Differential homing mechanisms regulate regionalized effector CD8␣␤؉ T cell accumulation within the small intestine

Hanna Stenstad, Marcus Svensson, Helena Cucak, Knut Kotarsky, and William W. Agace*

Immunology Section, Lund University, BMC I-13, S-221 84 Lund, Sweden

Edited by Dan R. Littman, New York University Medical Center, New York, NY, and approved May 1, 2007 (received for review January 11, 2007) The CC chemokine receptor (CCR)9 is expressed on the majority of relatively normal numbers of small intestinal CD8␣␤ϩ and CD4ϩ small intestinal, but few colonic, T cells, whereas its ligand CCL25 is T cells (12–14). Furthermore, antibodies to CCR9 and CCL25 constitutively expressed by small intestinal epithelial cells. As such, only partially ameliorate early but note late chronic murine ileitis CCR9/CCL25 have been proposed to play a central role in regulating (15). Thus, a clearer understanding of the relative roles of small intestinal but not colonic immune responses and thus to orga- CCR9-dependent and independent T cell entry to and localiza- nize regionalized immunity within the intestinal mucosa. Here, we tion within the intestinal mucosa is warranted. demonstrate that CCL25 is expressed at reduced levels by epithelial In the current study, we have determined the role of CCR9- ϩ cells in the distal compared with proximal small intestine, which dependent and independent effector CD8␣␤ T cell localization correlated with less efficient CCR9-dependent effector CD8␣␤؉ T cell to the intestinal mucosa. Our findings demonstrate significant ؉ entry into the ileal epithelium. In vitro-generated ␣4␤7 effector differences in T cell localization mechanisms both within and CD8␣␤؉ T cell entry into the lamina propria was less dependent on along the entire length of the small intestine highlighting for the CCR9 than entry into the epithelium along the entire length of the first time compartmentalized recruitment mechanisms within .؉ the small intestine small intestine and in particular in the ileum. CCR9-independent ␣4␤7 ؉␤␣ effector CD8 T cell entry was pertussis toxin-sensitive, suggesting Results and Discussion a role for additional G␣I-linked G protein-coupled receptors. Finally, in vivo-primed effector CD8␣␤؉ T cells displayed regionalized differ- Intestinal Epithelial CCL25 Expression Decreases from the Proximal to Distal Portion of the Small Intestine. ences in their entry to the small intestinal epithelium with enhanced To examine potential differ- ences in CCL25 expression in the proximal and distal small intes- CCR9-independent entry to the ileum. These results highlight a tine, epithelial cells were removed from the duodenum, jejunum, hitherto underappreciated compartmentalization of immune re- ileum, and colon with EDTA and the levels of CCL25 mRNA sponses within the small intestine and have direct implications for assessed by real-time RT-PCR. CCL25 mRNA was detected in targeting strategies aimed at regulating T cell localization to the small small intestinal epithelial cells, but not in colonic epithelial cells, or intestinal mucosa. colonic or small intestinal lamina propria (LP) (Fig. 1A), consistent with previous results (16). Notably however, epithelial CCL25 chemokine receptor ͉ intestinal mucosa mRNA levels were significantly reduced in the distal compared with the proximal small intestine (Fig. 1A). To rule out the possibility he intestinal mucosa, including the intestinal epithelium and that nonepithelial cells in the EDTA preparations influenced Tunderlying LP, contains a large number of antigen- CCL25 mRNA measurements, epithelial cells were dissected from experienced T cells that play a central role in regulating local intestinal sections by laser capture microscopy (Fig. 1B). Similar to adaptive immune responses and contribute to disease pathology epithelium from EDTA preparations, epithelial cells prepared from in inflammatory bowel diseases, such as Crohn’s disease and the distal small intestine by laser capture microscopy expressed ulcerative colitis. lower levels of CCL25 mRNA than epithelial cells taken from the Effector T cell entry into the intestinal mucosa is a complex proximal small intestine (Fig. 1B). The reduction in CCL25 mRNA event regulated by selective expression of intestinal homing in the ileum compared with the jejunum correlated with reduced receptors on the T cell surface and corresponding ligands within levels of CCL25 protein (Fig. 1C). CCL25 protein levels in the duodenum varied considerably between animals (n ϭ 5; 6,270, the intestinal mucosa. The intestinal homing receptors, ␣4␤7 and CCR9, are selectively induced on T cells primed in mesenteric 1,120, 8,610, 2,040, and 1,347 pg/mg protein), for reasons that we lymph nodes (MLN) and Peyer’s patches (1–4). Interactions currently do not understand. between the integrin ␣4␤7 on circulating effector T cells and its ligand mucosal addressin cell adhesion molecule-1 on intestinal Reduced CCR9-Dependent T Cell Accumulation in the Distal Small Intestine. To determine whether T cells that enter the epithelium microvascular endothelial cells are important for efficient ϩ by a CCR9-dependent mechanism accumulate less in the distal CD8␣␤ effector T cell entry to both the small intestine and colon (5). In contrast, the CCR9 ligand, CCL25, is selectively

expressed in the small intestine but not the colon (6–8), indi- Author contributions: H.S., M.S., and W.W.A. designed research; H.S., M.S., H.C., and K.K. cating a selective role in regulating small intestinal immunity. performed research; H.S., M.S., K.K., and W.W.A. analyzed data; and H.S. and W.W.A. wrote Consistent with this hypothesis, TCR transgenic T cell adoptive the paper. transfer studies using neutralizing antibodies to CCL25 or The authors declare no conflict of interest. Ϫ/Ϫ CCR9 T cells have demonstrated a role for CCL25/CCR9 in This article is a PNAS Direct Submission. ϩ ϩ mediating CD4 and CD8 effector T cell localization to the Abbreviations: CCR, CC chemokine receptor; IEL, intraepithelial lymphocyte; LP, lamina small intestinal mucosa (1, 4, 9). Selective expression of CCL25 propria; MLN, mesenteric lymph node; OVA, ovalbumin; PTX, pertussis toxin. in the small intestine is maintained in patients with small bowel *To whom correspondence should be addressed. E-mail: [email protected]. Crohn’s disease (10), suggesting a potential role for this chemo- †Keshav, S., Wolf, D., Katz, S., Pruitt, R., Souder, R., Barish, C., Eyring, E., Goff, J., Hansen, R., kine in inflammatory bowel disease, and a small molecular Hommes, D., et al. (2006) Gut Vol. 55 (Suppl. V), p. A 22 (abstr.). weight CCR9 antagonist, Traficet-ENTM, has shown evidence This article contains supporting information online at www.pnas.org/cgi/content/full/ of clinical benefit in a preliminary phase II trial in Crohn’s 0700269104/DC1. Ϫ Ϫ disease patients.† Despite these findings, CCR9 / mice have © 2007 by The National Academy of Sciences of the USA

10122–10127 ͉ PNAS ͉ June 12, 2007 ͉ vol. 104 ͉ no. 24 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0700269104 Downloaded by guest on September 25, 2021 Fig. 1. Intestinal epithelial CCL25 expression decreases from the proximal to the distal part of the small intestine. Total RNA was extracted from epithelial cells isolated by consecutive EDTA treatments (A) or laser capture microscopy (B), and CCL25 mRNA levels were quantified by real-time RT-PCR. (A) Mean (SEM) of three (LP) or five (epithelial cells) experiments. (B) Mean (SEM) shown from two separate experiments. Levels of CCL25 mRNA in the intestinal LP and colon were similar to that found in negative control tissues (lung and liver). (C) CCL25 protein levels were determined by sandwich ELISA. Mean (SEM) from five (intestine) and two (spleen) individual mice. *, P Ͻ 0.05, calculated by using two-tailed paired Student’s t test.

compared with the proximal small intestinal epithelium, WT compare the efficiency of OT-I cell accumulation to the different (Ly5.2ϩLy5.1ϩ) and CCR9Ϫ/Ϫ (Ly5.2ϩ) OT-I cells were stimu- epithelial compartments, we determined the percentage of WT lated in vitro with ovalbumin (OVA) peptide-pulsed splenic OT-I cells within the CD8␣␤ϩ IEL compartment. Results from dendritic cells (DCs) in the presence of retinoic acid [that this analysis demonstrated that the accumulation of WT OT-I induces expression of CCR9 and ␣4␤7 (17)]. These stimulatory cells in the ileal IEL compartment was lower than that of the conditions generated homogenous populations of effector jejunum and duodenum (Fig. 2E). Thus, under conditions of ϩ ϩ ϩ Ϫ/Ϫ CCR9 ␣4␤7 WT and ␣4␤7 CCR9 OT-I cells (Fig. 2A) that CCR9-dependent effector T cell entry, reduced expression of were subsequently coinjected into recipient mice. Analysis of the CCL25 in the ileal epithelium correlates with reduced effector CCR9Ϫ/Ϫ:WT OT-I ratio 12 and 24 h after injection demon- T cell accumulation at this site. ϩ Ϫ/Ϫ strated that ␣4␤7 CCR9 OT-I cells were dramatically dis- advantaged in their ability to enter the epithelium along the CD8␣␤؉ T Cell Recruitment to the Small Intestinal LP Depends Less on entire length of the small intestine compared with their WT CCR9 Than Entry to the Epithelium. Studies have demonstrated a role counterparts (Fig. 2 B and C and data not shown). In contrast, for CCR9 in effector CD4ϩ T cell and IgA B cell recruitment to the CCR9Ϫ/Ϫ and WT OT-I cells were detected at equal frequencies small intestinal LP (9, 18, 19), suggesting that CCR9 functions in the in secondary lymphoid organs and the liver (Fig. 2C). Endoge- initial recruitment of lymphocytes from the vasculature. Consistent nous CD8␣␤ϩ intraepithelial lymphocyte (IEL) were evenly with this hypothesis, CCL25 protein is detected on microvascular distributed along the length of the small intestine (Fig. 2D). To endothelium in the small intestine (19–21) and neutralizing anti- IMMUNOLOGY

Fig. 2. Effector CD8␣␤ϩ T cells displaying CCR9-dependent entry into the small intestinal epithelium accumulate less efficiently in the ileal epithelium. In vitro-generated CCR9Ϫ/Ϫ and WT effector OT-I cells were injected i.v. into C57BL/6.Ly5.1 recipient mice and the ratio of CCR9Ϫ/Ϫ to WT OT-I cells in different tissues determined 24 h later. (A) Representative flow cytometry plots showing CCR9 and ␣4␤7 expression on in vitro-generated effector OT-I cells. (B) Representative flow cytometry plots showing CCR9 and WT OT-I cells in the MLN and duodenal, jejunal, and ileal epithelium. (C) CCR9Ϫ/Ϫ:WT OT-I ratio in the different organs. Mean (SEM) from three experiments, using three individual mice per experiment for spleen, liver, PLN, and MLN and three pooled mice for duodenal (duo), jejunal (jej), and ileal epithelium. (D) Percentage of endogenous CD8␣␤ϩ T cells among CD45ϩIEL in the duodenal (duo), jejunal (jej), and ileal epithelium. Numbers represent mean (SEM) from three experiments using three individual mice per experiment. (E) Percentage of WT OT-I cells within the CD8␣␤ϩ IEL gate normalized to duodenal values. Mean (SEM) of three experiments, using three pooled mice per experiment.

Stenstad et al. PNAS ͉ June 12, 2007 ͉ vol. 104 ͉ no. 24 ͉ 10123 Downloaded by guest on September 25, 2021 Fig. 3. CD8␣␤ϩ T cell recruitment to the small intestinal LP is less dependent on CCR9 than their recruitment to the small intestinal epithelium. In vitro- generated CCR9Ϫ/Ϫ and WT effector OT-I cells were coinjected i.v. into C57BL/ Ϫ/Ϫ 6.Ly5.1 mice and the CCR9 :WT OT-I ratio determined 24 h later in the MLN Fig. 4. CCR9-independent migration of effector CD8␣␤ϩ cells to the small and small intestinal LP and epithelium. (A) Representative flow cytometry intestinal LP is pertussis toxin sensitive. PTX-treated or untreated in vitro- Ϫ/Ϫ plots of CCR9 and WT OT-I cells in the MLN and intestine gating on live ϩ Ϫ/Ϫ generated ␣4␤7 CCR9 effector OT-I cells were injected into C57BL/6.Ly5.1 ␤ϩ Ϫ/Ϫ CD8 cells. (B) CCR9 :WT OT-I ratio in MLN, the small intestinal LP, and recipients and the proportion of cells within the indicated tissues determined epithelium. (C) MLN and intestinal LP segments. Mean (SEM) from four (B) and 24 h later. (A) Representative flow cytometry plots showing donor cells in the three (C) experiments, using three individual mice per experiment for MLN recipient LP, gating on total live cells. (B) The percentage of injected PTX- samples and three pooled mice per experiment for the intestinal LP and treated or untreated CCR9Ϫ/Ϫ OT-I cells among total CD8␤ϩ cells in the spleen, Ͻ epithelial samples. *, P 0.05, calculated by using paired two-tailed Student’s MLN, and small intestinal LP. Mean (SEM) of seven and six mice receiving t test. PTX-treated or untreated OT-I cells, respectively, pooled from three separate experiments. ***, P Ͻ 0.001, calculated by using unpaired two-tailed Student’s t test. n.s., not significant. bodies to CCL25 reduced adhesion of adoptively transferred intes- tinal lamina propria lymphocytes and IEL to small intestinal post ϩ ϩ capillary venules (21). To determine whether in vitro-generated requirements for in vitro-generated ␣4␤7 effector CD8 T cell effector OT-I cell entry to the small intestinal LP was similarly entry along the small intestine remain to be determined, one Ϫ Ϫ CCR9-dependent, the CCR9 / :WT OT-I ratio was compared in potential explanation for our findings is that microvascular endo- the intestinal LP and epithelium. OT-I effector cells displayed less thelial cells in the distal small intestine express higher levels of CCR9-dependent entry to the intestinal LP compared with the G␣i-coupled receptor ligands that promote CCR9-independent intestinal epithelium (Fig. 3 A and B) along the entire length of the entry. We have demonstrated that LP preparations containing small intestine (compare LP ratio in Fig. 3C with the epithelial ratio microvascular endothelial cells do not contain CCL25 mRNA (16). in Fig. 2C). Furthermore, OT-I cell entry into the ileal LP was less Thus, an additional nonexclusive possibility is that the lower levels dependent on CCR9 than entry into the jejunal and duodenal LP of epithelial-derived CCL25 in the distal small intestine result in less (Fig. 3C). efficient CCL25 presentation by vascular endothelial cells at this ؉ site. Of note, in contrast to previous reports (19–21), we were␤␣ CCR9 Independent Effector CD8 T Cell Entry to the Small Intestinal unable to detect CCL25 protein on small intestinal vascular endo- Mucosa Is Pertussis Toxin Sensitive. To determine whether CCR9- thelium, presumably because CCL25 levels were below the detec- independent effector CD8␣␤ϩ T cell migration to the small intes- tion limit of our assays. tinal LP involves alternative G␣i protein-coupled receptors, in vitro-generated ␣ ␤ ϩ CCR9Ϫ/Ϫ effector OT-I cells were pretreated 4 7 CCR9-Dependent and Independent Entry of in Vivo-Primed Effector with pertussis toxin (PTX) and injected into recipient animals (Fig. ؉ Ϫ/Ϫ CD8␣␤ T Cells to Small Intestinal Epithelium. Seventy-five to 90% 4 A and B). PTX-treated and untreated CCR9 OT-I cells were ϩ equally capable of entering the spleen (Fig. 4B), demonstrating that of endogenous duodenal, jejunal and ileal CD8 IEL expressed PTX-treatment had no detrimental effect on the in vivo survival of CCR9 and a proportion of these isolated IEL responded to these cells. In marked contrast, PTX-treatment inhibited CCR9Ϫ/Ϫ CCL25 in chemotaxis assays [supporting information (SI) Fig. 7 OT-I cell entry into MLN and the small intestinal LP (Fig. 4 A and A and B]. Nevertheless, the relative importance of CCR9- ␣␤ϩ B). Thus, CCR9-independent T cell entry into the small intestinal dependent versus CCR9-independent effector CD8 T cell localization to these distinct intestinal epithelial compartments LP is an active mechanism involving G␣i-coupled receptors. ␣ ␤ ϩ after in vivo priming is currently unclear. To address this Together, these results demonstrate that in vitro-generated 4 7 Ϫ Ϫ effector CD8␣␤ϩ T cells can use CCR9-dependent and CCR9 question, CCR9 / and WT OT-I cells were injected i.v. at an independent G␣i-coupled receptor-dependent mechanisms to gain equal ratio into recipient mice that were subsequently immu- entry into the small intestinal LP, and that the latter pathway nized i.p. or orally with OVA and adjuvant. Three days after Ϫ Ϫ appears particularly relevant in the distal small intestine. Moreover, immunization the ratio of CCR9 / :WT OT-I cells was assessed they provide strong evidence that epithelial derived CCL25 plays an in the MLN and intestinal segments. Although both immuniza- ϩ ϩ ϩ ϩ␣ ␤ ϩ additional role in the recruitment of CCR9 ␣4␤7 CD8 T cells tion regimes induce efficient generation of CCR9 4 7 effec- from the LP into the epithelium along the entire length of the small tor OT-I cells in the MLN (1, 22), oral antigen administration is intestine. Although the mechanism(s) regulating the regionalized likely to preferentially target intestinal DC populations and OT-I

10124 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0700269104 Stenstad et al. Downloaded by guest on September 25, 2021 Fig. 5. CCR9-dependent and -independent OT-I cell localization to the small intestinal epithelium after i.p immunization. CCR9Ϫ/Ϫ and WT OT-I cells were coinjected into C57BL/6.Ly5.1 mice, and their relative efficiency in entering epithelial sites along the intestine determined 3 days after immunization with OVA and LPS i.p (A–C). (A) Representative flow cytometry plots used to determine the ratio of CCR9Ϫ/Ϫ to WT OT-I cells in individual tissues gating on live CD8␤ϩ cells. Numbers represent CCR9Ϫ/Ϫ:WT OT-I ratios for the respective plots. (B) CCR9Ϫ/Ϫ:WT OT-I ratio in different intestinal segments. Mean (SD) of four separate experiments, using three or four individual mice per experiment and pooled colonic tissues from three individual mice per experiment. (C) CCR9Ϫ/Ϫ:WT OT-I cell ratio in intestinal segments from individual mice. **, P Ͻ 0.01 and ***, P Ͻ 0.001, calculated by using paired two-tailed Student’s t test. (D) Percentage of in ϩ vivo-activated WT OT-I cells within the CD8␤ IEL gate normalized to duodenal values. Mean (SEM) of eight mice from three separate experiments. *, P Ͻ 0.05, calculated by using two-tailed paired Student’s t test.

cell priming in the MLN after oral immunization requires CCR9Ϫ/Ϫ 93.9% (SEM ϭ 1.4), n ϭ 6], CXCR6 [WT 85.6% CCR7-dependent DC migration from the intestinal LP into the (SEM ϭ 8.7); CCR9Ϫ/Ϫ 80.7% (SEM ϭ 9.3), n ϭ 4], CCR6 [WT MLN (22). I.p. immunization, on the other hand, results in 32% (SEM ϭ 13.4); CCR9Ϫ/Ϫ 20% (SEM ϭ 9.2), n ϭ 4], and simultaneous OT-I priming in multiple secondary lymphoid CCR2 [WT 5.5% (SEM ϭ 2.6); CCR9Ϫ/Ϫ 3.9% (SEM ϭ 3.9), organs, and priming in the MLN can occur independently of n ϭ 2], indicating that CCR9 deficiency did not result in CCR7 (22). After i.p. immunization, the CCR9Ϫ/Ϫ:WT OT-I compensatory induction of these receptors. Together, these IMMUNOLOGY ratio in the MLN was similar to that of the input population (data results demonstrate that CCR9-independent entry mechanisms not shown), consistent with results in ref. 1. Furthermore, the can play an important role in directing effector CD8ϩ T cells to CCR9Ϫ/Ϫ:WT OT-I ratio in the cecal and colonic epithelium was the ileal epithelium and suggest that the recruitment mechanism similar to that observed in the MLN, demonstrating that CCR9 mediating this CCR9-independent ileal epithelial localization does not play a role in effector CD8␣␤ϩ T cell migration to these may not be well recapitulated by our in vitro induction protocol. sites (Fig. 5 A and B). As observed with in vitro-generated gut In contrast to the i.p immunization regime, oral immunization tropic OT-I cells, CCR9Ϫ/Ϫ OT-I cells were heavily disadvan- resulted in more pronounced CCR9-dependent OT-I cell mi- taged in their ability to enter the duodenal epithelium compared gration to the jejunal and ileal epithelium (Fig. 6A). Further- with WT OT-I cells (Fig. 5 A–C). However, the importance of more, under these conditions, WT OT-I cells localized less CCR9 for OT-I cell localization to the small intestinal epithelium efficiently to the ileal than the jejunal epithelium (Fig. 6B), displayed marked regional differences. Thus, OT-I cell entry to similar to the in vitro-generated WT effector OT-I cells. Despite the jejunum was less dependent on CCR9 than entry into the enhanced CCR9-dependent migration to the ileum, OT-I cell duodenum and entry to the ileum was less dependent on CCR9 entry to the ileal epithelium remained significantly less depen- compared with the jejunum (Fig. 5 A–C). In contrast to in dent on CCR9 compared with their localization to the jejunal vitro-generated effector WT OT-I cell migration to the small epithelium (Fig. 6C). intestinal epithelium (Fig. 2E), effector WT OT-I cells gener- In summary, our results highlight that effector CD8ϩ T cells ated after i.p immunization localized more efficiently to the ileal may use both CCR9-dependent and independent mechanisms to compared with the jejunal and duodenal epithelium (Fig. 5D). localize within the small intestinal mucosa and that the degree The majority of WT OT-I cells entering the ileal epithelium after of CCR9-independent entry depends in part on the site within Ϫ/Ϫ i.p immunization expressed CCR9 and ␣4␤7, whereas CCR9 (LP versus epithelium) or along (proximal versus distal) the OT-I cells expressed ␣4␤7 (SI Fig. 8) suggesting that these cells small intestine, as well as the conditions under which T cell had been primed in intestinal LN. Furthermore, WT and priming takes place. Further studies will be required to deter- CCR9Ϫ/Ϫ OT-I cells that entered the intestinal epithelium mine the molecular mechanisms regulating CCR9 dependent/ expressed similar levels of CXCR3 [WT 92.8% (SEM ϭ 3.4); independent localization to the small intestine and in particular

Stenstad et al. PNAS ͉ June 12, 2007 ͉ vol. 104 ͉ no. 24 ͉ 10125 Downloaded by guest on September 25, 2021 Fig. 6. CCR9-dependent and independent OT-I cell localization to the small intestinal epithelium after oral immunization. CCR9Ϫ/Ϫ and WT OT-I cells were coinjected into C57BL/6.Ly5.1 mice and their relative efficiency in entering epithelial sites along the intestine determined 3 days after oral immunization with OVA and cholera toxin. (A) CCR9Ϫ/Ϫ:WT OT-I ratio in different intestinal segments. Mean (SEM) of two experiments, using six or seven individual mice. (B) Percentage of in vivo-activated WT OT-I cells within the CD8␤ϩ IEL gate normalized to duodenal values. Mean (SEM) of six or seven individual mice from two separate experiments. (C) CCR9Ϫ/Ϫ:WT OT-I cell ratio in intestinal segments from individual mice. *, P Ͻ 0.05 and **, P Ͻ 0.01, calculated by using two-tailed paired Student’s t test. n.s. not significant.

the role of antigen administration route/antigen dose and the before the cecum (24). Lymphocytes were isolated from the influence of inflammatory mediators in this process. lymph nodes, spleen, liver, intestinal epithelium, and LP of the small intestine, cecum, and colon as described in ref. 4. For Conclusion real-time PCR analysis, intestinal tissue pieces were dissected CCR9 and its ligand CCL25 have been demonstrated to play a role and inverted before epithelial cell isolation with six treatments in effector T cell localization to the small intestinal mucosa (4), and of HBSS supplemented with 10% FCS, 10 mM Hepes, 100 are potential therapeutic targets for small bowel Crohn’s disease (†, units/ml penicillin, 100 ␮g/ml streptamycin, 20 ␮g/ml gentamycin 23). Nevertheless, CCR9Ϫ/Ϫ mice display relatively normal numbers (all from Gibco, Paisely, U.K.), and 30 mM EDTA for 20 min of small intestinal CD4ϩ and CD8␣␤ϩ T cells (13, 14, 18), indicating each. Remaining LP was scraped with tweezers to remove that effector T cells may use CCR9-independent mechanisms of remaining epithelial cells and washed in HBSS extensively. entry to the small intestine. In the current study, we demonstrate Purity of LP fractions was verified by running real-time PCR important regionalized differences in the role of CCR9 in effector analysis for intestinal alkaline phosphatase as a marker of CD8␣␤ϩ T cell entry to the small intestinal mucosa, both along the contaminating epithelial cells. length of the intestine mucosa and between the LP and epithelium, and that CCR9-independent entry is an active mechanism involving Laser Capture Microscopy and Real-Time PCR. Laser capture of alternative G␣i-coupled receptors. These findings demonstrate a intestinal epithelium was performed exactly as described in ref. 16 remarkable compartmentalization of intestinal adaptive immune on a Zeiss (Thornwood, NY) microscope equipped with a micro- responses within the small intestine and suggest in particular that catapulting laser system (P.A.L.M. Microlaser Technologies, Bern- CCR9-independent entry mechanisms should be taken into ac- ried, Germany) according to manufacturers instructions. Briefly, count when attempting to regulate adaptive immune responses, Tissue-Tek O.C.T. embedded intestinal tissue sections (10-␮m) particularly in the distal small intestine. were placed on PEN-membrane coated slides (P.A.L.M. Microlaser Technologies) and fixed in 70% ethanol for 30 s and acetone for 4 Materials and Methods min. Fixed sections were stained with Harris haematoxylin for 10 s Mice. OT-I and C57BL/6.Ly5.1 mice were from The Jackson (Sigma–Aldrich, Steinheim, Germany), washed, overlaid with 10% Laboratory (Bar Harbor, ME), C57BL/6 mice were from Taconic DMSO, and placed on dry ice or kept at Ϫ80°C until use. All (Lille Skensved, Denmark), and CCR9Ϫ/Ϫ OT-I and Ly5.1ϩLy5.2ϩ aqueous solutions were made from DEPC-treated water and sup- WT OT-I mice were generated as described in ref. 1. All mice were plemented with VRC RNase Inhibitor (Sigma–Aldrich). Cells with bred and maintained at the BMC animal facility of Lund University. lymphocyte morphology were destroyed with the laser before Animal experiments were approved by the local ethical review capture. Total RNA was extracted from the catapulted samples, board at Lund University. using Stratagene Microprep RNA kit (Stratagene, Stockholm, Sweden) and translated into cDNA using SuperScript II (Invitro- Isolation of Epithelial Cells and Intestinal T Cell Populations. Intesti- gen, Stockholm, Sweden). A first PCR was performed with outer nal tissues were divided into duodenum, jejunum, ileum, cecum, primers for 12 cycles (11) before quantification with real-time PCR, and colon. Duodenum was defined as the first 3-cm section after using SYBR-green (Stratagene) and a Roche (Pentzberg, Ger- the pylorus, the jejunum as the following proximal part of the many) LightCycler as described in ref. 16. The following primers small intestine, and ileum as the distal 5 cm of the small intestine were used: CCL25 outer forward 5ЈATAGGCAATACACGCTA-

10126 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0700269104 Stenstad et al. Downloaded by guest on September 25, 2021 CAAGC 3Ј, CCL25 outer reverse 5ЈGCGGAATTCTTTGATC- were incubated with 200 ng/ml PTX (Sigma–Aldrich) at 37°C for CTGTGCTGGTAACCCAGG 3Ј, CCL25 inner forward 5ЈAG- 2 h in RPMI medium 1640 containing 5% FCS and 25 mM Hepes GCACCAGCTCTCAGGACC 3Ј, CCL25 inner reverse (untreated cells were kept under the same, but PTX-free, condi- 5ЈGCGGAATTCGTCTTCAAAGGCACCTTGGGCATGG3Ј, tions). Cells were washed with PBS, and 8–10 ϫ 106 PTX-treated ␤-actin outer forward 5ЈCCGGGACCTGACAGACTA 3Ј, ␤-actin or untreated cells were injected into C57BL/6.Ly5.1 recipient mice. outer reverse 5ЈACGGATGTCAACGTCACACTTC 3Ј, ␤-actin Twenty-four hours later, the mice were killed, and the ratio of inner forward 5ЈGAGAGGGAAATCGTGCGTGACA 3Ј, and injected cells to endogenous CD8␤ϩ cells was determined in the ␤-actin inner reverse 5ЈGTTTCATGGATGCCACAGGAT 3Ј. spleen, MLN, and intestinal LP by flow cytometry. To increase the Quantitative real-time PCR of EDTA isolated epithelial cells was lymphocyte yield, intestinal LP lymphocytes were here isolated performed as described above without the outer primer PCR step. without percoll density centrifugation.

Intestinal Protein Extraction and ELISA for CCL25. Intestinal tissues In Vivo Priming Model. Splenic CD8bϩ T cells were purified from were washed in PBS, snap frozen in liquid nitrogen and homoge- CCR9Ϫ/Ϫ (Ly5.2ϩ) and WT (Ly5.1ϩLy5.2ϩ) OT-I mice by magnetic nized in T-PER tissue protein extraction buffer (Pierce Biotech- cell sorting and coinjected (3–5 ϫ 106 of CCR9Ϫ/Ϫ and WT cells) nology, Rockford, IL) supplemented with complete protease in- i.v. into C57BL/6.Ly5.1 recipients. Recipient mice were immunized hibitor mixture (Roche Diagnostics). Lysates were removed after i.p with OVA (5 mg, grade VI, Sigma–Aldrich) and LPS (100 ␮g, centrifugation for 10 min at 10,000 rpm [Sorvall Instruments Escherichia coli, serotype 055:B5; Sigma–Aldrich) or orally with (Newton, CT) RC5C centrifuge; GSA-rotor], and total protein OVA (50 mg, grade VI, Sigma–Aldrich) and cholera toxin (10 ␮g, levels and CCL25 levels determined by using a Quick Start Brad- Sigma–Aldrich), killed 3 days later and the ratio of CCR9Ϫ/Ϫ:WT ford kit (Bio-Rad, Hercules, CA) and a CCL25 sandwich ELISA OT-I cells in the MLN and intestinal tissue determined by flow (R&D Systems, Minneapolis, MN), respectively. cytometry.

؉ ؉ ϩ In Vitro-Generation of CCR9 ␣4␤7 OT-I Cells. CD8␤ T cells and Antibodies and Flow Cytometry. Flow cytometry analysis was DCs were purified from the spleens of CCR9Ϫ/Ϫ and WT OT-I performed as described in ref. 9, using the following antibodies mice and C57BL/6 mice, respectively, by magnetic cell sorting and reagents: anti-Ly5.1 (A20), anti-Ly5.2 (104), anti-CD8␤ (Miltenyi Biotech, Bergisch Gladbach, Germany), using biotin- (53-5.8), anti-CD4 (L3T4), anti-␣4␤7 (DATK32), biotinylated ylated anti-CD8␤ antibody followed by streptavidin-conjugated mouse-anti-rat IgG2b (G15-337) (BD PharMingen, San Diego, magnetic beads (purity Ͼ98%) or anti-CD11c magnetic beads for CA); anti-CCR9 [7E71 (12)]; streptavidin-APC (Nordic BioSite, DC isolation. Splenic DCs were pulsed with OVA257–264 SIINFEKL Ta¨by, Sweden); 7-amino-actinomycin D (7AAD) (Sigma– peptide (200 pM; Innovagen, Lund, Sweden), washed, and incu- Aldrich), and anti-FcRII/III (2.4G2) (American Type Culture bated with OT-I cells in RPMI-c (RPMI medium 1640 supple- Collection, Rockville, MD). mented with 10% FCS, 10 mM Hepes, 1 mM Na-puryvate, 50 ␮M 2-mercaptoethanol, 100 units/ml penicillin, 100 ␮g/ml streptamycin, We thank Ann-Charlotte Selberg for valuable technical assistance, Dr. 20 ␮g/ml gentamycin) and 10 nM retinoic acid (Sigma–Aldrich). Oliver Pabst (Institute of Immunology, Hannover Medical School, After 3.5 days of coculture, cells were transferred into 24-well tissue Hannover, Germany) for providing the anti-CCR9 antibody, and Drs. M-A. Wurbel and B. Malissen (Centre d’Immunologie de Marseille- culture plates (Corning, Corning, NY) and allowed to expand in Ϫ/Ϫ RPMI-c supplemented with 10 ng/ml IL-7 and 10 ng/ml IL-15 (both Luminy, Marseille, France) for providing CCR9 mice. This work was Ϫ/Ϫ supported by a Swegene post doctoral fellowship (to K.K.) and grants from R&D Systems) for an additional 2.5 days. CCR9 and WT from the Swedish Medical Research Council, the Crafoordska, O¨ ster- ϫ 6 OT-I cells (8–10 10 cells of each) were injected i.v. into lund, Åke Wiberg, Nanna Svartz, and Kocks Foundations, the Royal Ϫ/Ϫ C57BL/6.Ly5.1 recipient mice and the CCR9 :WT OT-I cell ratio Physiographic Society, the Swedish Medical Society, the Swedish Foun- in intestinal tissues determined 24 h later by flow cytometry. For dation for Strategic Research INGVAR II and ‘‘Microbes and Man’’ PTX-treatment experiments, in vitro cultured CCR9Ϫ/Ϫ OT-I cells programs, and the Wellcome Trust Grant 075571/Z/04/Z. IMMUNOLOGY 1. Johansson-Lindbom B, Svensson M, Wurbel MA, Malissen B, Marquez G, 13. Wurbel MA, Malissen M, Guy-Grand D, Meffre E, Nussenzweig MC, Rich- Agace W (2003) J Exp Med 198:963–969. elme M, Carrier A, Malissen B (2001) Blood 98:2626–2632. 2. Mora JR, Bono MR, Manjunath N, Weninger W, Cavanagh LL, Rosemblatt 14. Uehara S, Grinberg A, Farber JM, Love PE (2002) J Immunol 168:2811– M, Von Andrian UH (2003) Nature 424:88–93. 2819. 3. Campbell DJ, Butcher EC (2002) J Exp Med 195:135–141. 15. Rivera-Nieves J, Ho J, Bamias G, Ivashkina N, Ley K, Oppermann M, 4. Svensson M, Marsal J, Ericsson A, Carramolino L, Broden T, Marquez G, Cominelli F (2006) Gastroenterology 131:1518–1529. Agace WW (2002) J Clin Invest 110:1113–1121. 16. Ericsson A, Kotarsky K, Svensson M, Sigvardsson M, Agace W (2006) 5. Lefrancois L, Parker CM, Olson S, Muller W, Wagner N, Schon MP, J Immunol 176:3642–3651. Puddington L (1999) J Exp Med 189:1631–1638. 17. Iwata M, Hirakiyama A, Eshima Y, Kagechika H, Kato C, Song SY (2004) 6. Wurbel MA, Philippe JM, Nguyen C, Victorero G, Freeman T, Wooding P, Immunity 21:527–538. Miazek A, Mattei MG, Malissen M, Jordan BR, et al. (2000) Eur J Immunol 18. Pabst O, Ohl L, Wendland M, Wurbel MA, Kremmer E, Malissen B, Forster 30:262–271. R (2004) J Exp Med 199:411–416. 7. Kunkel EJ, Campbell JJ, Haraldsen G, Pan J, Boisvert J, Roberts AI, Ebert EC, 19. Hieshima K, Kawasaki Y, Hanamoto H, Nakayama T, Nagakubo D, Kanamaru Vierra MA, Goodman SB, Genovese MC, et al. (2000) J Exp Med 192:761–768. A, Yoshie O (2004) J Immunol 173:3668–3675. 8. Papadakis KA, Prehn J, Nelson V, Cheng L, Binder SW, Ponath PD, Andrew 20. Papadakis KA, Prehn J, Nelson V, Cheng L, Binder SW, Ponath PD, Andrew DP, Targan SR (2000) J Immunol 165:5069–5076. 9. Stenstad H, Ericsson A, Johansson-Lindbom B, Svensson M, Marsal J, Mack M, DP, Targan SR (2000) J Immunol 165:5069–5076. Picarella D, Soler D, Marquez G, Briskin M, Agace WW (2006) Blood 107:3447– 21. Hosoe N, Miura S, Watanabe C, Tsuzuki Y, Hokari R, Oyama T, Fujiyama 3454. Y, Nagata H, Ishii H (2004) Am J Physiol 286:G458–G466. 10. Papadakis KA, Prehn J, Moreno ST, Cheng L, Kouroumalis EA, Deem R, 22. Johansson-Lindbom B, Svensson M, Pabst O, Palmqvist C, Marquez G, Forster Breaverman T, Ponath PD, Andrew DP, Green PH, et al. (2001) Gastroenter- R, Agace WW (2005) J Exp Med 202:1063–1073. ology 121:246–254. 23. Papadakis KA, Prehn J, Moreno ST, Cheng L, Kouroumalis EA, Deem R, 11. Perixoto A, Monteiro M, Rocha B, Veiga-Fernandes H (2004) Genome Res Breaverman T, Ponath PD, Andrew DP, Green PH, et al. (2001) Gastroenter- 14:1938–1947. ology 121:246–254. 12. Pabst O, Ohl L, Wendland M, Wurbel MA, Kremmer E, Malissen B, Forster 24. Tamura A, Soga H, Yaguchi K, Yamagishi M, Toyota T, Sato J, Oka Y, Itoh R (2004) J Exp Med 199:411–416. T (2003) Cell Tissue Res 313:47–53.

Stenstad et al. PNAS ͉ June 12, 2007 ͉ vol. 104 ͉ no. 24 ͉ 10127 Downloaded by guest on September 25, 2021