(BTS) Rapid Detection of Leukemia-Associated Translocation

Rapid detection of leukemia-associated translocation fusion genes using a novel combined RT-PCR and ﬂow cytometric method Q-Y Zhang1, K Garner2 and DS Viswanatha1

1Department of Pathology, Experimental Pathology Laboratory, University of New Mexico Health Sciences Center, Albuquerque, NM, USA; and 2Tricore Reference Laboratories, Albuquerque, NM, USA

Efficient detection of recurrent translocation-associated fusion these additional maneuvers are technically more laborious, genes is of critical importance for the diagnosis, prognosis and costly and time-consuming. In order to retain the specificity post-therapeutic monitoring of many leukemias. Typically, the presence of such translocations is revealed by RT-PCR tech- of probe hybridization detection of target PCR amplicons and nique, followed by Southern blot hybridization to ensure speci- simultaneously reduce the technical complexity of post-PCR ficity of the PCR product. Though widely employed, post-PCR analysis in the diagnostic setting, we have developed a novel analysis of this type is relatively laborious and time-intensive. approach involving capture of fluorescent PCR product and As a departure from standard analytic approaches, we have probe complexes on to polystyrene microsphere beads, fol- developed a robust novel method combining both high speci- lowed by rapid analysis in a flow cytometer. By optimizing ficity and sensitivity, based on polystyrene bead capture of fluorescently labeled PCR products, with subsequent analysis several aspects of both the PCR and post-PCR analysis, we by flow cytometry. Results from cell line and patient sample have developed a specific and sensitive assay, with additional evaluations indicate that this method may be easily incorpor- substantial benefits in labor and cost reduction. ated into the diagnostic molecular laboratory as a rapid and cost-effective alternative to currently employed techniques. Leukemia (2002) 16, 144–149. DOI: 10.1038/sj/leu/2402322 Materialsand methods Keywords: leukemia; translocations; PCR; flow cytometry Cell lines and patient samples

Introduction Cell lines K562, BV173 and SUP-B15, carrying the t(9;22)- associated BCR-ABL fusion transcripts B3-A2, B2-A2, and Recurrent chromosomal translocations characterize a substan- E1-A2, respectively, were obtained from the American Type tial proportion of the acute myeloid and lymphoid leukemias, Culture Collection (ATCC). Cell line 697 harbors the resulting in the formation of unique fusion genes. The identi- t(1;19)/E2A-PBX1 fusion and was a generous gift of Dr D LeB- fication of particular fusion gene abnormalities is of consider- run, Queen’s University, Canada. For evaluation of patient 1–4 able diagnostic and prognostic importance. In addition, samples, excess material (ie banked cells or RNA) retained at given the ‘leukemia-specific’ nature of these transcribed UNM was identified, including cases with and without the genes, the corresponding chimeric mRNAs can serve as valu- translocation fusion genes of interest. For dilutional sensitivity able markers for sensitive minimal residual disease monitoring studies, either serial RNA-to-RNA or cell-to-cell dilutions were 1,5,6 following therapeutic induction. prepared using the positive control cell lines and a fusion gene Detection of an individual translocation fusion gene abnor- negative cell source. The research protocol was approved by mality is commonly accomplished by reverse-transcription the UNM Human Research Review Committee. polymerase chain reaction (RT-PCR) amplification encompassing the junctional region of the chimeric mRNA molecule, followed by detection of the specific PCR products by gel RNAisolation and reverse-transcription polymerase electrophoresis. Although interpretation of electrophoretic chain reaction band patterns may often be sufficient, the production of non- specific PCR amplicons can frequently create substantial dif- RNA isolation was performed using the RNeasy Mini Kit ficulty in accurate analysis. To alleviate this problem, many (Qiagen, Santa Clarita, CA, USA) according to the manufac- laboratories employ an additional Southern blot hybridization turer’s protocol. Single tube RT-PCR was carried out using the step, using a specific oligonucleotide probe with isotopic or OneStepRT-PCR Kit (Qiagen). Briefly, 1 ␮g of total RNA was 7 non-isotopic detection on a nylon membrane. Although reverse transcribed and subjected to PCR amplification in a specificity is greatly enhanced using blot and probe methods, 50 ␮l reaction volume containing 1 × OneStepRT-PCR Buffer, 400 ␮M of each dNTP, 30 pmol (0.6 ␮M) of each primer and 2 ␮l OneStepRT-PCR enzyme mix. RT-PCR was performed Correspondence: DS Viswanatha, Rm 337-C, Biomedical Research Facility, University of New Mexico Health Sciences Center, 915 Cam- in a GeneAmpmodel 9700 thermal cycler (Perkin Elmer, Fos- ino de Salud NE, Albuquerque, NM 87131, USA; Fax: 505 272–5186 ter City, CA, USA) using the following parameters: (RT step) Received 21 March 2001; accepted 27 August 2001 50°C for 30 min, then (PCR step) 95°C for 15 min (for ‘hot PCR and flow cytometry to detect leukemic translocations Q-Y Zhang et al 145 start’), 35 cycles of 95°C for 30 s, 58–62°C for 30 s, 72°C for added to 10 ␮l of 0.5% streptavidin coated 6.0–8.0 ␮m poly- 1 min, final extension at 72°C for 10 min, followed by cooling styrene beads (SVP-60–5, Spherotech Inc, Libertyville, IL, to 4°C. For each primer set employed in the fluorescent detec- USA) and incubated at room temperature for 1 h. The beads tion protocol, the reverse (downstream) primer was labeled were subsequently spun at high speed in a microcentrifuge for with biotin at the 5Ј end to enable post-PCR analysis (see 15 s, the supernatant discarded and the beads resuspended in below). One PCR was carried out to detect the t(1;19)/ 750 ␮l of buffer solution (100 mM Tris, 300 mM NaCl) in a 5 E2A-PBX1 fusion. For the t(9;22)/BCR-ABL, one single tube ml volume borosilicate collection tube. To enhance the polymerase chain reaction was performed, using B2 and E1 maximum dilutional sensitivity of the fluorescent assay, a forward primers with the A2 reverse primer, to detect the second 10 ␮l aliquot of the PCR products was further purified major breakpoint region (M-BCR) B2-A2 and B3-A2 fusions, using a spin column (MinElute PCR Purification Kit; Qiagen) as well as the minor breakpoint cluster region (m-BCR) E1-A2 to remove excess biotinylated primers, then subjected to the fusion, respectively. Negative controls (non-specific RNA or fluorescent probe hybridization reaction as described. no RNA template) were utilized in each run to assess for con- For comparison with the more traditional probe hybridiz- tamination. To confirm RNA integrity and reverse transcription ation method of post-PCR analysis, the reverse transcription efficacy, a segment of beta2-microglobulin (beta2-MCG)or polymerase chain reactions were also carried out with E2A gene transcript was concurrently amplified for each sam- unmodified (non-biotinylated) primers followed by gel ple and detected by agarose gel electrophoresis. The nucleo- electrophoresis, Southern blot transfer and junction-specific tide sequences of all PCR primers are listed in Table 1. All oligoprobe hybridization. The same oligonucleotide probe primers and probes were synthesized by the Department of sequences in Table 1 were prepared instead with a 5Ј end Biochemistry and Molecular Biology, University of New biotin label to enable subsequent chemiluminescent detection Mexico. of specific RT-PCR products on radiographic film, as previously described.7

Speciﬁc probe hybridization and bead capture of ﬂuorescent PCR products Flow cytometric analysis

Oligonucleotide probes specific to the junctional regions of Sample tubes were analysed on a FACScan flow cytometer the amplified fusion gene transcripts of interest were synthe- (Becton Dickinson, San Jose, CA, USA) using a 488 nm laser sized by phosphoramidite chemistry with a fluorescent moiety excitation. Two-color compensation was performed where (eg 6-FAM or CY3) attached at the 5Ј end. The sequences of necessary. For data analysis, the mean fluorescence intensity all hybridization probes are shown in Table 1. For fluorescent values of the test samples were compared against negative probe hybridization, 10 ␮l of the final RT-PCR product was controls (non-specific RNA template and/or no RNA mixed with 10 pmol of the corresponding 6-FAM or CY3 lab- template). A mean fluorescence shift above 101 (log scale) was eled probe in a 0.5 ml PCR tube (approximate total volume considered positive and below this value, negative. 12–15 ␮l, depending on probe concentration). The hybridization reactions were performed in the thermal cycler by denat- uring the PCR products at 95°C for 5 min, followed by a 60– Results and discussion 65°C probe annealing for 15 min. Sample tubes were rapidly cooled to 4°C. The volume of hybridization product was then The t(1;19) abnormality in pediatric acute lymphoblastic leukemia is a translocation resulting essentially in a single breakpoint-fusion event with one chimeric E2A-PBX1 fusion Table 1 PCR primer and oligonucleotide probe sequences transcript,8–10 and is thus relatively easily amplified by RT- PCR. The 697 cell line bearing this translocation was used as t(1;19)/E2A-PBXI fusion: the prototype to develop and test our methodology, which is E2A forward CTCCACGGCCTGCAGAGTAAG schematically depicted in Figure 1. Following experimental PBX1 reverse Biotin-GCCACGCCTTCCGCTAACA optimization, 15 blinded patient samples either positive or E2A-PBX1 probe 6FAM-TACAGTGTTTTGAGTATCCGAGG negative for the E2A-PBX1 fusion were evaluated. Among t(9;22)/BCR-ABL fusion: these, six were found to be positive and nine were negative for the E2A-PBX1 transcript by the PCR-bead capture-flow E1 forward CGCATGTTCCGGGACAAAAG cytometric method, in complete concordance with prior B2 forward GAGCTGCAGATGCTGACCAA A2 reverse Biotin-CAGACCCTGAGGCTCAAAGT results obtained from equivalent RT-PCR followed by standard B3A2 probe 6FAM-GCAGAGTTCAAAAGCCCTTCAG Southern blot hybridization using an E2A-PBX1 biotinylated B2A2 probe CY3-CATCAATAAGGAAGAAGCCCT junction probe (data not shown). To determine the relative E1A2 probe 6FAM-GGAGACGCAGAAGCCCTTCAG sensitivity of the assay, serial dilutions of RNA from cell line 697 in RNA from cell line SUP-T1 were examined. To maxi- mRNA controls: mise the relative sensitivity of the assay, a 10 ␮l aliquot of the E2A-C forward TGCACAACCACGCGGCCCTC PCR products was also purified by spin column and the eluate E2A-C reverse CTTCTCCTCCTCCGAGTGGT used for subsequent probe hybridization and bead capture. Beta2-MCG GAAAAAGATGAGTATGCCTG Not surprisingly, a greater sensitivity (у50-fold increase) was forward Beta2-MCG ATCTTCAAACCTCCATGATG observed with the purified PCR product, owing to removal reverse of excess biotinylated PBX1 primer, which would otherwise compete for streptavidin binding sites on the beads. Results of 5Ј biotin or fluorescent alterations to oligonucleotide sequences this analysis for the E2A-PBX1 fusion are shown in Figure 2, are underlined. demonstrating the agarose gel electrophoresis bands and the All sequences shown in 5Ј–3Ј orientation. corresponding post-PCR fluorescent dot plots. A dilutional

Leukemia PCR and ﬂow cytometry to detect leukemic translocations Q-Y Zhang et al 146

Figure 2 Sensitivity and specificity of fluorescent PCR product- bead capture-flow cytometry technique for detection of the t(1;19)/E2A-PBX1 gene fusion. RNA from cell line 697 harboring the t(1;19)/E2A-PBX1 was serially diluted in RNA from the T cell leukemia line SUP-T1. Upper panel shows standard agarose gel electrophoresis of samples analysed for the presence of the E2A-PBX1 fusion transcript by RT-PCR. M is a size marker. Lane 1, no RNA; lane 2, pure SUP- T1 RNA; lane 3, pure 697 RNA; lanes 4 to 10, 697 to SUP-T1 RNA dilutions of 1/100, 1/1000, 1/5000, 1/104, 1/5 × 104, 1/105, 1/5 × 105, respectively. Bottom images demonstrate flow cytometric analysis of the corresponding biotinylated PCR products after E2A-PBX1 junction-specific fluorescent oligoprobe hybridization and capture on to streptavidin-coated polystyrene beads. Excess biotin-labeled primers were removed by spin column prior to probe hybridization as described in the text, to enhance detection sensitivity. Fluorescent detection of E2A-PBX1 transcripts extends to 1 in 5 × 105 Figure 1 Schematic of fluorescent probe-bead capture method for (approximately 2 pg of target RNA) by flow analysis method (lane 10), post-PCR analysis of leukemia-associated fusion transcripts. Poly- with absence of significant background fluorescent signal in negative merase chain reaction encompassing the fusion junction region of control samples (lanes 1 and 2). interest is carried out using a standard forward (sense) primer and 5Ј biotinylated reverse (antisense) primer, as shown in (a). An aliquot of PCR products is then hybridized in solution with a 5Ј fluorescently + the E1-A2 probe reaction (6-FAM) was carried out separately. labeled junction-specific oligoprobe (b). The probe PCR product Following these initial experiments, a group of BCR-ABL-posi- complex is captured on to streptavidin-coated polystyrene beads (c). Detection of fluorescent signal is achieved by flow cytometry of the tive or -negative patient samples was randomly selected and beads. Samples lacking the particular gene fusion will not generate tested as ‘unknowns’. These included four B3-A2,twoB2-A2 specific PCR products and will not have a specific site for stringent and one E1-A2 type fusions (comprising three diagnostic and probe hybridization and so no fluorescent signal will be obtained from four post-therapy samples), as well as three BCR-ABL negative the beads. Procedural details are provided in the text. cases. These data are shown in Figure 3 and indicate that cell line or diagnostic patient samples with high BCR-ABL transcript abundance are unequivocally detected on the agarose sensitivity of 1 in 5 × 105 (equivalent to approximately 2 pg gel (upper panel, lanes 4, 5, 8 and 11). However, the agarose target RNA) is evidently detected by the PCR-bead capture- gel image in Figure 3 also illustrates of the presence of low flow cytometric method (Figure 2, lanes 3–10), without non- intensity, non-specific PCR bands of similar size in BCR-ABL- specific fluorescence in the negative controls (Figure 2, lanes positive post-therapy samples (eg upper panel, lanes 6, 7, 9 1 and 2). and 10) and negative control samples (upper panel, lanes 12– Subsequently, we applied this method to detect the t(9;22)- 14) alike. Post-PCR analysis is thus required to achieve assay associated BCR-ABL fusion characteristic of CML and a subset specificity for these samples. Southern blot hybridization of of pediatric and adult acute lymphoblastic leukemia (Ph1 the PCR products using junction-specific oligoprobes and ALL).11 This more complex translocation provided a relevant chemiluminescent detection confirms the presence and type basis for developing and testing the RT-PCR, fluorescent probe of BCR-ABL fusion mRNA in positive samples, with variable and flow cytometric analysis in a ‘multiplex’ format. Optimiz- probe hybridization intensities generally correlating with the ation of the PCR assay was accomplished using cell line level of amplified transcript in individual cases (Figure 3, sources producing the three BCR-ABL fusion mRNA types, middle panel, lanes 4–11). PCR-negative cases with weak spu- respectively. Primers to detect each of the three chimeric tran- rious agarose gel bands do not show specific chemiluminesc- scripts (B2 and E1 forward with A2 reverse, Table 1) were ent hybridization products (Figure 3, middle panel, lane 12). combined in one sample tube for multiplex ‘one-step’ RT- The fluorescent probe-bead capture-flow cytometric tech- PCR. Next, dual color (6-FAM and CY3 labeled) probe nique (Figure 3, lower panel, lanes 1 and 4–12) demonstrates hybridizations for B3-A2 and B2-A2 transcripts, respectively, complete concordance with the Southern blot hybridization were performed simultaneously in one reaction tube, while results. Furthermore, the relative fluorescence intensity of indi-

Leukemia PCR and flow cytometry to detect leukemic translocations Q-Y Zhang et al 147 Figure 3 Application of fluorescent PCR product-bead capture- flow cytometry technique for detection of the t(9;22)/BCR-ABL gene fusion in patient samples. Patient samples either positive or negative for the t(9;22)/BCR-ABL fusion occurring in chronic myeloid leukemia (CML) or Ph1 acute lymphoblastic leukemia (ALL) were analyzed by multiplex RT-PCR followed by either standard Southern blot detection, or the fluorescent probe/flow cytometric method. Upper panel shows standard agarose gel electrophoresis of PCR products. M is a size marker. Lane 1 is a negative control (no RNA). Lanes 2–4 rep- resent positive control cell lines BV173 (B2-A2 fusion), SUP-B15 (E1- A2 fusion) and K562 (B3-A2 fusion), respectively. Lanes 5–11 show patient samples positive for various BCR-ABL transcripts as follows: lane 5, diagnostic CML with B2-A2 fusion; lanes 6 and 7, CML post- therapy with B3-A2 fusions; lane 8, diagnostic ALL with E1-A2 fusion; lane 9, CML post-therapy with B3-A2 fusion; lane 10, CML post-therapy with B2-A2 fusion; lane 11, diagnostic CML with B3-A2 fusion. Lanes 12 to 14 are samples lacking the BCR-ABL fusion. The middle panel demonstrates individual chemiluminescent Southern blot hybridization results in representative cases using junction-specific probes recognizing the three most common BCR-ABL break-fusion types, to determine the specificity of the PCR bands. The relevant Southern blot bands were scanned from larger radiographic films and arranged in this panel as lanes corresponding to the agarose gel sample numbers. Lower panel images illustrate representative PCR samples analyzed by flow cytometry after specific fluorescent probe hybridization and capture on streptavidin-coated polystyrene beads. The lane designations correspond to the agarose gel and Southern blot sample numbers. Fluorescent probes detecting B3-A2 and E1-A2 fusions were labeled with 6-FAM (FL 1, x-axis), whereas the B2-A2 probe was labeled with CY3 (FL 2, y-axis). There is good correlation between strongly positive agarose gel bands and the corresponding results of both post-PCR Southern blot or fluorescent detection analy- vidual samples correlates well with the corresponding band ses among cell lines and diagnostic samples (all panels, lanes 4, 5, 8 and 11). Of note, however, the presence of weakly positive BCR-ABL intensities on both agarose gel and Southern blot, while sig- bands on the agarose gel in post-treatment samples (upper panel, nificant non-specific fluorescent signal is not observed in the lanes 6, 7, 9 and 10) can be difficult to distinguish from BCR-ABL- BCR-ABL negative cases (Figure 3, lower panel, lanes 1 and negative samples showing faint bands of similar size (upper panel, 12). As evidence to support the use of this novel method for lanes 12–14). Additional post-PCR analysis is thus required to delin- routine diagnosis and possibly for post-therapeutic monitoring eate these possibilities when transcript abundance is low. The fluor- of BCR-ABL-positive tumors, the flow cytometric results in Fig- escent probe flow cytometric method is both specific and sensitive, allowing recognition of true positive samples (ie lower panel, lanes ure 3 clearly demonstrate sufficient sensitivity for the identifi- 5–11), whereas samples lacking the BCR-ABL transcript are appropri- cation of relatively low abundance BCR-ABL transcripts in ately negative (ie lower panel, lane 12), in concordance with the such patient samples (ie lower panel, lanes 6, 7, 9 and 10). Southern blot data as shown. In addition, the relative hybridization To this end, using a non-multiplexed single primer set RT- intensities in the middle panel Southern blot images (indicating vari- PCR, we have determined the detection sensitivity for the B3- able transcript levels between samples) are comparably recapitulated A2 fusion transcript in cell line K562 to be approximately one by the fluorescence detection method (eg contrast lane 6 vs 7 in both middle and lower panel images). cell in 5 × 104 background cells with the fluorescent assay, even without the pre-hybridization spin column enhancement step(Figure 4). Notably however, the CY3-labeled B2-A2 olig- ein provides a rapid and robust alternative means to achieve oprobe exhibited a weaker overall fluorescence intensity in the same ends. Other investigators have described similar but diagnostic samples than the 6-FAM-labeled B3-A2 or E1-A2 non-identical uses of specialized beads to capture and ana- probes, using the fixed 488 nm laser excitation of the flow lyze PCR products or non-amplified nucleic acid targets.12–14 cytometer (Figure 3, lower panel, lane 5), indicating some However, these analogous procedures are characterized by inherent variability in the nature of the fluorochromes significantly more laborious or proprietary requirements for employed. Finally, all sample runs in this study were also the generation of labeled PCR products or the analytic beads. assessed for the presence of an internal control mRNA Unlike these other approaches, our methodology first simpli- (segment of the beta2-microglobulin or E2A gene product) by fies the chemical modifications of the oligonucleotide RT-PCR and agarose gel electrophoresis to confirm reverse reagents to allow synthesis in most university or commercial transcription fidelity and RNA integrity (data not shown). molecular laboratories. Additionally, the PCR, hybridization Many laboratories perform post-PCR isotopic or non-iso- and bead capture steps are straightforward and rapid, utilizing topic Southern blot oligoprobe hybridization to detect a spe- readily available and standardized components. In our hands, cific amplified target in a given PCR assay. Alternatively, the entire PCR and post-PCR detection procedure can be nested (two-round) PCR is another well-recognized technique accomplished in approximately 4 h following RNA isolation, for increasing both the sensitivity and specificity of target substantially faster than standard blot and probe methods. detection, as well as minimising unwanted aspecific amplifi- Alternative detection approaches, such as the use of streptavi- cation products. However, both of these approaches are din-coated well plates and a fluorescent plate reader, could characterized by additional laborious or time-consuming further extend the applicability of this general method to larger manipulations and, in the case of nested PCR, may be prone scale applications. to increased contamination risk, if thorough adherence to Of note, the hybridization probes employed in this study detail is not strictly followed. The methodology described her- were designed to span the unique fusion junction regions of

Leukemia PCR and ﬂow cytometry to detect leukemic translocations Q-Y Zhang et al 148

Figure 4 Detection sensitivity for B3-A2 type BCR-ABL fusion transcript using the fluorescent probe-bead capture methodology. K562 cell line cells harboring the B3-A2 type BCR-ABL fusion were diluted into donor buffy coat cells and RNA extracted. Single tube RT-PCR was carried out with B2 forward and A2 reverse primers (Table 1), followed by 6-FAM labeled B3-A2 probe hybridization, bead capture of the PCR product + probe complex, and flow cytometry. Sample 1, negative control (no RNA); sample 2, 100% K562; samples 3 to 6, K562:buffy coat dilutions of 1/102, 1/103, 1/104 and 1/5 × 104, respectively. A fluorescent signal is detected at 1/5 × 104 dilution and was not present below this level, although spin column purification to remove excess biotin-labeled primers prior to probe hybridization was not performed in this experiment. The addition of the latter step would be expected to increase the limit of specific detection somewhat further (see text).

the target chimeric mRNAs (cDNAs) and to maintain calcu- (MRD) setting. The technique we describe is based upon end- lated annealing temperatures above 60°C (using the 4[G+C] point PCR product detection, yet is sufficiently sensitive + 2[A+T] method). This typically resulted in a requirement for (particularly if post-PCR removal of excess biotinylated pri- probe lengths of 21–23 bases. Nonetheless, it should be mers is performed prior to fluorescent probe hybridization and emphasized that junctional probe design may have limitations bead attachment) to serve both for diagnostic purposes and imposed by the inherent nucleotide sequence available and possibly for screening of MRD samples. In the latter instance, some aspects of this process are therefore empirical. In our assay can potentially be used to direct individual patient addition, the general method described here has some restric- samples to more quantitative MRD evaluation techniques as tions imposed by the range of fluorophores currently available necessary. Comparison studies with real-time quantitative for use in oligonucleotide synthesis. As a corollary, certain PCR to evaluate this potential role may therefore be of value fluorescent dyes we have investigated may tend to relatively in this regard. weak fluorescence intensity (eg CY3), or conversely, higher background (eg CY5) in particular applications (personal observations). Rather than provide a rigorous platform for the References use of fluorescent detection of leukemic translocation PCR products, our data demonstrate ‘proof of concept’ and should 1 Hokland P, Pallisgaard N. Integration of molecular methods for stimulate continued optimization of this type of assay for more detection of balanced translocations in the diagnosis and follow- routine application. Undoubtedly, improvements in primer upof patientswith leukaemia. Semin Hematol 2000; 37: 358–367. and probe design, fluorophore choice and the availability of 2 Morgan GJ, Pratt G. Molecular diagnostics and the management dual laser fluorescent instrumentation should permit greater of haematological malignancies. Clin Lab Haematol 1998; 20: standardization of the approach presented in this study. 135–141. 3 Rubnitz JE, Pui CH. Molecular diagnostics in the treatment of leu- In conclusion, this novel analytic method is more rapid, kaemia. Curr Opin Hematol 1999; 6: 229–235. simple and cost effective as compared to traditional RT-PCR 4 Bartolo C, Viswanatha DS. Molecular diagnosis in pediatric acute with Southern blot hybridization for the detection of leuke- leukaemias. In: Crisan D (ed.). Clinics in Laboratory Medicine. WB mia-specific translocation gene fusions. This technique can Saunders: Philadelphia, 2000, pp 139–182. potentially be used in a multiplex format for rapid identifi- 5 Yin JAL, Tobal K. Detection of minimal residual disease in acute cation of prognostically important recurrent leukemic myeloid leukaemia: methodologies, clinical and biological sig- nificance. Br J Haematol 1999; 106: 578–590. translocations in pediatric ALL and adult or pediatric AML at 6 Foroni L, Harrison C, Hoffbrand AV, Potter MN. Investigation of diagnosis. Alternative fluorescent technologies now exist for minimal residual disease in childhood and adult acute lymphobl- rapid, ‘real-time’ quantitative analysis of specific PCR frag- astic leukaemia by molecular analysis. Br J Haematol 1999; 105: ments (eg ABI Prism 7700 Sequence Detection System 7–24. (‘TaqMan’), Foster City, CA, USA, or Roche LightCycler Sys- 7 Viswanatha DS. Detection of the t(15;17), t(8;21), and inv(16) tem, Indianapolis, IN, USA).15–17 Although such approaches abnormalities in acute myeloid leukaemias. In: Killeen A (ed.). Molecular Pathology Protocols. Humana Press: Totowa, NJ, 2000, currently remain relatively costly and are not suitable for rou- pp 115–146. tine diagnostic screening, these methods have become 8 Nourse J, Mellentin JD, Galili N, Wilkinson J, Stanbridge E, Smith increasingly well established in the minimal residual disease SD, Cleary ML. Chromosomal translocation t(1;19) results in syn-

Leukemia PCR and flow cytometry to detect leukemic translocations Q-Y Zhang et al 149 thesis of a homeobox fusion mRNA that codes for a potential 13 Spiro A, Lowe M, Brown D. A bead-based method for multiplexed chimeric transcription factor. Cell 1990; 60: 535–545. identification and quantitation of DNA sequences using flow cyto- 9 Hunger SP, Galili N, Carroll AJ, Crist WM, Link MP, Cleary ML. metry. Appl Environ Microbiol 2000; 66: 4258–4265. The t(1;19)(q23;p13) results in consistent fusion of E2A and PBX1 14 Yang G, Ulrich PP, Aiyer RA, Rawal BD, Vyas GN. Detection of coding sequences in acute lymphoblastic leukaemias. Blood hepatitis B virus in plasma using flow cytometric analyses of poly- 1991; 77: 687–693. merase chain reaction-amplified DNA incorporating digoxigenin- 10 Izraeli S, Kovar H, Gadner H, Lion T. Unexpected heterogeneity 11-dUTP. Blood 1993; 81: 1083–1088. in E2A/PBX1 fusion messenger RNA detected by the polymerase 15 Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative chain reaction in pediatric patients with acute lymphoblastic leu- PCR. Genome Res 1996; 6: 986–994. kaemia. Blood 1992; 80: 1413–1417. 16 Wittwer CT, Ririe KM, Andrew RV, David DA, Gundry RA, Balis 11 Chopra R, Pu QQ, Elefanty AG. Biology of BCR-ABL. Blood Rev UJ. The LightCycler. A microvolume multisample fluorimeter 1999; 13: 211–229. with rapid temperature control. BioTechniques 1997; 22: 12 Wedemeyer N, Gohde W, Potter T. Flow cytometric analysis of 176–181. reverse transcription-PCR products: quantification of p21 17 Wittwer CT, Hermann MG, Moss AA, Rasmussen RP. Continuous (WAF1/CIP1) and proliferating cell nuclear antigen mRNA. Clin fluorescence monitoring of rapid cycle DNA amplification. Chem 2000; 46: 1057–1064. BioTechniques 1997; 22: 130–131.

Leukemia