Expression Correlates with Increasing Malignancy in Human Astrocytomas'

Vo!. 1, 207-214, February 1995 Clinical Cancer Research 207

PAX5 Expression Correlates with Increasing Malignancy in Human Astrocytomas’

Edward 1. Stuart, Chrissa Kioussi, cated in the control of the developing embryo (reviewed in Ref. Adriano Aguzzi,2 and Peter Gruss3 12). All members of the family contain an evolutionanily con- served 128-amino acid-paired domain which can bind DNA. Department of Molecular Cell Biology, Max-Planck Institute for Unlike the developmental regulating homeobox (Hox) gene Biophysical Chemistry, Am Fassberg, 37077 GOttingen, Germany families which are clustered, each member of the PAX family is located on a different chromosome (11, 13). ABSTRACT It is likely that a relationship exists between developmental Rearrangements concerning chromosome 9p are a late processes and oncogenesis because one system involves the event in the progression of human astrocytic tumors to their regulation of cell growth and the other deregulation of cell most malignant form. The expression of PAX5, which maps growth. The involvement of homeobox-containing genes in to chromosome 9pl3, was studied in primary human brain leukemias has also been suggested (14-16). We have recently tumors of astrocytic origin. Whereas murine PaxS is not reported that the munine Pox family (17) as well as other expressed in the forebrain at any stage, PAXS expression homeobox-containing genes (18) have the ability to induce was increased in a range of astrocytomas (WHO grades tumors in mice. Expression of PAX2 and PAX8 has been dem- II-IV) which originated in the forebrain. Expression of onstrated in Wilms’ tumor and as such represent the only reported PAX5 was limited to those cells which also expressed the expression of PAX genes in primary human tumors (19, 20). oncogenes myc, los, orfun singularly or in combination. The However, the characteristic t(2;13)(q35;q14) in alveolar epidermal growth factor receptor was highly expressed in rhabdomysarcoma involves the PAX3 locus (21). This rear- glioblastoma multiform tumors in areas which were also rangement results in the translocation of the PAX3 locus and its highly PAX5 positive. We conclude that the missappropriate subsequent expression as a fusion protein whereby the COOH- expression of PAX5 may aid in promoting the progression of terminal portion of the normal PAX3 protein is replaced by a astrocytomal malignancy. portion of a novel forkhead protein termed FKHR (22) or ALV (23). An identical translocation has been recently reported for a INTRODUCTION subgroup of rhabdomyosarcomas in which the t(1;13)(p36;q14) Tumors of astrocytic origin are the most common intracra- rearrangement results in the fusion of PAX7 with FKHR (24). nial neoplasms and account for 50% of all neuroglial tumors (1). The consistent abnormalities associated with chromosome Astrocytomas are graded as I-IV according to their histological 9p and the previously documented involvement of 9p13, the features (2). Low-grade astrocytomas typically display a long PAX5 locus, in glioblastoma multiform prompted our investi- clinical history with relatively benign prognosis, whereas the gation of PAX gene expression in these tumors. Here we report prognosis of high-grade astrocytomas is devastating. Even low- on the expression of PAX5 in primary tumors of the human grade astrocytomas, however, have an inherent tendency to central nervous system. The expression of PAX5 tends to in- progress toward more malignant forms with time. This progres- crease with the grade of malignancy of the tumor, suggesting sion is likely to result from an accumulation of genetic events that it may play a role in aiding the progression of the malig- leading to the clonal expansion of malignant cells (reviewed in nancy of astrocytomas. Furthermore, PAX5 may prove to be Refs. 3 and 4). Some of these events, such as inactivation of the useful as a diagnostic indicator of malignancy in tumors of p53 tumor suppressor gene (5, 6) in the initial stages of carci- astrocytic origin. nogenesis and amplification of the epidermal growth factor receptor in late astrocytoma progression (7, 8), have already MATERIALS AND METHODS been identified. Many more genetic lesions, however, remain to be characterized as shown by the frequent detection of charac- Collection of Tumor Samples. Frozen tumor samples teristic cytogenetic abnormalities in astrocytomas of various were obtained from the Department of Neuropathology, Univer- histological grades (9, 10). sity of Zurich, Zurich, Switzerland. In total 27 tumors were The human PAXgene family consists ofnine members (11) analyzed and subdivided into three groups (Table 1). Tumors encoding nuclear transcription factors which have been impli- were classified according to WHO guidelines as glioblastoma multiform (WHO grade IV), n = 12, mean patient age, 53.4 ± 4.6 (range, 28-79) years; anaplastic astrocytomas (WHO grade

III), n = 12, mean patient age, 38.5 ± 5.4 (range, 5-65) years;

or astrocytomas (WHO grade II), n = 3, mean patient age, Received 8/4/94; accepted 10/10/94. 34.3 ± 1.9 (range, 32-38) years. I This work was supported by The Mildred Scheel Foundation and The PCR Amplification of PAX cDNA. Total RNA was Max-Planck Society. prepared using a lithium chloride-urea procedure (25). In each 2 Current address: Department of Neuropathology, University of Zurich, Sternwartstn. 2, CH-8091, Zurich, Switzerland. case S jig of total RNA was reverse transcribed in a volume of 3 To whom requests for reprints should be addressed. 15 jib using a first-strand cDNA synthesis kit (Pharmacia). PCR

Table I Clinical data concerning the patients from whom the tumors GTTCGAAG. Negative controls were included by substituting were removed water for cDNA. All primers were designed within exons and Tumor Tumor Previous across introns and thus by size negate the possibility of amplifying identification Age (yr) Sex location history” genomic DNA. GMI 79 M RP” Ten jil of the PCR product were ebectrophoresed on a 1.0% GM2 34 F RC agarose gel and transferred to a nitrocellubose membrane GM3 42 F RT (Qiabrane, Qiagen) using a standard Southern transfer proce- GM4 63 M RT GM5 50 F RF dune. Filters were hybridized with nick-translated munine probes GMfl 69 F LO for Pax5 (28), Pax#{243}(29), or Pa.z4 (a gift from Dr. B. Sosa- GM7 40 M LP I Pineda and Dr. M. Asano) or a GAPDH cDNA probe labeled GM8 28 F RO GM9 64 M RF with [32P]dCTP. GM1O 63 M RO Relative Quantification of PAX5 Expression. Hybrid- GMI1 66 F RF ized filters were phosphonimaged using a Bio-Rad Molecular GM12 43 M RT l Imager (Bio-Rad). Filters for PAX or GAPDH PCR products in AAI 6 F RT AA2 42 M RC 1 all three tumor groups were imaged simultaneously. Identical AA3 45 M RF I areas were analyzed and the volume in pixel densities per mm2 AA4 48 M LF 1,2,3 calculated. Background volumes were calculated from the neg- AA5 36 M LP AA6 41 F LC 3 ative control lanes of the PCR reaction and subtracted from both AA7 65 F RO 3 tumor and GAPDH values prior to further assessment. Values AA8 5 M RT-O are expressed as the mean ration (±SEM) of the volume of the AA9 64 F LF particular PCR product to the volume of GAPDH. AAIO 37 M LF AA1I 28 F RC 2 Antibodies. Rabbit pobyclonal antibodies against Jun AA12 45 M RF 1 were obtained from Oncogene Science and used at a dilution of Al 33 F LT 1: 100. Sheep polyclonal antibodies against Fos (Serva) were A2 34 F LF 2 A3 38 M RF I used at a dilution of 1:100. Monocbonal mouse antibodies PXA 41 M LT against Myc (Oncogene Science) were used at dilutions of 1:100. Detection antibodies such as 5(6)-carboxyfluorescein-N- (‘ Previous history refers to tumor recurrence. Numbers denote previously treated for: I, anaplastic astrocytoma grade III; 2, astrocy- hydroxysuccinimide ester (FITC) conjugated to anti-digoxige- toma grade II; 3, fibniller astrocytoma grade I. nm sheep F(ab’) fragments (Boehninger Mannheim) and tetra- ,, R, night; L, left; T, temporal; 0, occipital; F, frontal; P. panietal. methylrhodamine conjugated to goat antibody against rabbit IgG (Sigma) were used at 1:100 dilution. Cy3 conjugated to goat anti-mouse lgG (F(ab’), fragments; Dianova) was used at 1:500 dilution. amplification of PAX cDNA was performed on 3 jil of the In Situ Hybridization-Immunohistochemistry. Sections reverse transcription product. GAPDH4 was amplified as an (13 jim) were cut with a cryostat at -20#{176}Cand transferred onto internal control in which case 1 jil of the reverse transcription slides subbed with gelatin and chromalum. Sections were dried product was used. PCR amplification of PAX4, PAX5, and PAX6 at 37#{176}C,fixed for 20 mm with 4% paraformaldehyde, and rinsed was performed in all three tumor types simultaneously. In each in PBS. Sections were prehybnidized (200 jil/slide) with SX case a standard protocol was used which consisted of 35 cycles SSC, SX Denhardt’s, 50% deionized formamide, 250 jig/ml of denaturation of 95#{176}C,annealing at 55#{176}C,and extension at yeast tRNA, 250 jig/mb denatured salmon sperm DNA, and 4 72#{176}C.PCR primers were designed from the published sequences mM EDTA for 2-3 h in a humid 45#{176}Cchamber, and washed at for PAX5 (26) and PAX6 (27). The primers used for PAX4 room temperature for 2 mm in 70, 90, and 100% ethanol. correspond to the 3’ region of the murine paired box.5 Primers Digoxigenin-labeled RNA probes were synthesized, using T7 or used and size of PCR products were: PAX4 (300 base pairs), T3 polymerase according to the manufacturer’s directions upstream: AGCAATAAGAGGGATGCGACC downstream: CT- (Boehringer Mannheim) from the linearized plasmid cDNA GAAGTGCCCGAAGTACTCG; PAX5 (500 base pairs), up- clone described above. Sections were incubated as described stream: AGGATGCCGCTGATGGAGTAC downstream: TGGA- above (with probe) in prehybnidization buffer lacking salmon GGAGTGAATCAGCflTGG; PAX6 (800 base pairs), upstream: sperm DNA (2.5 ng/jil), and washed twice for 15 mm with 2X GGTGGTGTCJTFGTCAACGGG downstream: TFCTCflTCTC- SSC, 15 mm with 0.2X SSC, and twice for 15 mm with 0.1X CA1TI’GGCCCIT; GAPDH (190 base pairs), upstream: GGCCG- SSC at 45#{176}C.For double-labeling fluorescence, cells were in- TATFGGGCGCCFGGTC downstream: GAAGGGCAACFACT- cubated with primary antibodies for 2 h at room temperature, rinsed, and both secondary antibodies applied for 2 h. Controls were: (a) using sense probe and (b) omitting the probe, first antibody, second antibody, or all of the above. Immunofluores- 4 The abbreviations used are: GAPDH, glycenaldehyde-3-phosphate de- ence-stained preparations were viewed with a Zeiss Axiophot hydnogenase; PDU, pixel density units; EGFR, epidermal growth factor receptor. photomicroscope. Photographic prints referring to comparative 5 B. Sosa-Pineda and M. Asano, unpublished data. immunostaining were prepared under identical conditions.

(A) firmed using antibodies against glial fibrillary acidic protein. Expression was demonstrated in each case to be restricted to certain groups of cells within the tumor. Expression of PAX5 C, Ci I.) Ot) () L) was similar to that described above by PCR. Although all PA.X 4 glioblastoma multiform tumors displayed focally elevated .I .1 PAX5 expression, a different expression pattern was evident in the anaplastic astrocytoma group. Anaplastic astrocytomas displayed either medium or low PAX5 expression relative to the PAX 5 glioblastoma group. Fig. 4 shows PAX4 expression in the PXA *! 1± - 1 tumor which is again limited to certain areas of the tumor and is not ubiquitous. PAX 6 s..e.==:= Immunohistochemistry. Results of the immunohisto- 1 chemistry experiments are summarized in Table 2. Normal brain did not show expression of any of the oncogenes. There was no consistent pattern of oncogene expression between the tumor GAPDH groups or within the combinatorial possibilities of the individual oncogenes. However, in every case oncogene expression over- lapped with PAX5 or in the case of the PXA tumor PAX4 expression. Myc. Myc was expressed in 80% of gliobbastoma multiform tumors, 62% of anaplastic astnocytomas, and in I of the 2 astrocytomas studied. Mvc expression was confined to PAX5 (B) expressing areas of the tumors (Fig. 3). In two anaplastic astro- 0 a. cytomas i.e., AA7 and AA8, Myc was not expressed. PAX5 U expression was also not observed in these tumor sections. Fos. Expression of Fos was stronger in all positive areas a. 0 -I-- A than the other oncogenes studied and again expression was only identifiable in those areas which expressed PAX5, (Fig. 3). Fos ,_ A was expressed in 78% of glioblastoma multiform tumors, 50% GM AA A of anaplastic astnocytomas, and in 1 of 2 astrocytomas. In Fig. 1 PAXS expression in human astrocytic tumors. In A, PAX4, accordance with the expression of Myc, the two anaplastic PAX5, and PAX6 were amplified from reverse-transcribed total RNA astrocytomas AA7 and AA8 which did not express PAX5 did (reverse transcniption-PCR), PCR products were visualized by Southern transfer, and hybridization was performed as described in ‘‘ Materials not express Fos. and Methods.” In B, PAX5 expression as determined by phospho- Jun. Jun expression in the glioblastoma multiform group nimagry and expressed as the ratio of PAX5:GAPDH in PDU. Mean ± (Fig. 3) was weaker thanfos and was demonstrated in only 44% SE expression is shown graphically below. GM, gtioblastoma multi- of the tumors studied. Fifty percent of anaplastic astrocytomas form; AA, anapbastic astrocytoma; A, astrocytoma. and astrocytomas expressed Jun. It is noteworthy to mention that expression of Fos and Jun together was only observed in three glioblastoma multiform tumors, three anaplastic astrocy- RESULTS tomas, and one astrocytoma, suggesting that cooperation be- PAX5 Expression in Tumors. PAX5 cDNA prepared tween these oncogenes and their subsequent effects manifested from tumor total RNA was amplified using the PCR (Fig. 1). through AP-1 was not a key role in the tumors. PAX5 was expressed to varying degrees in all glioblastoma EGFR. The presence of EGFR was studied using an multiform tumors studied. Expression of PAX5 in anaplastic antibody raised against amino acid residues 985-996 of the astrocytomas was more variable. Expression in the astrocytomas protein corresponding to a region between the kinase site (res- was negligible compared to other tumors tested. PAX5 expres- idues 694-940) and the carboxy terminal. Our results demon- sion was highest in glioblastoma multiform tumors-1.16 ± strate that in glioblastoma multiform tumors (Fig. 3), EGFR was 0.31 PDU/mm2 compared to 0.17 ± 0.05 PDU, for anaplastic highly expressed, again coinciding with highly PAX5-positive astrocytomas, and 0.08 ± 0.01 PDU for astrocytomas. PAX6 areas. In contrast EGFR was not expressed in tumors of lower was expressed and PAX4 not expressed in each of the three malignancy. groups (Fig. 1). One pleomorphic xanthroastrocytoma (PXA) was studied and highly expressed PAX4 (Fig. 4A) but not PAX5 DISCUSSION (data not shown). We have studied the expression of PAX genes in human RNA in Situ Hybridization. PAX5 expression was stud- astrocytic tumors of various histological grades. The facts that ied in tumors using in situ hybridization. PAX4 and PAX5 were (a) PAX gene products are nuclear transcription factors which not expressed in normal brain (Fig. 2). Fig. 3 shows PAX5 are involved in the development of the nervous system (12), (h) expression in a representative glioblastoma multiform tumor munine Pa’: genes are pnoto-oncogenes in mice (17), and (c) the (GM6). Glial homogeneity of the cellular population was con- PAX5 locus (9pl3) maps to a recognized site for chromosomab

. .‘ , . .

.4 0 . “#{149} .

. . - __t .,.

.‘ ,d.

. a ‘ ‘ .,. ‘ I.. , ... ! : - , ‘H . $ ‘. .,,‘. ,. 3’. Fig. 2 In situ hybridization of PAXS RNA . ; #{149},: .‘.‘ ti in normal brain tissue. Cryostat sections were hybridized with digoxigenin-labeled anti- #{149} .1 sense PAX5 or PAX4 probe and hence visualized with the secondary (FITC-labeled) antibody. The intense signals represent S nonspecific background (see phase contrast) #{149}:-_ x 72. ;.. S

S. t

...... ,., ‘. . ... A., .,#{149},

$..-. -...... . . ;“#{149} .‘-

F ... . t’:.. . :-‘

‘-, -. f

, ! . #{149}‘, #{149}:- ‘-.s P#{149}x-4‘ #{182}. ‘

rearrangement in glioblastoma multiform tumors prompted us to stantiates the notion that PAX5 might be involved in progression study whether PAX5 was expressed in these tumors. rather than initiation of astrocytic tumors. Chromosomal rearrangements concerning 9p first appear in The fact that normal brain tissue does not express PAX5 anaplastic (grade III) astrocytomas (10). Our data suggest that and more importantly that PAX expression was detected in PAX5 may play a role in the progression of low-grade astrocy- specific areas of the tumors suggests that PAX is not normally tomas (e.g., fibnillary, protoplasmic, on gemistocytic astrocy- expressed in the human brain areas from which the tumor was toma) through to glioblastoma multiform tumors, the highly resected. All tumors were removed from the forebrain. Murine malignant end stage of astrocytoma. The observed increase in Pa_:5 is expressed at the midbrain-hindbrain area during embry- PAX5 expression which accompanies increasing malignancy has ogenesis (28) and not expressed in the forebrain of the adult two important facets: (a) it suggests that PAX5 may act as a mouse (30). The expression of PAX6 was similar in all tumors proto-oncogene in this type of tumor. (b) PAX5 expression studied, indicating that it is normally expressed in the human seems to be indicative of high malignancy gliomas and may forebrain, as is the case for adult mouse forebrain (30) and therefore represent a potentially useful prognostic marker. Our murine astrocytes (31). The expression of murine Pox’! has not data clearly indicate that grade IV gliomas express more PAX5 as yet been reported, however, PAX4 was not expressed in any than anaplastic and low-grade astrocytomas. Therefore, PAX5 tumor of low- or high-grade malignancy other than the single expression behaved concordantly with the histopathological no- pleomorphic xanthroastrocytoma studied. Although included as tion that the most malignant portion is determining the prog- a control for PAX4 expression, it is of interest to note that this nosis. With in situ hybridization we failed to identify PAX5 tumor did not express PAX5 and to speculate that the more expression in three low-grade astrocytomas. This finding sub- favorable prognosis which accompanies this type of tumor may

PAX

Fig. 3 In situ hybridization with corresponding immunohistochemistry in one glioblastoma multiform (GM6). Left panels, PAX5 RNA; center panels, oncogene expression in the same section; right panels, the corresponding phase contrast. Cry- ostat sections were hybridized with digoxy- genin-babeled antisense PAX5 probes and visualized with the secondary FITC-labeled ‘- ..,. ‘3,. .; ; ,- :‘-‘#{149} #{149}‘ antibody. Oncogenes and glial fibnillary .3. 0’ .‘ #{149}..-_:._ acidic protein were visualized using rhoda- mine optics. PAX5 is present in the glial ‘:..3I’ : -:‘-. .- ,. 0 cells (gliab fibrillary acidic protein positive) (_ - , and in the oncogene-positive cells. The PAX5 expressing cells have a characteristic / ) morphology and high mitotic activity. X 72.

:‘,

\ p \

:.. ‘: 4#{234}

0-4 .a

- (N A ‘.0 N ., - es c’ -- << < << < OL L Ci L,

PAX 4

GAPDH

: Fig. 4 PAX4 expression in a pleomorphic xanthroastrocytoma, PXA. A, reverse transcniption-PCR of PAX4 cDNA showing no expression in anaplastic astrocytomas and glioblastoma multiform tumors but expression in the PXA; B, in situ hybridization of ,, , ., PAX4 RNA in the corresponding tumor. Note the coexpression with myc and jun as demo- strated for PAX5 in Fig. 3. PAX4 PAX4

i4 ‘.

-- .- Jun myc

be in part due to the absence of PAX5 and/or the presence of scnibed at the same time and used immediately without storage; PAX4. (b) PCRs were performed simultaneously for each tumor, trans- The method used for identification and comparison of PAX fer to nitrocellulose filters was performed together, filters and expression in multiple tumor types in this report can be vali- for each tumor type were hybridized with probe and phospho- dated: (a) similar quantities of total RNA were reverse tran- nimaged together; and (c) all calculations were performed on

Table 2 Summary of the expression of oncogenes and EGFR in human astrocytic tumors

GM2 GM5 GM6 GM7 GM8 GM9 GM1O GM11 GM12 AA2 AA6 AA7 AA8 AA9 AA1O AA11 AA12 Al A3 WHO grade IV IV IV IV IV IV IV IV IV III III III III III III III III-IV II lI-Ill PAX5” I / / I / I I I I X X / I “ / I / GFAP”5 / I / / \/ I I I / / I I I / / I Mvc ++ ++ ++ - - + + ++ +++ + + - - - + +++ +++ - +

Fos ++ ++ +++ +++ ++ ++ - ++ - ++ - - - +++ - + ++ + - :1:+ ++ ++ - ++ - - + Jun - - + + + ++ +++ + ++

EGFR ++ ++ ++ ++ ++ ++ ++ ------++ ++ ++ ++ ++ ++ ++ ++ ++

“ PAX5 and GFAP-positive tumors are denoted by J: tumors not expressing PAX5 are denoted by X. Expression of MVC, fun, Fos, and EGFR were visually graded by comparison to the other tumors. Normal brain did not express any oncogene. b GFAP, glial fibnilbary acidic protein.

similar areas of the image produced which were then related to REFERENCES the positive control expression. Therefore we conclude that 1. Mikkelsen, T., Cainncross, J. G., and Cavanee, W. K. Genetics of the relative comparison between these tumors is applicable. malignant progression ofastrocytoma. J. Cell. Biochem., 46: 3-8, 1991. We chose to study jun and fos expression in these tumors 2. Z#{252}lch,K.G. Histological typing of tumors of the central nervous because previous observations suggested thatfos expression was system. International histological classification of tumors, Vol. 21. up-regulated by PAX expression.6 The expression of PAX5 in World Health Organization, Geneva: 1979. tumor cells corresponded in each case with expression of one or 3. Vogebstein, B., and Kinzler, K. W. The multistep nature of cancer. more of the oncogenes studied but a relationship between spe- Trends Genet., 9: 138-141, 1993. cific oncogenes and PAX5 was not evident. The apparent ex- 4. Bishop, J. M. Molecular themes in oncogenesis. Cell, 64: 235-248, pression of PAX5 and the EGFR suggests that there may be a 1991. link between tyrosine kinase-mediated pathways and PAX ex- S. Sidnansky, D., et al. Clonal expression of p53 mutant cells is asso- dated with brain tumor progression. Nature (Land.), 355: 846-847, pression in the nucleus in these tumors. 1992. The molecular basis for PAX5 ovenexpression in glioblas- 6. Fults, D., Brockmeyer, D., Tulbous, M. W., Pedone, C. A., and toma multiform tumors is evidently complex. Southern blot Cawthon, R. M. p.53 mutation and loss of heterozygosity on chromo- analysis of tumor genomic DNA identified a potential rear- somes 17 and 10 during human astrocytoma progression. Cancer Res., rangement in one tumor (data not shown); however, it would 52: 674-679, 1992. appear that the reason for altered expression may be more 7. Humphrey, P. A., et a!. Amplification and expression of the epider- subtle. Point mutations within the PAX5 locus or disruption of mal growth factor receptor gene in human glioma xenognafts. Cancer upstream or downstream regulatory elements may explain al- Res., 48: 2231-2238, 1988. tered expression. The possibility that PAX5 is a target gene for 8. Wong, A. J., et a!. Structural alterations of the epidermal growth factor receptor gene in human gliomas. Proc. NatI. Acad. Sci. USA, 89: another misappropriately expressed gene cannot as yet be ruled 2965-2969, 1992. out. 9. Bigner, S. H., Mark, J., Burger, P. C., Mahaley, M. S., Bullard, D. E., Here we have demonstrated a possible role for PAX genes Muhlbaier, L. H., and Bigner, D. D. Specific chromosomal abnormali- in common cancers of the human central nervous system, rein- ties in malignant human gliomas. Cancer Res., 88: 405-41 1, 1988. forcing our original suggestion (17) and extending it into the 10. Bigner, S. H., Mark, J., Bulland, D. E., Mahaley, M. S., and Bigner, human situation. We conclude that the increased expression of D. D. Chromosomal evolution in malignant human gliomas starts with PAX5 may play a role in the progression of malignancy of specific and usually numerical deviations. Cancer Genet. Cytogenet., gliomas and that it may be useful in the assessment of the degree 22: 121-135, 1986. of malignancy in this tumor type. 11. Stapelton, P., Weith, A., Urban#{233}k,P., Kozmik, Z., and Bussbingen, M. Chromosomal location of seven PAX genes and cloning of a novel family member, PAX-9. Nature Genet., 3: 292-298, 1993. ACKNOWLEDGMENTS 12. Chalepakis, G., Stoykova, A., Wijnholds, J., Tremblay, P., and We would like to acknowledge the superb technical assistance of Gruss, P. Pax: gene regulators in the developing nervous system. J. Simone Dieglen. We are grateful to Hans-Peter Geithe for oligonucle- Neunobiol., 24: 1367-1384, 1993. otide synthesis and Ralf Altsch#{228}ffel for photographic work. We would 13. Pilz, A. J., Povey, S., Gruss, P., and Abbott, C. M. Mapping of the also like to thank Jan Wijnholds, Michael Kessel, Gen Yamada, Mike human homologs of the munine paired-box-containing genes. Mamm. Gross, Ahmed Mansouni, and Cathanina Maulbecken for helpful discus- Genome, 4: 78-82, 1993. sions and suggestions. 14. Aberdam, D., Negneanu, V., Sachs, L., and Blatt, C. The oncogenic potential of an activated Hox-2.4 homeobox gene in mouse fibroblasts. Mol. Cell. Biol. 11: 554-557, 1991. 15. Blatt, C., Aberdam, D., Schwartz, R., and Sachs, L. DNA rearrangement of a homeobox gene in myeloid leukaemic cells. EMBO J., 7:

(3 G. Chalepakis and P. Gruss, unpublished data. 4283-4290, 1988.

16. Kongsuwan, K., Allen, J., and Adams, J. M. Expression of Hox-2.4 location in alveolar rhabdomyosancoma. Cancer Res., 54: 2869-2872, homeobox gene directed by provinal insertion in a myeboid leukemia. 1994. Nucleic Acids Res., /7: 1881-1892, 1989. 25. Auffnay, C., and Rougeon, F. Purification of mouse immunogbobin I 7. Maulbecker, C. C., and Gruss, P. The oncogenic potential of Pax heavy-chain messenger RNA’s from total myeloma tumor RNA. Eur. J. genes. EMBO J., 12: 2361-2397, 1993. Biochem., 107: 303-314, 1980. 18. Maulbecken, C. C., and Gruss, P. The oncogenic potential of de- 26. Adams, B., D#{246}rfler, P., Aguzzi, A., Kozmik, Z., Unban#{233}k, P., regulated homeobox genes. Cell Growth & Differ., 4: 431-441, 1993. Maurer-Fogy, I., and Busslinger, M. PAX5 encodes the transcription 19. Poleev, A., et al. Pax8, a human paired box gene: isolation and factor BSAP and is expressed in B-lymphocytes, the developing CNS, expression in developing thyroid, kidney and Wilms’ tumor. Develop- and adult testis. Genes Dev., 6: 1589-1607, 1992. ment, 116: 611-623, 1992. 27. Ton, C. C. T., Hirvonen, H., Miwa, H., Weil, M. M., Monaghan, P., 20. DressIer, G. R., and Douglass, E. C. Pax-2 is a DNA-binding Jordan, T., van Heyningen, V., Hastie, N. D., Meijens-Heijboer, H., protein expressed in embryonic kidney and Wilms’ tumor. Proc. Natl. Drechslen, M., Royer-Pokora, B., Collins, F., Swaroop, A., Strong, Acad. Sci. USA, 89: 1179-1183, 1992. L. C., and Saunders, G. F. Positional cloning and characterization of a 21. Barr, F. G., et a!. Rearrangement of the PAX3 paired box gene in paired box- and homeobox-containing gene from the aninidia region. the paediatnic solid tumor alveolar rhabdomyosancoma. Nature Genet., Cell, 67: 1059-1074, 1991. 3: 113-117, 1993. 28. Asano, M., and Gruss, P., Pox-S is expressed atthe midbrain-hindbrain 22. Galibi, N., et a!. Fusion of a forkhead domain gene to PAX3 in the boundary during mouse development. Mech. Dev., 39: 29-39, 1992. solid tumour alveolar rhabdomyosarcoma. Nature Genet., 5: 230-235, 29. Walther, C., and Gruss, P. Pax-6, a munine paired box gene, is 1993. expressed in the developing CNS. Development, 113: 1435-1449, 1991. 23. Shapiro, D. N., Sublett, J. E., Li, B., Downing, J. R., and Naeve, 30. Stoykova, A., and Gruss, P. Roles of Pax-genes in developing and C. W. Fusion of PAX3 to a member of the forkhead family of transcnip- adult brain as suggested by expression patterns. J. Neurosci., 14: 1395- tion factors in human alveolar rhabdomyosarcoma. Cancer Res., 53: 1412, 1994. 5108-5112, 1993. 31. Kioussi, C., and Gruss, P. Differential induction of Pax genes by 24. Davis, R. J., D’Cnuz, C. M., Lovell, M. A., Biegel, J. A., and Barr, NGF and BDNF in cerebellan primary cultures. J. Cell Biol., 125: F. G. Fusion of PAX7 to FKHR by the variant t(1;13)(p36;q14) trans- 417-425, 1994.

E T Stuart, C Kioussi, A Aguzzi, et al.

Clin Cancer Res 1995;1:207-214.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/1/2/207

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/1/2/207. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.