S, Yang Q, Lo CM, Vonlehmden SB, Lee D, Jandacek RJ, Abumrad NA and Tso P (2006). "CD36 is important for chylomicron formation and secretion and may mediate cholesterol uptake in the proximal intestine." Gastroenterology 131(4): 1197-207. Neeli I, Siddiqi SA, Siddiqi S, Mahan J, Lagakos WS, Binas B, Gheyi T, Storch J and Mansbach CM, 2nd (2007). "Liver fatty acid-binding protein initiates budding of pre- chylomicron transport vesicles from intestinal endoplasmic reticulum." J Biol Chem 282(25): 17974-84. Neerati P, Barla R and Bedada S (2011). "Influence of Diabetes Mellitus on P-Glycoprotein Function in Rat Intestine." Pharmacologia 2 (10): 293-298. Newberry EP, Xie Y, Kennedy SM, Luo J and Davidson NO (2006). "Protection against Western diet-induced obesity and hepatic steatosis in liver fatty acid-binding protein knockout mice." Hepatology 44(5): 1191-205. Nguyen DV, Drover VA, Knopfel M, Dhanasekaran P, Hauser H and Phillips MC (2009). "Influence of class B scavenger receptors on cholesterol flux across the brush border membrane and intestinal absorption." J Lipid Res 50(11): 2235-44. Nicholson AC, Frieda S, Pearce A and Silverstein RL (1995). "Oxidized LDL binds to CD36 on human monocyte-derived macrophages and transfected cell lines. Evidence
143
Références 2011
implicating the lipid moiety of the lipoprotein as the binding site." Arterioscler Thromb Vasc Biol 15(2): 269-75. Noy N (2000). "Retinoid-binding proteins: mediators of retinoid action." Biochem J 348 Pt 3: 481-95. Ntambi JM, Miyazaki M, Stoehr JP, Lan H, Kendziorski CM, Yandell BS, Song Y, Cohen P, Friedman JM and Attie AD (2002). "Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity." Proc Natl Acad Sci U S A 99(17): 11482-6. Ockner RK and Manning JA (1974). "Fatty acid-binding protein in small intestine. Identification, isolation, and evidence for its role in cellular fatty acid transport." J Clin Invest 54(2): 326-38. Oelkers P, Behari A, Cromley D, Billheimer JT and Sturley SL (1998). "Characterization of two human genes encoding acyl coenzyme A:cholesterol acyltransferase-related enzymes." J Biol Chem 273(41): 26765-71. Ogami K, Hadzopoulou-Cladaras M, Cladaras C and Zannis VI (1990). "Promoter elements and factors required for hepatic and intestinal transcription of the human ApoCIII gene." J Biol Chem 265(17): 9808-15. Ohama T, Hirano K, Zhang Z, Aoki R, Tsujii K, Nakagawa-Toyama Y, Tsukamoto K, Ikegami C, Matsuyama A, Ishigami M, Sakai N, Hiraoka H, Ueda K, Yamashita S and Matsuzawa Y (2002). "Dominant expression of ATP-binding cassette transporter-1 on basolateral surface of Caco-2 cells stimulated by LXR/RXR ligands." Biochem Biophys Res Commun 296(3): 625-30. Olivecrona G and Beisiegel U (1997). "Lipid binding of apolipoprotein CII is required for stimulation of lipoprotein lipase activity against apolipoprotein CII-deficient chylomicrons." Arterioscler Thromb Vasc Biol 17(8): 1545-9. Oliveira HC, Nilausen K, Meinertz H and Quintao EC (1993). "Cholesteryl esters in lymph chylomicrons: contribution from high density lipoprotein transferred from plasma into intestinal lymph." J Lipid Res 34(10): 1729-36. Olofsson SO and Boren J (2005). "Apolipoprotein B: a clinically important apolipoprotein which assembles atherogenic lipoproteins and promotes the development of atherosclerosis." J Intern Med 258(5): 395-410. Oram JF and Heinecke JW (2005). "ATP-binding cassette transporter A1: a cell cholesterol exporter that protects against cardiovascular disease." Physiol Rev 85(4): 1343-72.
144
Références 2011
Orlowski J, Kandasamy RA and Shull GE (1992). "Molecular cloning of putative members of the Na/H exchanger gene family. cDNA cloning, deduced amino acid sequence, and mRNA tissue expression of the rat Na/H exchanger NHE-1 and two structurally related proteins." J Biol Chem 267(13): 9331-9. Orlowski S, Comera C, Terce F and Collet X (2007). "Lipid rafts: dream or reality for cholesterol transporters?" Eur Biophys J 36(8): 869-85. Orso E, Broccardo C, Kaminski WE, Bottcher A, Liebisch G, Drobnik W, Gotz A, Chambenoit O, Diederich W, Langmann T, Spruss T, Luciani MF, Rothe G, Lackner KJ, Chimini G and Schmitz G (2000). "Transport of lipids from golgi to plasma membrane is defective in tangier disease patients and Abc1-deficient mice." Nat Genet 24(2): 192-6. Out R, Hoekstra M, de Jager SC, de Vos P, van der Westhuyzen DR, Webb NR, Van Eck M, Biessen EA and Van Berkel TJ (2005). "Adenovirus-mediated hepatic overexpression of scavenger receptor class B type I accelerates chylomicron metabolism in C57BL/6J mice." J Lipid Res 46(6): 1172-81. Out R, Kruijt JK, Rensen PC, Hildebrand RB, de Vos P, Van Eck M and Van Berkel TJ (2004). "Scavenger receptor BI plays a role in facilitating chylomicron metabolism." J Biol Chem 279(18): 18401-6. Palin KJ and Wilson CG (1984). "The effect of different oils on the absorption of probucol in the rat." J Pharm Pharmacol 36(9): 641-3. Pendse S, Sayegh MH and Frank MH (2003). "P-glycoprotein--a novel therapeutic target for immunomodulation in clinical transplantation and autoimmunity?" Curr Drug Targets 4(6): 469-76. Petit V, Arnould L, Martin P, Monnot MC, Pineau T, Besnard P and Niot I (2007). "Chronic high-fat diet affects intestinal fat absorption and postprandial triglyceride levels in the mouse." J Lipid Res 48(2): 278-87. Picard F, Boivin A, Lalonde J and Deshaies Y (2002). "Resistance of adipose tissue lipoprotein lipase to insulin action in rats fed an obesity-promoting diet." Am J Physiol Endocrinol Metab 282(2): E412-8. Pinto D and Clevers H (2005). "Wnt control of stem cells and differentiation in the intestinal epithelium." Exp Cell Res 306(2): 357-63. Pinto M, Robineleon S, Appay M, Kedinger M, Triadou N, Dussaulx E, Lacroix B, Simon- assmann P, Haffen K, Fogh J and Zweibaum A (1983). "Enterocyte-like 145
Références 2011
differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture." BIOLOGY OF THE CELL 47(3): 323-330. Plosch T, Bloks VW, Terasawa Y, Berdy S, Siegler K, Van Der Sluijs F, Kema IP, Groen AK, Shan B, Kuipers F and Schwarz M (2004). "Sitosterolemia in ABC-transporter G5-deficient mice is aggravated on activation of the liver-X receptor." Gastroenterology 126(1): 290-300. Podrez EA, Poliakov E, Shen Z, Zhang R, Deng Y, Sun M, Finton PJ, Shan L, Gugiu B, Fox PL, Hoff HF, Salomon RG and Hazen SL (2002). "Identification of a novel family of oxidized phospholipids that serve as ligands for the macrophage scavenger receptor CD36." J Biol Chem 277(41): 38503-16. Pohl J, Ring A and Stremmel W (2002). "Uptake of long-chain fatty acids in HepG2 cells involves caveolae: analysis of a novel pathway." J Lipid Res 43(9): 1390-9. Poirier H, Degrace P, Niot I, Bernard A and Besnard P (1996). "Localization and regulation of the putative membrane fatty-acid transporter (FAT) in the small intestine. Comparison with fatty acid-binding proteins (FABP)." Eur J Biochem 238(2): 368-73. Pol A, Luetterforst R, Lindsay M, Heino S, Ikonen E and Parton RG (2001). "A caveolin dominant negative mutant associates with lipid bodies and induces intracellular cholesterol imbalance." J Cell Biol 152(5): 1057-70. Polli JW, Wring SA, Humphreys JE, Huang L, Morgan JB, Webster LO and Serabjit-Singh CS (2001). "Rational use of in vitro P-glycoprotein assays in drug discovery." J Pharmacol Exp Ther 299(2): 620-8. Ponz de Leon M, Loria P, Iori R and Carulli N (1981). "Cholesterol absorption in cirrhosis: the role of total and individual bile acid pool size." Gastroenterology 80(6): 1428-37. Porter CJ, Charman SA, Humberstone AJ and Charman WN (1996). "Lymphatic transport of halofantrine in the conscious rat when administered as either the free base or the hydrochloride salt: effect of lipid class and lipid vehicle dispersion." J Pharm Sci 85(4): 357-61. Porter CJ and Charman WN (2001). "Intestinal lymphatic drug transport: an update." Adv Drug Deliv Rev 50(1-2): 61-80. Porter CJ, Trevaskis NL and Charman WN (2007). "Lipids and lipid-based formulations: optimizing the oral delivery of lipophilic drugs." Nat Rev Drug Discov 6(3): 231-48.
146
Références 2011
Potts JL, Coppack SW, Fisher RM, Humphreys SM, Gibbons GF and Frayn KN (1995). "Impaired postprandial clearance of triacylglycerol-rich lipoproteins in adipose tissue in obese subjects." Am J Physiol 268(4 Pt 1): E588-94. Pouliot JF, L'Heureux F, Liu Z, Prichard RK and Georges E (1997). "Reversal of P- glycoprotein-associated multidrug resistance by ivermectin." Biochem Pharmacol 53(1): 17-25. Procyshyn RM, Tsai G and Wasan KM (2003). "The influence of dyslipidemia on the plasma protein and lipoprotein distribution of haloperidol." Eur Neuropsychopharmacol 13(1): 33-7. Puglielli L, Rigotti A, Greco AV, Santos MJ and Nervi F (1995). "Sterol carrier protein-2 is involved in cholesterol transfer from the endoplasmic reticulum to the plasma membrane in human fibroblasts." J Biol Chem 270(32): 18723-6. Puigserver P, Wu Z, Park CW, Graves R, Wright M and Spiegelman BM (1998). "A cold- inducible coactivator of nuclear receptors linked to adaptive thermogenesis." Cell 92(6): 829-39. Raeissi SD, Hidalgo IJ, Segura-Aguilar J and Artursson P (1999). "Interplay between CYP3A-mediated metabolism and polarized efflux of terfenadine and its metabolites in intestinal epithelial Caco-2 (TC7) cell monolayers." Pharm Res 16(5): 625-32. Rajan N, Kidd GL, Talmage DA, Blaner WS, Suhara A and Goodman DS (1991). "Cellular retinoic acid-binding protein messenger RNA: levels in rat tissues and localization in rat testis." J Lipid Res 32(7): 1195-204. Ramaswamy M, Wallace TL, Cossum PA and Wasan KM (1999). "Species differences in the proportion of plasma lipoprotein lipid carried by high-density lipoproteins influence the distribution of free and liposomal nystatin in human, dog, and rat plasma." Antimicrob Agents Chemother 43(6): 1424-8. Razani B, Combs TP, Wang XB, Frank PG, Park DS, Russell RG, Li M, Tang B, Jelicks LA, Scherer PE and Lisanti MP (2002). "Caveolin-1-deficient mice are lean, resistant to diet-induced obesity, and show hypertriglyceridemia with adipocyte abnormalities." J Biol Chem 277(10): 8635-47. Reboul E, Goncalves A, Comera C, Bott R, Nowicki M, Landrier JF, Jourdheuil-Rahmani D, Dufour C, Collet X and Borel P (2011). "Vitamin D intestinal absorption is not a simple passive diffusion: Evidences for involvement of cholesterol transporters." Mol Nutr Food Res 55(5): 691-702. 147
Références 2011
Reboul E, Klein A, Bietrix F, Gleize B, Malezet-Desmoulins C, Schneider M, Margotat A, Lagrost L, Collet X and Borel P (2006). "Scavenger receptor class B type I (SR-BI) is involved in vitamin E transport across the enterocyte." J Biol Chem 281(8): 4739-45. Rhee J, Inoue Y, Yoon JC, Puigserver P, Fan M, Gonzalez FJ and Spiegelman BM (2003). "Regulation of hepatic fasting response by PPARgamma coactivator-1alpha (PGC-1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis." Proc Natl Acad Sci U S A 100(7): 4012-7. Rodrigues AC, Rebecchi IM, Bertolami MC, Faludi AA, Hirata MH and Hirata RD (2005). "High baseline serum total and LDL cholesterol levels are associated with MDR1 haplotypes in Brazilian hypercholesterolemic individuals of European descent." Braz J Med Biol Res 38(9): 1389-97. Rogue A, Spire C, Brun M, Claude N and Guillouzo A (2010). "Gene Expression Changes Induced by PPAR Gamma Agonists in Animal and Human Liver." PPAR Res 2010: 325183. Rohrer SP and Evans DV (1990). "Binding characteristics of ivermectin in plasma from collie dogs." Vet Res Commun 14(2): 157-65. Rossignol DP, Wasan KM, Choo E, Yau E, Wong N, Rose J, Moran J and Lynn M (2004). "Safety, pharmacokinetics, pharmacodynamics, and plasma lipoprotein distribution of eritoran (E5564) during continuous intravenous infusion into healthy volunteers." Antimicrob Agents Chemother 48(9): 3233-40. Roulet A, Puel O, Gesta S, Lepage JF, Drag M, Soll M, Alvinerie M and Pineau T (2003). "MDR1-deficient genotype in Collie dogs hypersensitive to the P-glycoprotein substrate ivermectin." Eur J Pharmacol 460(2-3): 85-91. Runge P, Muller DP, McAllister J, Calver D, Lloyd JK and Taylor D (1986). "Oral vitamin E supplements can prevent the retinopathy of abetalipoproteinaemia." Br J Ophthalmol 70(3): 166-73. Saeki T, Ueda K, Tanigawara Y, Hori R and Komano T (1993). "Human P-glycoprotein transports cyclosporin A and FK506." J Biol Chem 268(9): 6077-80. Sakai T, Sugiyama T, Banno Y, Kato Y and Nozawa Y (2004). "Involvement of phosphatidylcholine hydrolysis by phospholipase C in prostaglandin F2alpha-induced 1,2-diacylglycerol formation in osteoblast-like MC3T3-E1 cells." J Bone Miner Metab 22(3): 198-206.
148
Références 2011
Samyn H, Moerland M, van Gent T, van Haperen R, van Tol A and de Crom R (2009). "Reduction of HDL levels lowers plasma PLTP and affects its distribution among lipoproteins in mice." Biochim Biophys Acta 1791(8): 790-6. Sandoval JC, Nakagawa-Toyama Y, Masuda D, Tochino Y, Nakaoka H, Kawase R, Yuasa- Kawase M, Nakatani K, Inagaki M, Tsubakio-Yamamoto K, Ohama T, Matsuyama A, Nishida M, Ishigami M, Komuro I and Yamashita S (2010). "Molecular mechanisms of ezetimibe-induced attenuation of postprandial hypertriglyceridemia." J Atheroscler Thromb 17(9): 914-24. Sane AT, Sinnett D, Delvin E, Bendayan M, Marcil V, Menard D, Beaulieu JF and Levy E (2006). "Localization and role of NPC1L1 in cholesterol absorption in human intestine." J Lipid Res 47(10): 2112-20. Schaffer JE (1996). "A novel adipocyte long chain fatty acid transport protein." Eur J Med Res 1(4): 176-80. Schaffer JE and Lodish HF (1994). "Expression cloning and characterization of a novel adipocyte long chain fatty acid transport protein." Cell 79(3): 427-36. Schinkel AH and Jonker JW (2003). "Mammalian drug efflux transporters of the ATP binding cassette (ABC) family: an overview." Adv Drug Deliv Rev 55(1): 3-29. Schinkel AH, Mayer U, Wagenaar E, Mol CA, van Deemter L, Smit JJ, van der Valk MA, Voordouw AC, Spits H, van Tellingen O, Zijlmans JM, Fibbe WE and Borst P (1997). "Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug- transporting) P-glycoproteins." Proc Natl Acad Sci U S A 94(8): 4028-33. Schinkel AH, Smit JJ, van Tellingen O, Beijnen JH, Wagenaar E, van Deemter L, Mol CA, van der Valk MA, Robanus-Maandag EC, te Riele HP and et al. (1994). "Disruption of the mouse mdr1a P-glycoprotein gene leads to a deficiency in the blood-brain barrier and to increased sensitivity to drugs." Cell 77(4): 491-502. Schoeller C, Keelan M, Mulvey G, Stremmel W and Thomson AB (1995). "Oleic acid uptake into rat and rabbit jejunal brush border membrane." Biochim Biophys Acta 1236(1): 51-64. Segrest JP, Jones MK, De Loof H and Dashti N (2001). "Structure of apolipoprotein B-100 in low density lipoproteins." J Lipid Res 42(9): 1346-67. Sehayek E, Ono JG, Shefer S, Nguyen LB, Wang N, Batta AK, Salen G, Smith JD, Tall AR and Breslow JL (1998). "Biliary cholesterol excretion: a novel mechanism that regulates dietary cholesterol absorption." Proc Natl Acad Sci U S A 95(17): 10194-9. 149
Références 2011
Sgoutas D, MacMahon W, Love A and Jerkunica I (1986). "Interaction of cyclosporin A with human lipoproteins." J Pharm Pharmacol 38(8): 583-8. Shapiro AB and Ling V (1994). "ATPase activity of purified and reconstituted P-glycoprotein from Chinese hamster ovary cells." J Biol Chem 269(5): 3745-54. Sharom FJ (1997). "The P-glycoprotein efflux pump: how does it transport drugs?" J Membr Biol 160(3): 161-75. Shayeganpour A, Korashy H, Patel JP, El-Kadi AO and Brocks DR (2008). "The impact of experimental hyperlipidemia on the distribution and metabolism of amiodarone in rat." Int J Pharm 361(1-2): 78-86. Shen Y, Lookene A, Nilsson S and Olivecrona G (2002). "Functional analyses of human apolipoprotein CII by site-directed mutagenesis: identification of residues important for activation of lipoprotein lipase." J Biol Chem 277(6): 4334-42. Shiau YF (1981). "Mechanisms of intestinal fat absorption." Am J Physiol 240(1): G1-9. Shiau YF, Fernandez P, Jackson MJ and McMonagle S (1985). "Mechanisms maintaining a low-pH microclimate in the intestine." Am J Physiol 248(6 Pt 1): G608-17. Shim J, Moulson CL, Newberry EP, Lin MH, Xie Y, Kennedy SM, Miner JH and Davidson NO (2009). "Fatty acid transport protein 4 is dispensable for intestinal lipid absorption in mice." J Lipid Res 50(3): 491-500. Siddiqi SA, Gorelick FS, Mahan JT and Mansbach CM, 2nd (2003). "COPII proteins are required for Golgi fusion but not for endoplasmic reticulum budding of the pre- chylomicron transport vesicle." J Cell Sci 116(Pt 2): 415-27. Sietsma H, Veldman RJ and Kok JW (2001). "The involvement of sphingolipids in multidrug resistance." J Membr Biol 181(3): 153-62. Simmonds WJ (1972). "The role of micellar solubilization in lipid absorption." Aust J Exp Biol Med Sci 50(4): 403-21. Simons PJ, Kummer JA, Luiken JJ and Boon L (2010). "Apical CD36 immunolocalization in human and porcine taste buds from circumvallate and foliate papillae." Acta Histochem. Sipahi AM, Oliveira HC, Vasconcelos KS, Castilho LN, Bettarello A and Quintao EC (1989). "Contribution of plasma protein and lipoproteins to intestinal lymph: comparison of long-chain with medium-chain triglyceride duodenal infusion." Lymphology 22(1): 13-9.
150
Références 2011
Skov M, Tonnesen CK, Hansen GH and Danielsen EM (2011). "Dietary cholesterol induces trafficking of intestinal Niemann-Pick Type C1 Like 1 from the brush border to endosomes." Am J Physiol Gastrointest Liver Physiol 300(1): G33-40. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA and et al. (1993). "Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease." Cell 75(3): 451-62. Springer S, Spang A and Schekman R (1999). "A primer on vesicle budding." Cell 97(2): 145-8. Stahl A (2004). "A current review of fatty acid transport proteins (SLC27)." Pflugers Arch 447(5): 722-7. Stahl A, Gimeno RE, Tartaglia LA and Lodish HF (2001). "Fatty acid transport proteins: a current view of a growing family." Trends Endocrinol Metab 12(6): 266-73. Stahl A, Hirsch DJ, Gimeno RE, Punreddy S, Ge P, Watson N, Patel S, Kotler M, Raimondi A, Tartaglia LA and Lodish HF (1999). "Identification of the major intestinal fatty acid transport protein." Mol Cell 4(3): 299-308. Stefkova J, Poledne R and Hubacek JA (2004). "ATP-binding cassette (ABC) transporters in human metabolism and diseases." Physiol Res 53(3): 235-43. Stein Y and Stein O (2003). "Lipoprotein lipase and atherosclerosis." Atherosclerosis 170(1): 1-9. Stolowich NJ, Frolov A, Atshaves B, Murphy EJ, Jolly CA, Billheimer JT, Scott AI and Schroeder F (1997). "The sterol carrier protein-2 fatty acid binding site: an NMR, circular dichroic, and fluorescence spectroscopic determination." Biochemistry 36(7): 1719-29. Stone SJ, Levin MC, Zhou P, Han J, Walther TC and Farese RV, Jr. (2009). "The endoplasmic reticulum enzyme DGAT2 is found in mitochondria-associated membranes and has a mitochondrial targeting signal that promotes its association with mitochondria." J Biol Chem 284(8): 5352-61. Stone SJ, Myers HM, Watkins SM, Brown BE, Feingold KR, Elias PM and Farese RV, Jr. (2004). "Lipopenia and skin barrier abnormalities in DGAT2-deficient mice." J Biol Chem 279(12): 11767-76.
151
Références 2011
Strauss EW (1966). "Electron microscopic study of intestinal fat absorption in vitro from mixed micelles containing linolenic acid, monoolein, and bile salt." J Lipid Res 7(2): 307-23. Stremmel W (1988). "Uptake of fatty acids by jejunal mucosal cells is mediated by a fatty acid binding membrane protein." J Clin Invest 82(6): 2001-10. Stremmel W, Lotz G, Strohmeyer G and Berk PD (1985). "Identification, isolation, and partial characterization of a fatty acid binding protein from rat jejunal microvillous membranes." J Clin Invest 75(3): 1068-76. Sun J, He ZG, Cheng G, Wang SJ, Hao XH and Zou MJ (2004). "Multidrug resistance P- glycoprotein: crucial significance in drug disposition and interaction." Med Sci Monit 10(1): RA5-14. Tanaka T, Hosaka K, Hoshimaru M and Numa S (1979). "Purification and properties of long- chain acyl-coenzyme-A synthetase from rat liver." Eur J Biochem 98(1): 165-72. Temel RE, Gebre AK, Parks JS and Rudel LL (2003). "Compared with Acyl-CoA:cholesterol O-acyltransferase (ACAT) 1 and lecithin:cholesterol acyltransferase, ACAT2 displays the greatest capacity to differentiate cholesterol from sitosterol." J Biol Chem 278(48): 47594-601. Temel RE, Hou L, Rudel LL and Shelness GS (2007). "ACAT2 stimulates cholesteryl ester secretion in apoB-containing lipoproteins." J Lipid Res 48(7): 1618-27. Temel RE, Lee RG, Kelley KL, Davis MA, Shah R, Sawyer JK, Wilson MD and Rudel LL (2005). "Intestinal cholesterol absorption is substantially reduced in mice deficient in both ABCA1 and ACAT2." J Lipid Res 46(11): 2423-31. Terpstra V, van Amersfoort ES, van Velzen AG, Kuiper J and van Berkel TJ (2000). "Hepatic and extrahepatic scavenger receptors: function in relation to disease." Arterioscler Thromb Vasc Biol 20(8): 1860-72. Tessner TG and Stenson WF (2000). "Overexpression of MDR1 in an intestinal cell line results in increased cholesterol uptake from micelles." Biochem Biophys Res Commun 267(2): 565-71. Thornton SJ, Wong E, Lee SD and Wasan KM (2008). "Effect of dietary fat on hepatic liver X receptor expression in P-glycoprotein deficient mice: implications for cholesterol metabolism." Lipids Health Dis 7: 21. Tontonoz P, Hu E, Graves RA, Budavari AI and Spiegelman BM (1994). "mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer." Genes Dev 8(10): 1224-34. 152
Références 2011
Traber MG, Goldberg I, Davidson E, Lagmay N and Kayden HJ (1990). "Vitamin E uptake by human intestinal cells during lipolysis in vitro." Gastroenterology 98(1): 96-103. Trevaskis NL, Porter CJ and Charman WN (2006). "An examination of the interplay between enterocyte-based metabolism and lymphatic drug transport in the rat." Drug Metab Dispos 34(5): 729-33. Trevaskis NL, Porter CJ and Charman WN (2006). "The lymph lipid precursor pool is a key determinant of intestinal lymphatic drug transport." J Pharmacol Exp Ther 316(2): 881-91. Trigatti BL, Mangroo D and Gerber GE (1991). "Photoaffinity labeling and fatty acid permeation in 3T3-L1 adipocytes." J Biol Chem 266(33): 22621-5. Trotter PJ, Ho SY and Storch J (1996). "Fatty acid uptake by Caco-2 human intestinal cells." J Lipid Res 37(2): 336-46. Tso P and Liu M (2004). "Apolipoprotein A-IV, food intake, and obesity." Physiol Behav 83(4): 631-43. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER and Gordon JI (2006). "An obesity-associated gut microbiome with increased capacity for energy harvest." Nature 444(7122): 1027-31. Twentyman PR (1992). "Cyclosporins as drug resistance modifiers." Biochem Pharmacol 43(1): 109-17. Ueda K, Cornwell MM, Gottesman MM, Pastan I, Roninson IB, Ling V and Riordan JR (1986). "The mdr1 gene, responsible for multidrug-resistance, codes for P- glycoprotein." Biochem Biophys Res Commun 141(3): 956-62. Vahouny GV, Nelson J and Treadwell CR (1968). "Inhibition of triglyceride synthesis in everted intestinal sacs." Proc Soc Exp Biol Med 128(2): 495-500. van Bennekum A, Werder M, Thuahnai ST, Han CH, Duong P, Williams DL, Wettstein P, Schulthess G, Phillips MC and Hauser H (2005). "Class B scavenger receptor- mediated intestinal absorption of dietary beta-carotene and cholesterol." Biochemistry 44(11): 4517-25. van den Bosch H, Postema NM, de Haas GH and van Deenen LL (1965). "On the positional specificity of phospholipase A from pancreas." Biochim Biophys Acta 98(3): 657-9. van der Veen JN, van Dijk TH, Vrins CL, van Meer H, Havinga R, Bijsterveld K, Tietge UJ, Groen AK and Kuipers F (2009). "Activation of the liver X receptor stimulates trans- intestinal excretion of plasma cholesterol." J Biol Chem 284(29): 19211-9. 153
Références 2011
van der Velde AE, Vrins CL, van den Oever K, Kunne C, Oude Elferink RP, Kuipers F and Groen AK (2007). "Direct intestinal cholesterol secretion contributes significantly to total fecal neutral sterol excretion in mice." Gastroenterology 133(3): 967-75. van der Velde AE, Vrins CL, van den Oever K, Seemann I, Oude Elferink RP, van Eck M, Kuipers F and Groen AK (2008). "Regulation of direct transintestinal cholesterol excretion in mice." Am J Physiol Gastrointest Liver Physiol 295(1): G203-G208. van Heek M, Farley C, Compton DS, Hoos L, Alton KB, Sybertz EJ and Davis HR, Jr. (2000). "Comparison of the activity and disposition of the novel cholesterol absorption inhibitor, SCH58235, and its glucuronide, SCH60663." Br J Pharmacol 129(8): 1748- 54. Van Nieuwenhoven FA, Verstijnen CP, Abumrad NA, Willemsen PH, Van Eys GJ, Van der Vusse GJ and Glatz JF (1995). "Putative membrane fatty acid translocase and cytoplasmic fatty acid-binding protein are co-expressed in rat heart and skeletal muscles." Biochem Biophys Res Commun 207(2): 747-52. van Wijk JP, Halkes CJ, Erkelens DW and Castro Cabezas M (2003). "Fasting and daylong triglycerides in obesity with and without type 2 diabetes." Metabolism 52(8): 1043-9. Vasconcelos KS, Sipahi AM, Oliveira HC, Castilho LN, De Luccia N and Quintao EC (1989). "Origin of intestinal lymph cholesterol in rats: contribution from luminal absorption, mucosal synthesis and filtration from plasma." Lymphology 22(1): 4-12. Vassileva G, Huwyler L, Poirier K, Agellon LB and Toth MJ (2000). "The intestinal fatty acid binding protein is not essential for dietary fat absorption in mice." Faseb J 14(13): 2040-6. Vautier S, F.C., Milane A., Lacomblez L, Davrinche C. and R. F (2006). "ABCB1 (P- glycoprotéine) et barrière hémato-encéphalique : implication dans les maladies neurologiques et leurs traitements." Journal de pharmacie clinique 25: 225 - 235. Voshol PJ, Minich DM, Havinga R, Elferink RP, Verkade HJ, Groen AK and Kuipers F (2000). "Postprandial chylomicron formation and fat absorption in multidrug resistance gene 2 P-glycoprotein-deficient mice." Gastroenterology 118(1): 173-82. Vrins CL, van der Velde AE, van den Oever K, Levels JH, Huet S, Oude Elferink RP, Kuipers F and Groen AK (2009). "Peroxisome proliferator-activated receptor delta activation leads to increased transintestinal cholesterol efflux." J Lipid Res 50(10): 2046-54.
154
Références 2011
Wacher VJ, Salphati L and Benet LZ (2001). "Active secretion and enterocytic drug metabolism barriers to drug absorption." Adv Drug Deliv Rev 46(1-3): 89-102. Wakelam MJ and Pettitt TR (1998). "Determination of phospholipase C- or phospholipase D- catalyzed phosphatidylcholine hydrolysis." Methods Mol Biol 105: 141-9. Wasan KM, Brazeau GA, Keyhani A, Hayman AC and Lopez-Berestein G (1993). "Roles of liposome composition and temperature in distribution of amphotericin B in serum lipoproteins." Antimicrob Agents Chemother 37(2): 246-50. Wasan KM and Cassidy SM (1998). "Role of plasma lipoproteins in modifying the biological activity of hydrophobic drugs." J Pharm Sci 87(4): 411-24. Wasan KM, Pritchard PH, Ramaswamy M, Wong W, Donnachie EM and Brunner LJ (1997). "Differences in lipoprotein lipid concentration and composition modify the plasma distribution of cyclosporine." Pharm Res 14(11): 1613-20. Werder M, Han CH, Wehrli E, Bimmler D, Schulthess G and Hauser H (2001). "Role of scavenger receptors SR-BI and CD36 in selective sterol uptake in the small intestine." Biochemistry 40(38): 11643-50. Westergaard H and Dietschy JM (1976). "The mechanism whereby bile acid micelles increase the rate of fatty acid and cholesterol uptake into the intestinal mucosal cell." J Clin Invest 58(1): 97-108. Wetterau JR, Gregg RE, Harrity TW, Arbeeny C, Cap M, Connolly F, Chu CH, George RJ, Gordon DA, Jamil H, Jolibois KG, Kunselman LK, Lan SJ, Maccagnan TJ, Ricci B, Yan M, Young D, Chen Y, Fryszman OM, Logan JV, Musial CL, Poss MA, Robl JA, Simpkins LM, Slusarchyk WA, Sulsky R, Taunk P, Magnin DR, Tino JA, Lawrence RM, Dickson JK, Jr. and Biller SA (1998). "An MTP inhibitor that normalizes atherogenic lipoprotein levels in WHHL rabbits." Science 282(5389): 751-4. Wiersma H, Nijstad N, Gautier T, Iqbal J, Kuipers F, Hussain MM and Tietge UJ (2010). "Scavenger receptor BI facilitates hepatic very low density lipoprotein production in mice." J Lipid Res 51(3): 544-53. Xie Y, Newberry EP, Young SG, Robine S, Hamilton RL, Wong JS, Luo J, Kennedy S and Davidson NO (2006). "Compensatory increase in hepatic lipogenesis in mice with conditional intestine-specific Mttp deficiency." J Biol Chem 281(7): 4075-86. Yao L, Heubi JE, Buckley DD, Fierra H, Setchell KD, Granholm NA, Tso P, Hui DY and Woollett LA (2002). "Separation of micelles and vesicles within lumenal aspirates
155
Références 2011
from healthy humans: solubilization of cholesterol after a meal." J Lipid Res 43(4): 654-60. Yen CL and Farese RV, Jr. (2003). "MGAT2, a monoacylglycerol acyltransferase expressed in the small intestine." J Biol Chem 278(20): 18532-7. Yen CL, Stone SJ, Cases S, Zhou P and Farese RV, Jr. (2002). "Identification of a gene encoding MGAT1, a monoacylglycerol acyltransferase." Proc Natl Acad Sci U S A 99(13): 8512-7. Yengi LG, Leung L and Kao J (2007). "The evolving role of drug metabolism in drug discovery and development." Pharm Res 24(5): 842-58. Yokoyama S (2005). "Assembly of high density lipoprotein by the ABCA1/apolipoprotein pathway." Curr Opin Lipidol 16(3): 269-79. Yoon JC, Chickering TW, Rosen ED, Dussault B, Qin Y, Soukas A, Friedman JM, Holmes WE and Spiegelman BM (2000). "Peroxisome proliferator-activated receptor gamma target gene encoding a novel angiopoietin-related protein associated with adipose differentiation." Mol Cell Biol 20(14): 5343-9. Yoshida K, Shimizugawa T, Ono M and Furukawa H (2002). "Angiopoietin-like protein 4 is a potent hyperlipidemia-inducing factor in mice and inhibitor of lipoprotein lipase." J Lipid Res 43(11): 1770-2. Yoshioka M, Bolduc C, Raymond V and St-Amand J (2008). "High-fat meal-induced changes in the duodenum mucosa transcriptome." Obesity (Silver Spring) 16(10): 2302-7. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC and Hobbs HH (2002). "Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol." J Clin Invest 110(5): 671-80. Yu L, York J, von Bergmann K, Lutjohann D, Cohen JC and Hobbs HH (2003). "Stimulation of cholesterol excretion by the liver X receptor agonist requires ATP-binding cassette transporters G5 and G8." J Biol Chem 278(18): 15565-70. Zanlungo S, Amigo L, Mendoza H, Miquel JF, Vio C, Glick JM, Rodriguez A, Kozarsky K, Quinones V, Rigotti A and Nervi F (2000). "Sterol carrier protein 2 gene transfer changes lipid metabolism and enterohepatic sterol circulation in mice." Gastroenterology 119(6): 1708-19. Zhou J, Zhai Y, Mu Y, Gong H, Uppal H, Toma D, Ren S, Evans RM and Xie W (2006). "A novel pregnane X receptor-mediated and sterol regulatory element-binding protein- independent lipogenic pathway." J Biol Chem 281(21): 15013-20. 156
Références 2011
Zhou SL, Stump D, Kiang CL, Isola LM and Berk PD (1995). "Mitochondrial aspartate aminotransferase expressed on the surface of 3T3-L1 adipocytes mediates saturable fatty acid uptake." Proc Soc Exp Biol Med 208(3): 263-70. Zimmermann R, Strauss JG, Haemmerle G, Schoiswohl G, Birner-Gruenberger R, Riederer M, Lass A, Neuberger G, Eisenhaber F, Hermetter A and Zechner R (2004). "Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase." Science 306(5700): 1383-6.
157
Résumé
L’absorption intestinale des lipides et des micronutriments à caractère lipophile fait intervenir des transporteurs de la membrane apicale de l’entérocyte tels que NPC1L1, SR-B1 et CD36. Pour les xénobiotiques incluant les médicaments lipophiles, les transporteurs ABC multidrogues, comme la P-glycoprotéine (Pgp) ou MRP ou BCRP, interviennent en effluant et en limitant la biodisponibilité de ces composés dans l’organisme. Ils sont aussi capables de transporter des lipides comme le cholestérol et les phospholipides. De plus, un rôle dans l’homéostasie des lipides a été évoqué pour la Pgp. Les objectifs de cette thèse ont été (i) de caractériser la contribution de NPC1L1 et SR-B1 dans l’absorption du cholestérol et d’une vitamine liposoluble, la vitamine E ou tocophérol, tout au long de l’intestin grêle, (ii) d’identifier le rôle de la Pgp dans l’homéostasie des lipides dans l’organisme et enfin (iii) d’évaluer le rôle de la Pgp dans la biodisponibilité de l’ivermectine, un médicament anthelmintique lipophile, lorsqu’elle est administrée dans des formulations lipidiques. Nous avons montré que les cellules Caco-2 sont capables d’absorber le cholestérol et le tocophérol incorporés dans des micelles contenant de l’acide oléique, selon une voie commune, faisant intervenir NPC1L1 et SR-B1. Chez la souris, nous avons montré que le tocophérol est majoritairement absorbé au niveau du jéjunum médial et distal. Nous avons également mis en évidence un rôle spécifique de ces transporteurs en fonction de leur localisation intestinale : NPC1L1 intervient tout au long de l’intestin dans l’absorption du cholestérol et seulement au niveau distal pour le tocophérol. SR-B1 intervient dans l’absorption du cholestérol au niveau distal et dans celle du tocophérol au niveau proximal de l’intestin (Publication 1: Soayfane et al., 2011). Par ailleurs, nous avons mis en évidence un rôle important de la P-glycoprotéine (Pgp) dans le maintien de l’homéostasie des lipides. Les souris déficientes en Pgp développent une obésité associée à des troubles métaboliques (stéatose hépatique, hyperinsulinémie) (Publication 2: Foucaud-Vignault et al., 2011) mais ont aussi une triglycéridémie postprandiale augmentée par rapport aux souris sauvages. Parmi les mécanismes explorés, nous avons montré que les souris déficientes en Pgp avaient une diminution de l’absorption intestinale des lipides et une captation plus importante des lipides par le tissu adipeux (Publication 3: Soayfane et al., en préparation). Enfin, la biodisponibilité de l’ivermectine formulée dans de l’huile ou avec un émulsifiant, le polysorbate 80, a été évaluée. Nous avons montré chez la souris que le polysorbate augmente de façon marquée la biodisponibilité de l’ivermectine via l’inhibition de la Pgp (Publication 4: Soayfane et al., en préparation). En conclusion, nous avons contribué à élucider certains mécanismes qui sous-tendent l’absorption intestinale de différents composés lipidiques. Différents rôles de NPC1L1 et SR-B1 dans l’absorption du cholestérol et du tocophérol ont été établis tout au long de l’intestin. De plus, d’autres transporteurs semblent intervenir dans l’absorption du tocophérol au niveau médial et distal de l’intestin. D’autre part, l’homéostasie des lipides est profondément affectée chez la souris déficiente en Pgp révélant une nouvelle fonction physiologique possible pour la Pgp en relation avec le développement de l’obésité. Enfin, des formulations à base de composés capables d’inhiber la Pgp augmentent la biodisponibilité des médicaments lipophiles dans l’organisme et pourraient contribuer ainsi à améliorer l’efficacité. Ces travaux devraient contribuer à potentialiser l’absorption de composés lipophiles clé de notre alimentation comme les vitamines liposolubles mais aussi certains médicaments lipophiles.
Mots clés : transporteurs, absorption intestinale, NPC1L1, SR-B1, Pgp, cholestérol, triglycéride, vitamine E, ivermectine