i

THE EVOLUTION OF FUNGAL PECTINASES IN GLYCOSYL HYDROLASE FAMILY 28 AND THEIR ASSOCIATION WITH ECOLOGICAL STRATEGY

A thesis submitted to Kent State University in partial fulfillment of the requirements for the degree of Master of Sciences

By

Daniel David Sprockett

December 2009

i

ii

Thesis written by Daniel David Sprockett B.S., Kent State University, 2006 M.S., Kent State University, 2009

Approved by

______, Advisor Christopher B. Blackwood ______, Advisor Helen Piontkivska ______, Member, Masters Thesis Committee Walter R. Hoeh Accepted by

______, Chair, Department of Biology James L. Blank ______, Dean, College of Arts and Sciences John R.D. Stalvey

ii iii

TABLE OF CONTENTS

LIST OF FIGURES...... v

LIST OF TABLES...... vii

ACKNOWLEDGEMENTS…………………………………………….……………viii

CHAPTER 1: I. General Introduction………………………………….…………………….1

Pectin Structure ………………………………………………………1 Pectin Distribution and Environmental Role…………………………2 Pectin Industrial and Biomedical Uses…………………….…………3 Pectinase Structure and Biochemistry………………………..………4 Pectinase Distribution and Environmental Role……..……...... …5 Pectinase Industrial and Biomedical Uses………………….…...……6 Thesis Overview………………………………………………...……7

CHAPTER 2:

II. The Distribution, Functional Diversity, and Evolution of Glycosyl Hydrolase Family 28 in Fungi……………………………………………………….…12 Introduction…………………………………………………………12 Methods…………………………………………………………..…14 Results and Discussion…………………………………...…………17 Conclusion………………………………………………………..…24

CHAPTER 3:

III. Fungal Glycosyl Hydrolase Family 28 Repertoire is Significantly Influenced by Ecological Strategy…………………………………………...... ………30 Introduction…………………………………………….…...…....…30 Methods……………………………………………………...... …33 Results……………………………………………………...…….…36 Discussion………………………………………………….…….…38 Conclusion……………………………………………...….....…….44

LITERATURE CITED………………………………………………..…..….….…49

APPENDIX 1: Summary of Organisms Used in this Study …………...... …65

APPENDIX 2: Aspergillus niger GH28 BLAST Query Sequences……………….84

iii

iv

APPENDIX 3: Neighbor-Joining Gene Tree Clades………………………………86

APPENDIX 4: Maximum-Likelihood Gene Tree Clades………………….………95

iv v

List of Figures

Fig. 1.1 This diagram shows the structure of the pectin chain and sites of GH28 cleavage.

Modified from Willats et al. 2006……………………………………………...….10

Fig. 2.1 Fungal Species Tree and Maximum Parsimony Reconstruction of Ancestral GH8

Copy Number……………………………………………………………....………25

Fig 2.2.a GH28 Neighbor-Joining Phylogenetic Reconstruction. …………...... …26

Fig 2.2.b GH28 Maximum-Likelihood Phylogenetic Reconstruction. ……...... …27

Fig 2.3 This scatterplot shows the relationship between GH28 copy number and the number of clades those copies occur. ……………………………….…...... …28

Fig 2.4 This scatterplot shows the relationship between GH28 copy number and the number of different functional groups in which those GH28 gene copies are categorized, including endo-PG, exo-PG, endo-RG, and exo-RG. …………………………..…29

Fig 3.1.a Bar graph showing the differences in the genome sizes (Mb) in biotrophic, necrotrophic, and non-pathogenic fungi. ………………………………….…...…45

Fig 3.1.b Bar graph showing the differences in GH28 copy number in biotrophic, necrotrophic, and non-pathogenic fungi. ……………………………….……..…46

Fig 3.2 Scatterplot showing the relationship between genome size (Mb) and GH28 gene copy number. Biotrophs, necrotrophs, and non-pathogens are labeled, and groups of biotrophs and necrotrophs identified with colored ovals. ……………………....…47

v vi

Fig 3.3 Mirror Tree of fungal species. Genome size and GH28 copy number has been reconstructed using parsimony analysis. Biotrophs and necrotrophs are identified.

Felsenstein’s Contrast Correlation P < 0.0001, r 2 = 0.19………………………..…48

vi

vii

LIST OF TABLES

Table 1.1 A summary of GH28 functional types, E.C. numbers, and a brief description of each mode of enzymatic action. ……………………………………………………11

vii viii

ACKNOWLEDGEMENTS

It is a pleasure for me to acknowledge the many people who made this thesis research possible. I would first like to sincerely thank my graduate advisors, Christopher

B. Blackwood and Helen Piontkivska, for their careful guidance during this research project, as well as my thesis committee member, Walter Hoeh. I would also like to thank other biology faculty members that have significantly impacted my development as a research scientist over my tenure at Kent State. These faculty members include John

Stalvey, Andrea Case, Oscar Rocha, Pat Lorch, Ferenc de Szalay, and Mark Kershner.

I also need to thank Justin Reeves, Justin Montemarano and Sinu Paul for their help analyzing data and building figures, as well as Mikayel Hovhannisyan for writing me a valuable sequence re-naming program. I owe a large debt of gratitude to Chris

Blackwood and Bess Heidenreich for their help in completing an extensive literature search of fungal pathogens. I additionally need to acknowledge my many lab mates, including Stephanie Hovatter, Doug Antibus, Larry Feinstein, and Oscar Valverde, as well as fellow graduate students Eric Floro, Julie Proell, Julie Morris, and Jenn Clark.

Their enthusiasm, encouragement and advice has not only helped make this a successful project, but has also aided in my growth as a person and as a scientist.

Finally, I am grateful for my wonderful friends and family. Their endless love and support have made me the person that I am today. I wish to dedicate this thesis to my parents, Larry and Barbara Sprockett, and my fiancé, Andrea Loomis. I could have not made it this far without them.

viii

1

Chapter 1:

General Introduction

Pectin Structure

One major distinguishing characteristic of plant cells is their rigid cell wall. This specialized structure gives plant tissue rigidity and protection, while its semi-permeable nature also precludes the uptake of large molecules. Plant cell walls have three layers, the inner lamella, the primary cell wall, and the secondary cell wall, and are primarily composed of cellulose, hemicellulose, various soluble proteins, and pectin. Pectin, a diverse family of polysaccharides, is a major structural component of both the primary cell wall and the inner lamella. The cell wall can be conceptualized as a complex cellulose-glycan network surrounded by a soluble matrix of polysaccharides, glycoproteins, proteoglycans, and ions. Pectin is the most abundant class of macromolecule in this matrix, accounting for up to one third of all primary cell wall macromolecules (Willats et al. 2001).

Biochemically, the pectin family of carbohydrates is comprised of members dominated by a chain of 1,4-linked alpha-D-galactosyluronic acid residues (GalA).

There are three types of pectic domains, which include homogalacturonan, rhamnogalacturonan-I, and rhamnogalacturonan-II (Fig 1.1). Homogalacturonan (HG) is composed of a linear chain of 1,4-linked alpha-D-galactosyluronic acid residues.

Demethyl-esterification at the C-6 carboxyl allows calcium cross-linkages to form, resulting in large assemblies of homogalacuronan within the cell wall matrix.

Rhamnogalacturonan-I (RG-I) occurs when regions of galacturonic acid are replaced with

1 2 the disaccharide repeat [(1 →2)-α-L-rhamnose-(1 →4)- α-D-galacturonic acid]n. This

replacement causes steric hindrance or a “kink” in the linear backbone and allows the

bonding of various sugar side chains, including D-galactose, L-arabinose, and D-xylose.

Pectic regions with high densities of rhamnose are considered “hairy” regions due to their

highly branched configuration, while those with less branching are termed “smooth”

regions (Pérez et al. 2000). Rhamnogalacturonan-II (RG-II) is a branched pectic domain

containing a homogalacturonan backbone with various complex side chains bonded to the

GalA residues (O’Neill et al. 2004). These three polysaccharide domains form covalent

linkages throughout the primary cell wall matrix and middle lamellae, and provide

considerable potential for structural modulation by a wide range of pectinase enzymes.

This matrix forms a crystalline structure that allows it to trap water and other molecules,

giving pectin its widely used gelling properties. It has been traditionally assumed that the

structure of pectin was primarily composed of a HG backbone interspersed with RG-I

and RG-II regions (Fig 1.1). However, recent alternative structures have been proposed,

placing RG-I at the backbone with long side chains of HG, further branching into RG-II

(Willats et al. 2006).

Pectin Distribution and Environmental Role

Pectin is found in both angiosperms and gymnosperms, along with pteridophytes,

bryophytes, lycophytes and carophytes, an algal clade that is believed to be the closest

extant relative of land plants (Matsunaga et al. 2004, O’Neill et al. 2004). The occurrence

of pectin in lignified cell walls is thought to be a key plant adaptation that allowed plants

to colonize land by way of upright growth (Matsunaga et al. 2004). This carbohydrate

2 3 family makes up ~35% of primary walls in dicots and non-graminaceous monocots and anywhere between 2 and 10% of grass and other commelinoid primary walls (Mohnen

2008). It is synthesized in the Golgi apparatus and transported throughout the cell in membrane-bound vesicles. Pectic chains are largely deposited in the primary cell wall and inner lamella of growing and dividing cells, as well as the junction zone between cells where it regulates intercellular adhesion and cell wall porosity (Mohnen 2008).

Furthermore, pectins contribute to the strength and mechanical properties of cell walls, with its complex carbohydrate matrix adding both durability and flexibility. Pectins play an integral role in plant growth and development, but can also be used as intercellular signaling molecules named oligosaccharins (Ridley et al. 2001). These oligosaccharins can regulate growth and developmental processes, as well as stimulate plant pathogen defense mechanism (Côté and Hahn 1994).

Pectin Industrial and Biomedical Uses

Pectins are non-toxic, inexpensive, and some of the most abundant natural compounds on earth, and have a wide range of industrial and pharmacological uses. This family of carbohydrates is primarily used as a food additive, thickening agent, gelling agent, cosmetic texturizing agent, and is a common source of dietary fiber. World wide annual pectin consumption is estimated at around 45 million kilograms, worth a global market value of over $600 million (Willats et al. 2006). Pectins are also components of edible and biodegradable films, adhesives, paper, foams, and plasticizers, as well as recently developed antimicrobial food packaging (Mohnen 2008).

3 4

Furthermore, pectins have many important medical applications. They are used as a texturizing agent in pharmacology, as a treatment for a dry cough, and have been a traditional therapy for irritated mucous membranes in the respiratory tract (Sriamornsak

2003). Specialized drug delivery systems utilizing pectin’s unique bioadhesive properties toward gastrointestinal tissues have been developed (Sriamornsak 2003), along with special calcium pectinate gel (CaPG) beads that provide sustained drug release targeted at the colon (Sriamornsak et al. 2007). Furthermore, pectin has been shown to lower cholesterol and serum glucose levels, reduce cancer rates and stimulate immune responses (Mohnen 2008).

Pectin polymers are critically important in many areas of industry and biomedicine. In order to continue to increase pectin’s usefulness, we must understand how the varied and complex structures of pectin chains are enzymatically modified.

Pectinase Structure and Biochemistry

Glycosyl Hydrolases are a class of hydrolytic enzymes that break down polysaccharides, and are therefore essential components of a wide variety of biological processes. Enzymes are classified into groups based on the reactions they catalyze and are given corresponding E.C. numbers by the Nomenclature Committee of the

International Union of Biochemistry and Molecular Biology (http://www.brenda- enzymes.org/). O-glycoside hydrolases are assigned E.C 3.2.1.n., where n represents the substrate specificity or molecular mechanism of the enzyme. One group of Glycosyl

Hydrolases is Family 28 (GH28); a diverse yet phylogenetically and structurally related

4 5 gene family that degrades pectin in a variety of ways (Henrissat and Davies 1997). GH28 members’ E.C. numbers and modes of action are summarized in Table 1.

GH28 polygalacturonases hydrolyze the homogalacturonan and the rhamnogalacturonan components of the pectin chain by way of a single displacement inverting mechanism (Fig 1.1). This alters the stererochemistry around the anomeric carbon resulting in fully saturated products (Abbott and Boraston 2007). This mechanism is contrasted with other types of pectinases, namely pectin lyase and pectate, which use β-elimination to cleave glycosidic linkages, resulting in a 4,5-unsaturation at the non-reducing end (Abbott and Boraston 2007). There are four strictly conserved regions between plant, bacterial, and fungal polygalacturonases (Markovi č and Jane ček

2001). PROSITE has identified histidine (H) as the active site residue in the following

conserved GH28 motif:

[GSDENKRH] - x(2) - [VMFC] - x(2) - [GS] - H - G - [LIVMAG] - x(1,2) - [LIVM] - G - S

Another common feature of fungal and bacterial GH28s is a right-handed β-helix fold in their three dimensional structures (Abbott and Boraston 2007). These enzymes are able to contact internal sugars within the carbohydrate chain because its active site is a surface channel that is open on both ends (Abbott and Boraston 2007).

Pectinase Distribution and Environmental Role

Pectinases play a very important role in various biological processes across the whole spectrum of life. All plants have the ability to produce pectinolytic enzymes, and use them to modify mature tissues, such as in fruit ripening and maturation, leaf and

5 6 flower abscission, and pollen tube development. Alternately, pectinases are a major virulence factor for a wide variety of pathogenic bacteria and fungi, as cell wall penetration is often the first step in plant infection. Plants can respond to alien pectinases by producing protein inhibitors of cell wall degrading enzymes (De Lorenzo et al. 2001,

Federici et al. 2006, Juge 2006).

Additionally, cell wall degradation is an integral step in the decomposition of plant detritus. Saprophytic bacteria and fungi use extracellular pectinases to liberate galacturonic acid and sugars, as well as intracellular nutrients. Cell wall degradation is the rate-limiting step in the succession of microbial communities and the degradation of substrates in which they are present (Sinsabaugh et al. 2002).

Pectinase Industrial and Biomedical Uses

In addition to their environmental importance, pectinases are extremely valuable in industrial settings. Consumer products containing pectin polymers are altered by pectinases, and therefore the multimillion-dollar industry surrounding pectin-containing products depends heavily on glycosyl hydrolases and glycosyl transferases. A better understanding of the functional diversity of GH28s would allow investigators to more efficiently and precisely process pectin materials. A common industrial use of pectinases is in the production of fruit juices, as well as many types of wine (Kashyap et al 2001).

The addition of pectinases during the juice extraction process greatly increases yield, quality, and clarity, while reducing acidity and stabilizing citrus juices, purées, and nectars. Similarly, oil extraction yield and quality from the rape seed (Canola) and olives can be improved through the use of pectic enzymes (Kashyap et al 2001). These

6 7 enzymes can also be used during the processing of tough, fibrous plant materials, such as coffee beans, animal feed, jute, flax, hemp, and coir from coconut husks, as well as in commercial pulp and paper production (Kashyap et al 2001). Pectinase-producing bacteria are widely being used in the treatment of pectic wastewater, while industrial leaders are exploring the use of pectinase in the production of ethanol fuel (Kashyap et al

2001). This enormous increase in pectin processing power afforded by this gene family has lead to widespread exploration for more efficient enzymes by screening microbial communities and by using synthetic techniques such as site-directed mutagenesis

(Kashyap et al. 2001). Alternately, an understanding of the evolutionary distribution of these enzymes will inform industrial researchers on which groups of organisms are likely to possess functionally diverse and possibly useful novel pectinase isoforms.

Thesis Overview

The research described here seeks to improve our understanding of the distribution and diversity of glycosyl hydrolase family 28 in the fungi, as well as the origin of that diversity. We conducted two studies that address the ways that this gene family has evolved, expanded, and diversified.

The first study investigates the distribution and functional diversity of glycosyl hydrolase family 28 homologs in fully sequenced fungal genomes ( Chapter 2 ). Our goal is to show that a wide range of GH28 gene copy number exists in fungi, and that this diversity is directly related to the diversification of enzyme functionality. Analyzing fully sequenced genomes allows us to identify the entire repertoire of GH28 gene family members and reconstruct its complex evolutionary history using phylogenetic methods.

7 8

We also estimate the ancestral copy number and functional type of fungal GH28s, and evaluate whether this gene family’s evolutionary history is structured phylogenetically, where the gene history matches that of the organism, or structurally, where gene diversity is the result of functional diversification and possibly molecular adaptive radiation. The evidence presented in this investigation will be helpful to researchers investigating the molecular evolution of pectin-modifying enzymes. We also identify branches of the fungal tree of life that likely hold yet undescribed pectinases, which will be of interest to both academic and industrial researchers seeking more efficient alternatives to today’s industrial enzymes.

The second study deals with the selective forces that may have resulted in the currently observed distribution of GH28s ( Chapter 3 ). Our goal was to determine whether GH28 diversity and abundance within genomes is an artifact of general genome expansion and/or contraction, or if the GH28 gene family distribution and diversification was specifically selected as a result of ecological niche adaptation. We use statistical methods to examine the relationship between GH28 abundance and diversity within genomes and ecological strategy (plant/animal pathogen, non pathogen) and pathogenic strategy (biotroph, nectrotroph). This research will be helpful to researchers interested in the complex interactions surrounding host-pathogen evolution. This study takes an evolutionary approach to studying mechanisms that underlie genetic diversity within fungal genomes, including the diversity of GH28 members. The assimilation of evolutionary and ecological understandings of host-pathogen co-evolution will help advance our understanding of genetic diversity within genomic regions involved in stress response (de Meaux and Mitchell-Olds 2003).

8 9

This thesis represents a major update of the evolution of GH28 across fungal taxa, and is the first comprehensive overview of GH28s and the evolution of pathogenic strategy. This is a highly active area of research, with dozens of related manuscripts in this field being published every month. Billions of agricultural dollars are spent annually controlling both soft-rot and hard-rot fungal pathogens, affecting crops such as wheat, corn, strawberries, apples, chestnuts, and even bananas and other tropical fruits. This study contributes to the general understanding of host-pathogen molecular evolution, but also generally informs applied management strategies dealing with fungal infections and crop management.

9

10

Fig. 1.1 This diagram shows the structure of the pectin chain and sites of GH28 cleavage. Modified from Willats et al. 2006.

10

10 11

Table 1.1 A summary of GH28 functional types, E.C. numbers, and a brief description of each mode of enzymatic action.

Enzyme E.C. Number Mode of Action

Polygalacturonase 3.2.1.15 Random hydrolysis of 1,4-alpha-D- galactosiduronic linkages in pectate and other galacturonans

exo-polygalacturonase 3.2.1.67 (1,4-alpha-D-galacturonide)(n) + H(2)O <=> (1,4-alpha-D-galacturonide)(n-1) + D- galacturonate

exo-polygalacturonosidase 3.2.1.82 Hydrolysis of pectic acid from the non- reducing end, releasing digalacturonate

rhamnogalacturonase 3.2.1.- N/A

endo-xylogalacturonan 3.2.1.- N/A hydrolase

rhamnogalacturonan α-L- 3.2.1.40 Hydrolysis of terminal non-reducing alpha- rhamnopyranohydrolase L-rhamnose residues in alpha-L- rhamnosides

11

12

Chapter 2:

The Distribution, Functional Diversity, and Evolution of Glycosyl Hydrolase Family

28 in Fungal Genomes

Introduction

Glycosyl hydrolases, also known as glycosidases, are enzymes responsible for catalyzing hydrolysis of glycosidic bonds in oligosaccharide chains (Lehninger et al.

2005). On the basis of amino acid similarity, glycosyl hydrolases (GH) have been classified into 115 families that are widely distributed across prokaryotic, eukaryotic, and archaeal genomes as described in the Carbohydrate Active enZYmes database (Henrissat

1991; Henrissat and Bairoch 1993; Cantarel et al. 2009; http://www.CAZy.org).

Glycosyl Hydrolase Family 28 (GH28) forms a distinct gene family due to generally conserved protein sequences of family members and their ability to degrade pectin, a polysaccharide and major structural constituent of the plant cell wall. Long pectin chains within the plant cell wall are composed of α-linked galacturonic acid chains (GalA),

interspersed with regions where alternate galacturonic acid monomers are substituted by

rhamnose and branched xylose side-chains (Willats et al. 2001, Willats et al. 2006).

GH28 enzymes degrade these bonds by catalyzing a series of functionally distinct

reactions. Polygalacturonase (PG) hydrolyzes the GalA-GalA linkages, while

rhamnogalacturonase (RG) digests GalA-rhamnose bonds and xylogalacturonase (XG)

digests bonds between GalA and xylose (Fig. 1.1). These three functional types can also

be separated into two main categories according to the location of the digested bond.

Endo-glycosidases catalyze internal glycosidic bonds at random locations within the

12 13 polysaccharide, while exo-glycosidases catalyze the hydrolysis of terminal bonds that attach individual sugars to the ends of the polysaccharides.

Plants utilize GH28 enzymes during tissue growth and maturation processes (Kim et al. 2006). GH28 enzymes also occur in a wide range of bacteria and fungi, acting as virulence factors in plant pathogens (Walton 1994, Herron et al. 2000, Reignault et al.

2008) and as degradative enzymes in saprophytes (Kjøller and Struwe 2002). Notably, extracellular excretion of pectinases (including GH28 enzymes) is common among both saprophytic and pathogenic microbes, as cell wall penetration is often the first step in both plant infection and detrital decomposition.

Earlier phylogenetic studies have shown that fungal GH28s form a monophyletic

cluster, separate from plant and bacterial GH28 clades (Markovi č and Jane ček 2001, Park et al. 2008). However, recent advances in genome sequencing techniques have led to a dramatic increase in available complete fungal genome sequences, expanding the number of known GH28s over 10-fold. Therefore, this study seeks to comprehensively investigate the occurrence and distribution of this gene family in fungal genomes using whole genome sequences, and to reconstruct the long-term evolutionary history of GH28 diversification in fungi. We identify homologous GH28 genes in fungal genomes and infer the ancestral gene copy number at various key fungal ancestors. Additionally, we construct a comprehensive phylogeny of fungal GH28 sequences, allowing us to infer the ancestral enzymatic mode(s) of action and reconstruct the subsequent functional diversification within this gene family.

13 14

Methods

Species tree of fungal genome sequences

Our first step in inferring the GH28 copy number in the most recent common ancestor (MRCA) of fungi was to construct a species tree using small subunit ribosomal

RNA (SSU rRNA) sequences from 69 fully sequenced fungal genomes, including 57

Ascomycetes, 8 Basidiomycetes, 3 Mucoromycotinians, and 1 Chytridiomycotian, as well as an additional 2 Oomycetes (Stramenopiles) and 1 plant (Appendix 1). Relevant ribosomal sequences were extracted from the SILVA database (Pruesse et al. 2007) and

Genbank (http://www.ncbi.nlm.nih.gov/) (Appendix 1) and aligned using the MUSCLE sequence alignment tool using default parameters available through the Geneious Pro

4.7.1 software package (Biomatters Ltd., Auckland, New Zealand). The maximum- likelihood based species tree was reconstructed using the program PHYML (Guindon and

Gascuel 2003), utilizing the Tamura-Nei substitution model (TN93). The reliability of internal branches was evaluated using 1000 bootstrap replications (Felsenstein 1985a).

GH28 Genomic Distribution and Ancestral Copy Number

Translated GH28 amino acid sequences were collected from the 69 fungal and 2 stramenopile genomes (Appendix 1). BLASTp (Altschul et al. 1990) was used to identify putative GH28 sequences based on their sequence similarity to six diverse, yet well described GH28 members from the filamentous fungus Aspergillus niger (Bussink et al. 1991, de Vries and Visser 2001, Martens-Uzunova et al. 2006, Martens-Uzunova and

Schaap 2009) (Appendix 2). Expectation E value cut-off = 0.001 was used. These six A. niger sequences were chosen as GH28 queries because they are representative of the six

14 15 previously described general classifications of A. niger pectinases (endo-PG, exo-PG, endo-RG, exo-RG, endo-XG, exo-XG) (Martens-Uzunova and Schaap 2009).

Additionaly, A. niger is a well studied model organism used in numerous structural and biochemical glycosyl hydrolase studies (Kusters-van Someren et al. 1991, Bussink et al.

1992, de Vries et al. 2002, de Vries 2003, van Pouderoyen 2003), and its genome has been shown to possess up to 20 putative GH28 members (Martens-Uzunova and Schaap

2009). Our search for GH28 homologs yielded 293 GH28 members from 40 species.

These results were generally consistent with other studies examining the pectin degrading networks of Aspergillus niger (Martens-Uzunova and Schaap 2009), the white rot basidiomycete Phanerochaete chrysosporium (Wymelenberg et al. 2005), and the zygomycete Rhizopus oryzae (Mertens et al. 2008). These molecular studies identified nearly the same number GH28 homologs in selected fungal genomes that our methods identified. This allows us to ground our methods with supporting molecular evidence and lends confidence that we have identified all relevant GH28 homologs.

Collected BLASTp hits were aligned using MUSCLE (Edgar 2004). MUSCLE was chosen because it is computationally expedient yet attains alignment accuracy equal to or better than a standard CLUSTAL alignment (Edgar 2004). This alignment was then manually curated for accuracy and sequences shorter than 250 residues in length were removed. Sequences missing the GH28 active site motif predicted in PROSITE

(http://ca.expasy.org/), or the GH28 domain as defined in the Conserved Domain

Architecture Retrieval Tool (CDART; Geer et al. 2002), or other large portions of the gene were considered probable pseudogenes and also excluded from further analyses.

The final alignment encompassed 293 GH28 members from 40 species.

15 16

Using the species tree described above, the parsimony based ancestral character state reconstruction was performed using the Mesquite software package (Maddison and

Maddison 2009) to infer the most likely number of GH28 gene copies in the fungal

MRCA. Phytophthora species GH28 estimations were excluded from this analysis because Phytophthora GH28s were possibly horizontally transferred from fungi

(Andersson 2006; and see analysis below). The inclusion of enzymes from Phytophthora

would result in a biased estimation of the number of GH28 gene copies in the MRCA of

fungi.

GH28 Phylogenetic Reconstruction

The alignment of 293 GH28 members from 40 species described above was used

to reconstruct the evolutionary history of this gene family. Additionally, seven peach tree

(Prunus persica ) GH28s, available from the CAZy database, were used as an outgroup for this dataset. P. persica is an appropriate outgroup because it has been shown to

harbor a diverse set of GH28s, possessing both exo- and endo- acting PGs (Pressey and

Avants 1973, Hadfield and Bennett 1998). P. persica’s cell wall metabolic network and pectinase activity has been characterized previously (Brummell et al. 2004, Morgutti et al. 2006).

GH28 phylogenetic trees were reconstructed from the MUSCLE alignment using the neighbor-joining and maximum likelihood methods. The neighbor-joining (NJ) tree was constructed using the Jukes-Cantor (JC) amino acid substitution model available though the Geneious Treebuilder function (Biomatters Ltd., Auckland, New Zealand).

500 bootstrap replications were used to evaluate the reliability of internal branches

16 17

(Felsenstein 1985a). Because of the large number of sequences relative to the sequence length available in the alignment, we chose the relatively simple JC model that assumes equal rates of amino acid substitutions because of its smaller standard error (Nei and

Kumar 2000). The maximum-likelihood gene tree was reconstructed using the program

PHYML using the Jones-Taylor-Thorton (JTT) substitution model (Guindon and Gascuel

2003) available through Geneious Pro 4.7.1. Tree topologies were visualized using

Geneious Pro 4.7.1 and FigTree 1.2.1 (Rambaut 2007).

Results and Discussion

GH28 Genomic Distribution

The initial survey of GH28 members revealed the presence of at least one GH28 homolog in 40 of the 69 completed fungal genomes examined, as well as rather high variation in GH28 copy number among genomes (Appendix 1). The number of putative

GH28 members varied from 0 to 20 GH28 copies per genome. This high level of variability in GH28 copy number suggests an extremely dynamic evolutionary history, and is consistent with evolution via the birth-and-death process (Nei et al. 1997, Nei and

Rooney 2005). This form of multigene family evolution involves multiple gene copies being generated though repeated gene duplications, followed by subsequent sequence and functional diversification of some paralogs, while others may become pseudogenes and eventually be deleted from the genome.

Birth-and-death evolution can often lead to a lineage-specific gene family expansion, or the comparative diversification of a gene family in one lineage relative to a given sister lineage (Jordan et al. 2001, Lespinet et al. 2002). One large-scale systematic

17 18 comparative analysis of lineage-specific expansions in eukaryotes found that gene families involved in environmental sensing and response were more likely to undergo lineage-specific expansions than the rest of the genome (Lespinet et al. 2002). In fact, a recent genomic analysis of Aspergillus oryzae reveals conserved syntenic blocks with

Aspergillus fumigatus and Aspergillus nidulans , while also possessing a block of A. oryzae specific expansion that includes many secretory hydrolytic enzymes (Machida et al. 2005).

In order to infer ancestral gene copy number, we first reconstructed a fungal species tree from well-conserved SSU rRNA sequences, and then used a maximum parsimony approach to reconstruct ancestral gene copy number at key points in the evolutionary history of fungi. This species tree was essentially identical to recently published fungal phylogenies (James et al. 2006, Hibbett et al. 2007). Because of the likely horizontal gene transfer events that expanded GH28 composition of Stramenopiles

(Andersson 2006; see analysis below), it is difficult to estimate the number of ancestral copies in the MRCA of Stramenopiles. Thus, assuming unknown number of GH28 genes in the common ancestor of Stramenopiles and fungi, our maximum parsimony reconstruction analysis indicates that the MRCA of fungi possessed 2-4 GH28 members

(Fig. 2.1). Following the diversification of fungi from plants and animals ~1.5 billion years ago (Wang et al. 1999), there was differential expansion and contraction of this gene family among fungal lineages. Our analysis shows the MRCA of Saccaromycotina that existed ~773 MYA (Blair 2009) likely possessed between 2 and 4 copies of GH28s

(Fig. 2.1). However, this lineage has experienced a large-scale reduction in GH28 copy

18 19 number among its extant representatives, a trend also seen in other Saccaromycotina gene families (Cliften et al. 2006).

Conversely, organisms in the order Eurotiales, class Eurotiomycetes of

Pezizomycotina (Geiser 2006), have experienced a large increase in both the number of

GH28 gene family members and their functional diversity since their divergence from

Sordariomycetes ~673 MYA (Blair 2009, Fig. 2.1). The diverse genus of filamentous fungi Aspergillus, and especially Aspergillus niger, has undergone an especially large

GH28 expansion, as A. niger possesses 20 putative GH28 homologs. Because of this expansion, this branch of the fungal tree of life would be an ideal phylogenetic location to investigate taxa for novel GH28 enzymes. Closely related Aspergillus species may also

possess high numbers of GH28s, some of which may have novel functions.

Evolution of GH28 Functional Diversity

In order to better understand the patterns of gene family diversification, we

constructed gene trees from putative GH28 homologs in fungi. The topologies of GH28

trees reconstructed by NJ (Figure 2.2.a, Appendix 3) and ML (2.2.b, Appendix 4)

methods consistently show 10 well-supported, distinct clades, with Prunus persica

GH28s forming a well-supported monophyletic outgroup (supported by 99% and 100% bootstrap values in NJ and ML topologies, respectively). However, low bootstrap support indicates that we were unable to resolve the specific branching pattern among some of these clades due to a lack of sufficient phylogenetic information.

In both the NJ and ML trees, the most ancestral clade, Clade A, is made up almost exclusively of GH28 members annotated as having endo-RG activity. The fact that both

19 20

Basidiomycete and Ascomycete sequences occur in Clade A suggests that the MRCA of the Dikarya possessed an endo-RG that has since diversified into the present day form.

Clade E contains exo-PGs and a single endo-PG, although based on this analysis we suggest that the endo-PG could be a mis-annotation. The single endo-PG is a gene from Botrytis cinerea . The orthologous protein in the closely related species Sclerotinia sclerotiorum is annotated as an exo-PG. Eleven other GH28 genes from B. cinerea are paired with orthologous genes in S. sclerotorium in our GH28 phylogeny, and the pair in

Clade E is the only example of homolog disagreement in biochemical activity. The two closely related Sordariomycetes, Verticillium albo-atrum VaMs.102 and Verticillium dahliae VdLs.17 also co-occur in 10 out of 11 instances. The pattern exhibited by these species pairs suggests that even though this dynamically evolving gene family has experienced gene family birth-and-death at variable rates in different lineages, recently diverged species still retain many orthologous gene copies derived from a speciation event.

The exo-PG mode of enzymatic activity is present in several clades, including B,

C, D, and E, but is not present in Clade F. In contrast, if we assume the endo-PG in

Clade E is a mis-annotation, then endo-PGs only occur in Clade F. This supports our characterization that the evolutionary history of GH28 is not structured taxonomically within species. Because of low basal bootstrap support, we are unable to confidently infer the ancestral and derived modes of action of the GH28 enzyme from this data.

Biochemical studies have indicated that endo- and exo-acting isozymes of glycosyl hydrolases could have arisen independently multiple times throughout the evolutionary history of fungi by convergent evolution (Gherardini et al. 2007), and enzyme studies

20 21 have shown a high level of mutability in enzyme active sites (Todd et al. 2002). Abbott and Boraston (2007) have shown structurally how amino acid insertions or deletions can affect an enzyme’s access to the internal residues of the pectin substrate. Active site transformation between endo- and exo-acting forms can be accomplished by loop insertions or deletions and could occur with high frequency (Rouvinen et al. 1990, Dias et al. 2004, Proctor et al. 2005). In contrast, our data show that repeated evolutionary transitions between endo- and exo-acting forms fungal of GH28s are unlikely.

However, based on the widespread species distribution represented in Clade F and its well-supported phylogenetic proximity to the Murcoromycotina, a basal group of fungi, it is likely that at least one of the 2-4 GH28s in the MRCA of fungi was an endo-

PG. Subsequent forms of GH28 arose through natural selection, were maintained through purifying selection, and then radiated into the majority of the clades denoted here. This process probably opened new molecular niches for GH28 enzymes. Greater taxonomic sampling is needed to evaluate if this evolutionary scenario holds true across fungal taxa.

It has also been suggested that novel glycosyl hydrolase activities arise from the independent specialization of a generalist ancestral enzyme among different phylogenetic lineages (Todd et al. 2002), similar to the evolutionary process that shaped uracil DNA glycosylases (Aravarind and Koonin 2000). Our analysis indicates that RG activity may have evolved by this mechanism, because Clade B2 possesses both exo-RGs and exo-

PGs, while not including endo-RGs. This pattern suggests that exo-RGs have evolved from the exo-PG form of GH28 through active-site conversion, rather than through the gaining of exo-activity by the endo-RG isoenzyme.

21 22

Phylogenetic Relationships of GH28 Genes Among Phyla

Within the Dikarya, phylogenetic grouping of GH28 sequences corresponds primarily with enzyme function and not species phylogeny. GH28 gene copy number per genome is strongly positively correlated with the number of GH28 clades represented in the genome (Figure 2.3, r 2 = 0.88, P -value < 0.0001). Since the phylogenetic structure is

primarily based on enzyme function, number of GH28 clades can be considered a proxy

for its functional diversity within the Dikarya. Furthermore, GH28 copy number is also

strongly positively correlated with the number of different functional groups in which

those GH28 gene copies are categorized, including endo-PG, exo-PG, endo-RG, and exo-

RG (Figure 2.4, r2 = 0.61, P -value < 0.001). Fungal species lacking GH28 copies and functionally uncharacterized GH28s were removed from this analysis to avoid sampling bias. These results show that the presence of a high number of gene copies within a genome is generally indicative of a high level of GH28 functional diversity that genome.

In contrast to the GH28 phylogeny within Dikarya, Stramenopiles and

Mucoromycotina form two distinct and well-supported clades defined by phylogeny at the class or phylum level, rather than enzyme function. Despite possessing many morphological similarities to fungi, Stramenopiles are a distantly related taxonomic group that includes water molds (Oomycetes; Beakes and Sekimoto 2009). Unannotated

GH28s from the Stramenopiles Phytophthora ramorum and Phytophthora sojae reliably form a sister-group with Clade F (95% bootstrap support), and Clade F is made up primarily of endo-PGs from a wide range of distantly related Dikarya. This relationship supports an analysis by Gotesson et al. (2002), which shows GH28s from the

22 23

Stramenopile Phytophthora cinnamomi to be more closely related to fungal GH28s than with those from plants. Furthermore, Phytophthora species have been shown to have acquired many genes and gene families laterally from distantly related plant-degrading fungi (Andersson 2006, Soanes et al. 2007, Richards and Talbot 2007, Belbahri et al.

2007), and similar processes could have also resulted in the observed distribution of the pectinase gene family.

Mucoromycotina is a basal group of fungi “incertae sedis” (Hibbett et al. 2007),

and GH28s from this group form a well-supported clade of unannotated GH28 homologs.

The Mucoromycotina clade is composed of sequences from the species Rhizopus oryzae ,

Phycomyces blakesleeanus , and Mucor circinelloides . This phylogenetic pattern supports

the finding of previous studies showing that GH28s from Rhizopus oryzae form a distinct

monophyletic branch of this gene family (Mertens et al. 2008). The parsimony analysis

of the ancestral copy GH28 copy number and the observed gene copy number in this

clade is evidence of a large increase of GH28s within Rhizopus oryzae (23 copies)

following the Mucoromycotina/Dikarya split. In fact, recent genomic analyses suggest

that Rhizopus oryzae underwent a whole genome duplication, along with more recent

duplications of virulence factor genes such as secreted aspartic protease and subtilase

protein (Ma et al. 2009). However, because Mucor circinelloides has only 2 copies of

GH28, it is currently unclear whether there was a linage specific expansion restricted to

Rhizopus oryzae , or if there was an expansion in Mucoromycotina followed by lineage

specific gene loss in Mucor circinelloides . Greater taxon sampling in this basal fungal

group will help to clarify this issue.

23 24

Conclusions

Our results show that glycosyl hydrolase family 28 has experienced an extremely dynamic evolutionary history in fungi and is consistent with the birth-and-death process of gene family evolution. Lineage specific expansions and contractions in this gene family have broadly occurred, yet our analysis shows that the history of this gene family is primarily patterned according to enzymatic function and not species phylogeny. Our results indicate that the most recent common fungal ancestor possessed 2-4 GH28 copies, and based on this analysis it appears likely that those genes coded for an ancestral forms of exo-PG, endo-RG, and endo-PG. Based on its widespread species distribution and well-supported phylogenetic proximity to Mucoromycotina GH28s, we believe the most ancestral form of GH28 was likely endo-PG. Subsequent forms of GH28 arose through natural selection, possibly opening new molecular niches for GH28 enzymes. Greater taxonomic sampling is needed to evaluate if this pattern holds true in the

Mucoromycotina and Stramenopiles, since GH28s in these taxa are grouped by species phylogeny rather than by function. Finally, our results show that high GH28 copy number is strongly positively correlated with high levels of GH28 functional diversity.

This means it is likely that other fungi in the Eurotiales clade possess both high numbers of GH28 and corresponding high levels of functional diversity. Investigators seeking novel pectinase isoforms should look there first.

24 25

Fig. 2.1. Fungal Species Tree and Maximum Parsimony Reconstruction of Ancestral

GH8 Copy Number

25

26

Fig. 2.2.a. GH28 Neighbor-Joining Phylogenetic Reconstruction. * = likely mis-annotation

26

26

27

Fig. 2.2.b. GH28 Maximum-Likelihood Phylogenetic Reconstruction. * = likely mis-annotation

27

27 28

Fig 2.3 This scatterplot shows the relationship between GH28 copy number and the number of clades those copies occur. Pearson Correlation: r 2 = 0.88, P -value < 0.0001

28 29

Fig 2.4 This scatterplot shows the relationship between GH28 copy number and the number of different functional groups in which those GH28 gene copies are categorized, including endo-PG, exo-PG, endo-RG, and exo-RG. Fungal species lacking GH28 copies and functionally uncharacterized GH28s have been removed from this analysis. r2 = 0.61, P -value < 0.001

29

30

Chapter 3:

Fungal Glycosyl Hydrolase Family 28 Repertoire is Significantly Influenced by

Ecological Strategy

Introduction

A gene family is a set of genes with known sequence and structural homology that arise from the duplication and subsequent functional diversification of paralagous genes.

Gene duplications occur as the result of many well-described genetic processes, such as unequal crossing over, retroposition, or polyploidization (Ohno 1970, Hughes 1994,

Hughes 2002). These duplicated genes represent a genetic redundancy that may result in relaxation of selection pressure on one of the gene copies, which can then accumulate mutations that are neutral, deleterious, or confer a novel gene function (Prince and Pickett

2002). Genes with deleterious mutations are often purged from the genome via purifying selection, while genes with new functions can become fixed in the population through positive selection (Lynch et al. 2001, Hughes 2002, Lynch and Connery 2003). Genes involved in highly variable homeostatic processes, such as environmental sensing or immune response, have the highest rates of gene turnover (Zhang 2003), yet paralogous pairs of genes rarely diversify into different functional gene categories (Wapinski et al.

2007).

Members of one such gene family, Glycosyl Hydrolase Family 28 (GH28), catalyze the degradation of the structural carbohydrate pectin. As described in Chapter 2,

GH28s include both endo- and exo-acting polygalaturonases (PGs), rhamnogalaturonases

(RGs), and xylogalacturonases (XGs). Because cell wall penetration is often the first step in both plant infection and detrital decomposition, GH28 pectinases are used as

30 31 degradative enzymes by saprophytes (Kjøller and Struwe 2002) and virulence factors by fungal plant pathogens (Walton 1994, Herron et al. 2000, Reignault et al. 2008).

Although pectinases are generally considered fungal virulence factors, it is still unclear how important they are during plant infection. Phytopathogenic fungi can be classified into two general categories: biotrophs, which acquire energy from living host tissues, and necrotrophs, which kill infected tissue while liberating host nutrients. The extent that presence of GH28s in the species’ genome influences these strategies has not been determined. Targeted gene disruption studies have shown that various functional forms of PGs do play a role in fungal virulence (Garcia-Maceira et al. 2001, ten Have et al. 1998, Kars et al. 2005, Shieh et al. 1997, Wagner et al. 2000). In particular, Shieh et al. (1997) showed that in vivo disruption of pecA, a gene encoding PG, significantly reduced invasiveness of Aspergillus flavus in cotton bolls. However, several other studies have not found expression of GH28 genes to be critically important during cell wall invasion (Scott-Craig et al. 1990, Gao et al. 1996, Wagner et al. 2000). For example, Scott-Craig et al. (1990) found that the disruption of PGN1 , a gene encoding endoPG, had no significant effect on Cochliobolus carbonum ’s ability to infect maize.

This observed variability may be context dependent, so integrating molecular and ecological studies may be a way to advance our understanding of the evolution of molecular diversity at genetic loci involved in environmental sensing and response (de

Meaux and Mitchell-Olds 2003). Utilizing evolutionary approaches that integrate the

study of mechanisms that underlie genetic diversity within fungal genomes and

ecological factors such as life history strategy is useful for understanding the complex

31 32 host-pathogen interactions that determine pathogen invasiveness and host immune response (Barrett et al. 2008).

Previously we showed GH28 genes are both functionally diverse and widely distributed in fungal genomes (Fig. 2.1). The pattern of the gene phylogeny appears to be driven more by the enzyme function than by species evolutionary history. Thus, this study examines the evolutionary processes that have likely contributed to modern GH28 functional diversity and distribution in fungal genomes. We examine the hypothesis that genomic-scale factors are the major contributing force that determines GH28 copy number within a genome. If GH28 diversity and copy number are primarily determined by genome expansion, then we expect organisms with larger genomes to have concordantly higher numbers of GH28 copies than those with smaller genomes.

Alternately, because of the importance of pectinase in liberating carbon and energy in some environments, we postulate that the distribution of GH28 genes may be closely linked to the evolution of ecological niches. For example, some phytopathogens have undergone extensive lineage specific gene expansions in multiple gene families as compared to non-pathogenic relatives (Soanes et al. 2008, Powell et al. 2008). Previous studies have suggested that genes related to cell wall degradation are important in determining both the extent of invasiveness and the type of symptoms observed

(Reignault et al. 2008). If this is the case, then we expect pathogenic taxa to possess expanded extracellular enzyme repertoires and a greater number of GH28 genes, independent of species phylogeny or genome size. Fungal pathogens are not a monophyletic group, but rather are interspersed among non-pathogenic fungi (Bowman et al. 1996), making it possible to disentangle the effects of phylogeny from pathogenicity.

32 33

In this investigation, we test the hypotheses that copy number of GH28 genes is correlated with genome size, and that the occurrence of GH28s or particular clades of

GH28 (previously identified in Chapter 2 as an acceptable estimation of the functional categories endo-PG, exo-PG, endo-RG, and exo-RG for unannotated gene copies) are correlated with ecological strategy (pathogenic vs. nonpathogenic) and pathogenic lifestyle (nectrotrophic vs. biotrophic).

Methods

GH28 Evolution and Genome Size

A species tree was constructed using small subunit ribosomal RNA (SSU rRNA) sequences from 69 fungal species, including 57 Ascomycetes, 8 Basidiomycetes, 3

Mucoromycotinians, and 1 Chytridiomycotian, as well as 2 Stramenopiles and 1 plant to serve as an outgroup (Appendix 1). In order to be confident that all GH28 copies were identified in each genome, this investigation was restricted to fully sequenced genomes.

Relevant sequences were extracted from the SILVA database (Pruesse et al. 2007) and

Genbank (http://www.ncbi.nlm.nih.gov/) (Appendix 1) and aligned using the MUSCLE sequence alignment tool using default parameters available through the Geneious Pro

4.7.1 software package (Biomatters Ltd., Auckland, New Zealand). The maximum- likelihood based species tree was reconstructed as described in the Methods section of

Chapter 2.

GH28 homologs were also collected using BLASTp (Altschul et al. 1990) from the above 69 fully sequenced fungal genomes. Putative GH28 sequences were identified based on their sequence similarity to six diverse, yet well described GH28 members from

33 34 the filamentous fungus Aspergillus niger (Bussink et al. 1992a, de Vries and Visser 2001,

Martens-Uzunova et al, 2006, Martens-Uzunova and Schaap 2009) (Appendix 2).

Expectation E value cut-off = 0.001 was used. These six A. niger sequences were chosen as GH28 queries because they are representative of the six previously described general classifications of A. niger pectinases (endo-PG, exo-PG, endo-RG, exo-RG, endo-XG,

exo-XG), and the A. niger genome has been shown to possess up to 20 putative GH28 members (Martens-Uzunova and Schaap 2009). BLASTp hits were manually curated for accuracy. Sequences shorter than 250 residues, those missing the active site predicted in

PROSITE (http://ca.expasy.org/), missing the GH28 domain as defined in the Conserved

Domain Architecture Retrieval Tool (CDART; Geer et al. 2002), or missing other large portions of the gene were considered probable pseudogenes and excluded from further analyses. The final dataset included 293 GH28 members from 40 species. This dataset was also used in Chapter 2, in which each protein sequence has been assigned to Clades

A-F based on a reconstruction of its evolutionary history (see Fig 2.1)

Genome size and ecological strategy of each fungal species were identified from published studies. We recorded relevant information regarding plant and animal association or pathogenicity, and further subdivided plant pathogens into necrotrophs and biotrophs (Appendix 1). An Analysis of Variance (ANOVA) was use to test the hypothesis that GH28 copy number and genome size differed among necrotrophs, biotrophs, and non-pathogens. A two-tailed t-test assuming equal variance was used to

determine significant difference between groups. If GH28 copy number is primarily

dependent on genome size, then we expect to see no significant differences in GH28 copy

34 35 number between fungal species with genomes of similar size, regardless of pathogen type.

If genome size does not play an important role in determining GH28 copy number, we would expect to find no significant correlation between these two factors.

Pearson’s correlation coefficient was used to evaluate the relationship between GH28 copy number and genome size. We also used Felsenstein’s Independent Contrasts, a method that accounts for evolutionary relatedness (Felsenstein 1985b), to determine whether the number of GH28s in a genome was correlated with the total number of nucleotides in a genome, and hence whether genome-scale processes have played a role in GH28 diversification. Because this model assumes the random walk process of evolution, continuous character values were log 10 transformed. This was implemented

using the PDAP package in Mesquite (Midford et al. 2003). This relationship was

visualized by mapping GH28 copy number and genome size onto a mirror species

phylogeny constructed above using the parsimony based ancestral character state

reconstruction function in the Mesquite software package (Maddison and Maddison

2009).

GH28 Evolution and Ecological Strategy

Pagel’s correlation method (Pagel 1994) was used to evaluate the correlation

between ecological strategy and occurrence of GH28 or previously identified GH28

clades (see chapter 2). As implemented in Mesquite (Maddison and Maddison 2009),

this test takes into account branch length while estimating the rate of change in two

binary, discrete characters, and tests the hypothesis that traits are undergoing correlated

35 36 evolution without relying on ancestral character state reconstruction (Pagel 1994). Using the species tree topology derived from SSU rRNA phylogenetic tree, Mesquite calculates the log-likelihoods for two statistical models (Maddison and Maddison 2009). In the first model, the two binary characters are allowed to have evolved in an independent manner, while the second model assumes they are evolving as correlated traits (Pagel 1994).

Next, a null distribution is created by randomly assigning character states to the terminal tips of the tree via a Monte-Carlo simulation (Pagel 1994). Finally, a log-likelihood test is used to evaluate whether the independent or correlated models of character evolution best fit the given data (Pagel 1994). The null hypothesis that the two traits evolved independently can be rejected if the correlated model fits the data significantly better than the independent model (Pagel 1994). Distribution of GH28 presence/absence was examined for correlation with pathogenicity status (plant/animal pathogen, biotrophic/necrotrophic pathogen) (Appendix 1).

Results

GH28 Evolution and Genome Size

Our search for GH28 homologs yielded 293 GH28 members from 40 species. Our methods identified nearly the same number GH28 homologs that were identified by other studies examining the pectin degrading networks of Aspergillus niger (Martens-Uzunova and Schaap 2009), the white rot basidiomycete Phanerochaete chrysosporium

(Wymelenberg et al. 2005), and the zygomycete Rhizopus oryzae (Mertens et al. 2008).

This consistency allows us to ground our methods with supporting molecular evidence and lends confidence that we have identified all relevant GH28 homologs.

36 37

Plant pathogenic fungi (biotrophic and necrotrophic fungi) have significantly larger genomes than non-pathogenic fungi (Fig 3.1.a, P < 0.0001). Genome size of biotrophic and necrotrophic fungi does not significantly differ from one another (Fig 3.1.a, P =

0.91). In contrast, necrotrophic plant pathogens do have significantly more GH28 copies in their genome than both biotrophic fungi (Fig 3.1.b, P = 0.0007) and non-pathogens

(Fig 3.1.b, P < 0.0001). GH28 copy number is not significantly different between non- pathogens and biotrophic fungi (Fig 3.1.b, P = 0.75).

Genome size and GH28 copy number are significantly correlated (Fig 3.2, P <

0.05, r 2 = 0.10), and when the effect phylogeny is controlled for, Felsenstein’s

Independent Contrast correlation showed the same results (r 2 = 0.19, P < 0.0001). Figure

3.2 shows that biotrophs have genomes ranging in size from 10-90Mb and posses

relatively few GH28s. Conversely, necrotrophs all have genomes between 35-60Mb, yet

possess a wide range of GH28 copy numbers. Although these traits are significantly

correlated, these results leave 80-90% of the variability between these two traits

unexplained. The mirror phylogenetic tree in Figure 3.3 displays a parsimony-based

ancestral state reconstruction of both GH28 copy number and genome size. Evolutionary

patterns of genome size and GH28 copy number expansion or contraction among various

branches of the species phylogeny is apparent. Necrotrophic and biotrophic pathogens

are labeled for reference.

GH28 Evolution and Ecological Strategy

Pagel’s test for correlated binary characters showed that GH28 presence is not

correlated with a plant or animal pathogenic lifestyle ( P = 0.9, P = 0.9, respectively).

37 38

However, while possession of at least one GH28 copy was highly correlated with a necrotrophic lifestyle (P < 0.0001), it was not correlated with biotrophic pathogenicity ( P

= 0.74). The correlation between ecological strategy and presence of GH28 Clade F,

characterized in Chapter 2 as the endo-PG Clade, exhibited an identical pattern, whereas

other clades identified in Chapter 2 showed no correlation with pathogenicity status, with

the exception of Clade A. Fungi with GH28s in Clade A (Chapter 2), or the

rhamnogalacturonase clade, are significantly correlated with plant pathogenicity ( P =

0.01). Additionally there is a significant correlation between Clade A and necrotrophic

pathogenicity ( P < 0.0001), but not animal pathogenicity (P = 0.98) or biotrophic fungi

(P = 0.9).

Discussion

It has been demonstrated that fungi adapt to a pathogenic lifestyle by expanding gene families involved in host cell wall degradation (Soanes et al. 2008, Powell et al.

2008). Alternatively, the observed GH28 distribution and functional diversification (see

Chapter 2) could be an artifact of genome expansion and contraction. Here, we present evidence suggesting that correlated evolution between GH28 pectinase genes and pathogenic lifestyle determines both the extent of invasiveness and the mode of pathogenicity (i.e., necrotrophic or biotrophic).

GH28 Evolution and Genome Size

One hypothesis is that GH28 copy number is primarily determined as a result of genomic-scale factors including genome expansion and contraction. If this is the case,

38 39 we should observe phytopathogenic taxa to possess expanded extracellular enzyme repertoires and a greater number of GH28 genes. Phytopathogens in this dataset had significantly larger genomes than non-pathogenic fungi, and there was no detectable difference in genome size between necrotrophic and biotrophic pathogens. However, necrotrophs had significantly higher copy numbers of GH28 in their genomes than both biotrophs and non-pathogens, while copy number was statistically indistinguishable between biotrophs and non-pathogens. These results partially support our first hypothesis and suggest GH28 copy number may have been positively selected in necrotrophs, resulting in the observed lineage specific gene expansions. This is consistent with earlier studies that show extensive gene family expansion in pathogens as compared with non- pathogenic relatives (Soanes et al. 2008, Powell et al. 2008, Karlsson and Stenlid 2008).

However, this pattern does not hold true for biotrophic pathogens, which have significantly larger genomes than non-pathogens, but do not more possess more GH28s.

Both Pearson’s correlation coefficient and Felsenstein’s independent contrasts showed a significant correlation between genome size and GH28 copy number. However, variation in genome size only explained 10-20% of the total variability in GH28 copy number. Genome size certainly plays some role in determining the extent of gene family expansion, however these results suggest other factors such as ecological strategy may also contribute. Figure 3.2 shows that biotrophic and necrotrophic plant pathogens form loose groups. Necrotophs possess a wide range of GH28 copy numbers, but all have genomes 35-60Mb. Biotrophs contain very few GH28s, but have genomes ranging in size from 10-90Mb.

39 40

GH28 Evolution and Ecological Strategy

Because genome size only explains a small portion of the variability of GH28 diversity, we also tested the hypotheses that the occurrence of GH28s is correlated with ecological strategy (pathogenic vs. nonpathogenic) and pathogenic lifestyle (necrotrophic vs. biotrophic). Pagel’s test for correlated binary characters showed that the presence of

GH28 homologs in a genome is not correlated with a plant or animal pathogenic lifestyle.

However, when we analyzed the pathogen lifestyles (biotrophs or necrotrophs) separately, we found that necrotrophs were highly correlated with GH28 occurrence, while biotrophs were not. This suggests that the ability to degrade pectin using GH28 enzymes is more important to necrotrophic fungi than biotrophic fungi.

We also examined the correlation between ecological strategy and occurrence of previously described GH28 clades that were identified as approximate functional types for unannotated gene copies (see Chapter 2). Sequences in Clade A can be considered endo-RGs, sequences in Clades B-E are generally exo-PGs, while sequences in Clade F can be assumed to be endo-PGs. Pagel’s test showed no significant correlation between plant pathogenicity and Clades B - F. Fungi with endo-RGs in Clade A are significantly correlated with plant pathogens. This suggests that endo-RGs likely to be important to general pathogenic lifestyle.

Additionally, we found no significant relationship between biotrophy and GH28 occurrence or any GH28 sub-clade. However, we did find a strong correlation between a necrotrophic lifestyle and GH28 occurrence. This supports the findings of other studies that show GH28s are an important virulence factor in necrotrophs such as B. cinerea

(Kars et al. 2005) and A. flavus (Shieh et al. 1997), and suggests that GH28s are generally

40 41 important enzymes during necrotrophic lifestyle. Moreover, Clade A and Clade F were also correlated with a necrotrophic lifestyle, which suggests that endo-RGs and exo-PGs are also important to a necrotrophic lifestyle.

Necrotrophic vs. Biotrophic Fungal Phytopathogens

The evidence presented here strongly suggests that GH28 has experienced a

distinctly different evolutionary history in necrotrophic and biotrophic fungi. Fungi that

are primarily animal pathogens would have little use for an extensive pectin-degrading

network, and therefore their GH28 genes have likely been diminished through purifying

selection. Necrotrophs are characterized as pathogens that obtain carbon and energy by

killing and degrading plant tissues, while biotrophic fungi derive nutrients from living

host tissues, and are dependent on host survival for maintaining their own well being.

Therefore, while necrotrophs indiscriminately destroy cell wall constituents, biotrophs

must either enter host tissues through a stomal pore or selectively degrade only enough

cell wall components to be able to penetrate the cell wall, but not cause complete tissue

maceration and eventual host death. Biotrophs possess haustoria, which are specialized

hyphae used in nutrient absorption and metabolism (Mendgen and Hahn 2002). These

infection hyphae do not fundamentally differ from those of necrotrophic fungi, with the

notable exception that they do not induce host cell death. Biotrophs suppress host

defenses by strictly limiting secretory activity, especially that of lytic enzymes (Oliver

and Ipcho 2004).

Plants also have a wide array of immunological mechanisms for detecting and

responding to pathogen invasion. One such detection mechanism that plants use is

41 42 polygalacturonase-inhibiting proteins (PGIPs). PGIPs are extracellular plant proteins that can inhibit fungal PGs by forming PG-PGIP complexes (Federici et al. 2001). This interaction retards PG function, limits cell wall degradation and fungal growth, and additionally elicits further oligogalacturonide-mediated plant defense responses (De

Lorenzo et al. 2001). PGIPs are a diverse family of proteins that vary widely in their ability to inhibit PGs from different fungi or different PGs from the same fungus (Cook

1999, De Lorenzo et al. 2001, D’Ovidio et al. 2004). Both PGs and PGIPs possess a high degree of polymorphism, which necessitates this high level of intermolecular specificity

(D’Ovidio et al. 2004, Matteo et al. 2006). These interactions are so specific that a single amino acid substitution in a ligand PG can significantly decrease PGIP inhibition (Raiola et al. 2008, Casasoli et al. 2009).

The ability of PGIPs to distinguish invading fungal GH28s from their own pectin- modulating networks is determined by its leucine-rich repeat (LRR) structure (Federici et al. 2001, Matteo et al. 2006). This LRR region is found in several plant resistance genes

(R genes), which participate in gene-for-gene resistance (Federici et al. 2006). Gene-for- gene resistance describes the co-evolutionary molecular arms race between plants R genes and pathogen effectors, which often results in the wide expansion of both genetic repertoires (Chisholm et al. 2006 , Bent and Mackey 2007). PG-PGIP interactions display strikingly similar patterns, exhibiting a high level of GH28s structural diversity in necrotrophs that are likely evolving in a similar gene-for-gene manner (Federici et al.

2006). Conversely, saprotrophic fungi, which subsist on dead plant material, posses relative few GH28s on average because they do not experience the same co-evolutionary arms race that necrotrophic fungi experience while avoiding plant immune systems.

42 43

In addition to direct extracellular enzyme inhibition (Juge 2006), PGIPs also elicit host immune responses using oligosaccharins, or signal molecules released as a result of the fragmentation of cell wall homogalacturonan (Côté and Hahn 1994, Ridley et al.

2001). Oligosaccharins can elicit the hypersensitive response, where hosts actively initiate localized cell death though oxidative burst (Govrin and Levine 2000, Mayer et al.

2001). This self-induced apoptosis is thought to isolate the infected tissues to prevent the infection from spreading. However, this response facilitates the invasive activity of necrotrophic fungi (Govrin and Levine 2000). Recent studies suggest that necrotrophs may actively use complex molecular mechanisms to hijack plant hypersensitive response for their own benefit (Hammond-Kosack and Rudd 2008).

In contrast, biotrophs are adapted to living undetected in host tissues for long periods of time. Plant immune system elicitors, such as GH28s, have likely been deleted from the genomes of biotrophic fungi as a way of circumventing PGIP-mediated immune system activation. Furthermore, biotrophic fungi depend upon the infected host tissue to remain intact. The secretion of GH28s is strongly associated with tissue maceration and soft-rot diseases (Reignault et al. 2008), and increases the probably of secondary infection or host death. As an alternative to cell wall penetration by way of GH28 excretion, biotrophs use their extensive environmental sensing systems to recognize guard cells and redirect hyphal growth to enter through plant stoma (Mendgen and Hahn

2002). This allows them to gain access to intracellular nutrients without compromising the integrity of the host cell wall.

43 44

Conclusions

The evidence we present here regarding the genome size and the cell wall degrading network of pathogenic fungi is consistent with the body of literature concerning biotrophic and necrotrophic genetic repertoires. This study demonstrates that the lineage specific GH28 expansion observed in Chapter 2 is weakly but significantly correlated to a general increase in the genome size of necrotrophic fungi as compared to non-pathogens. These fungi have larger genomes and significantly more pectin-degrading enzymes that are used to indiscriminately degrade cell walls and instigate tissue maceration while avoiding PGIP-mediated plant immune responses.

Conversely, the observed GH28 repertoire of biotrophic fungi has likely resulted

from their ecological niche specificity. Biotrophic fungi have significantly larger

genomes than non-pathogens, but their pectin-degrading network is extremely limited.

GH28 gene products stimulate host plant hypersensitive immune response by way of

PGIP activation. The observed biotrophic fungi reduction in GH28 copy number is a

likely adaptation to an intracellular lifestyle that avoids host immune system detection

while not compromising host cell integrity. Utilizing an evolutionary approach allows us

to integrate genetic, genomic, and ecological data to better understand complex host-

parasite interactions.

44 45

Figure 3.1.a Bar graph showing the differences in the genome sizes (Mb) in biotrophic, necrotrophic, and non-pathogenic fungi. Non-Pathogen n = 48, Biotrophic n = 7,

Necrotrophic n = 17. F = 6.948, P = 0.0018

B

B

A

45 46

Figure 3.1.b Bar graph showing the differences in GH28 copy number in biotrophic, necrotrophic, and non-pathogenic fungi. Non-Pathogen n = 48, Biotrophic n = 7,

Necrotrophic n = 17. F = 25.72, P < 0.0001

B

A A

46 47

Figure 3.2 Scatterplot showing the relationship between genome size (Mb) and GH28 gene copy number. Biotrophs, necrotrophs, and non-pathogens are labeled, and groups of biotrophs and necrotrophs identified with colored ovals. Non-Pathogen n = 48,

Biotrophic n = 7, Necrotrophic n = 17. Pearson correlation: P < 0.05, r 2 = 0.10

47

48

Figure 3.3 Mirror Tree of fungal species. Genome size and GH28 copy number has been reconstructed using parsimony analysis.

Biotrophs and necrotrophs are identified. Felsenstein’s Contrast Correlation P < 0.0001, r 2 = 0.19

48

48 49

LITERATURE CITED

Abbott, D.W. and A.B. Boraston. 2007. The Structural Basis for Exopolygalacturonase

Activity in a Family 28 Glycoside Hydrolase. Journal of Molecular Biology 368:

1215-1222.

Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic Local

Alignment Search Tool. Journal of Molecular Biology 215: 403-410.

Andersson, J.O. 2006. Convergent Evolution: Gene Sharing by Eukaryotic Plant

Pathogens. Current Biology 16: 804-806.

Aravind, L. and E.V. Koonin. 2000. The α/β fold uracil DNA glycosylases: a common

origin with diverse fates. Genome Biology 1.

Barrett, L., P.H. Thrall, J.J. Burdon, and C.C. Linde. 2008. Life history determines

genetic structure and evolutionary potential of host–parasite interactions. Trends

in Ecology & Evolution 23: 678-685.

Beakes, G.W. and S. Sekimoto. 2009. The Evolutionary Phylogeny of Oomycetes –

Insights Gained from Studies of Holocarpic Parasites of Algae and Invertebrates.

Pages 1-24 in K. Lamour and S. Kamoun, eds. Oomycete Genetics and Genomics:

Diversity, Interactions, and Research Tools. USA: Wiley-Blackwell

Belbahri, L., G. Calmin, F. Mauch, J.O. Andersson. 2008. Evolution of the cutinase gene

family: Evidence for lateral gene transfer of a candidate Phytophthora virulence

factor. Gene 408: 1-8.

Bent, A.F. and D. Mackey. 2007. Elicitors, effectors, and R genes: The New Paradigm

and a Lifetime Supply of Questions. Annual Review of Phytopathology 45: 399-

436.

49 50

Biomatters Ltd. 2009. Geneious Pro 4.7.1 Software Package. Auckland, New Zealand.

Blair, J.E. 2009. Fungi. Pages 215-219 in S.B. Hedges and S. Kumar, eds. The Timetree

of Life. UK: Oxford University Press

Bowman, B.H., T.J. White, and J.W. Taylor. 1996. Human Pathogenic Fungi and Their

Close Nonpathogenic Relatives. Molecular Phylogenetics and Evolution 6: 89-96.

Brummell, D.A., V. Dal Cin, C.H. Crisosto, and J.M. Labavitch. 2004. Cell wall

metabolism during maturation, ripening and senescence of peach fruit. Journal of

Experimental Botany 55: 2029-2039.

Bussink, H.J.D., F.P. Buxton, B.A. Fraaye, L.H. de Graaff, and J. Visser. 1992. The

polygalacturonases of Aspergillus niger are encoded by a family of diverged

genes. European Journal of Biochemistry 208: 83-90.

Cantarel, B.L., P.M. Coutinho, C. Rancurel, T. Bernard, V. Lombard, and B. Henrissat.

2009. The Carbohydrate-Active EnZymes database (CAZy): an expert resource

for Glycogenomics. Nucleic Acids Research 37: D233-D238.

Casasoli, M., L. Federici, F. Spinelli, A. Di Matteo, N. Vella, F. Scaloni, J. Fernandez-

Recio, F. Cervone, and G. De Lorenzo. 2009. Integration of evolutionary and

desolvation energy analysis identifies functional sites in a plant immunity protein.

Proceedings of the National Academy of Sciences 106: 7666-7671.

Chisholm, S.T., G. Coaker, B. Day, and B.J. Staskawicz. 2006. Host-microbe

interactions: shaping the evolution of the plant immune response. Cell 124: 803-

814.

50 51

Cliften, P.F., R.S. Fulton, R.K. Wilson, and M. Johnson. 2005. After the Duplication:

Gene Loss and Adaptation in Saccharomyces Genomes. Genetics 172: 863-872.

Cook, B.J., R.P. Clay, C.W. Bergmann, P. Albersheim, and A.G. Darvill. 1999. Fungal

Polygalacturonases Exhibit Different Substrate Degradation Patterns and Differ in

Their Susceptibilities to Polygalacturonase-Inhibiting Proteins. Molecular Plant-

Microbe Interactions 12: 703-711.

Côté, F. and M.G. Hahn. 1994. Oligosaccharins: structures and signal transduction. Plant

Molecular Biology 26: 1379-1411.

D'Ovidio, R., B. Mattei, S. Roberti, and D. Bellincampi. 2004. Polygalacturonases,

polygalacturonase-inhibiting proteins and pectic oligomers in plant–pathogen

interactions. Biochimica et Biophysica Acta -Proteins and Proteomics 1696: 237-

244.

De Lorenzo, G., R. D'Ovidio, and F. Cervone. 2001. The Role of Polygalacturonase-

Inhibiting Proteins (PGIPs) in Defense Against Pathogenic Fungi. Annual

Review of Phytopathology 39: 313-335. de Meaux, J., and T. Mitchell-Olds. 2003. Evolution of plant resistance at the molecular

level: ecological context of species interactions. Heredity 91: 345-352. de Vries, R.P., and J. Visser. 2001. Aspergillus Enzymes Involved in Degradation of

Plant Cell Wall Polysaccharides. Microbiology and Molecular Biology Reviews

65: 497-522.

de Vries, R.P., J. Jansen, G Aguilar, L. Pa řenicová, V. Joosten, F. Wülfert, J.A.E. Benen,

J. Visser. 2002. Expression profiling of pectinolytic genes from Aspergillus niger .

FEBS Letters 530: 41-47.

51 52 de Vries, R.P. 2003. Regulation of Aspergillus genes encoding plant cell wall

polysaccharide-degrading enzymes; relevance for industrial production. Applied

Microbiology and Biotechnology 61: 10-20.

Di Matteo, A., D. Bonivento, D. Tsernoglou, L. Federici, and F. Cervone. 2006.

Polygalacturonase-inhibiting protein (PGIP) in plant defense: a structural view.

Phytochemistry 67: 528-533.

Dias, F.M.V., F. Vincent, G. Pell, J.A.M. Prates, M.S.J. Centeno, L.E. Tailford, L.

Ferreira, C.M.G.A. Fontes, G.J. Davies, and H.J. Gilbert. 2004. Insights into the

Molecular Determinants of Substrate Specificity in Glycoside Hydrolase Family 5

Revealed by the Crystal Structure and Kinetics of Cellvibrio mixtus Mannosidase

5A. Journal of Biological Chemistry 279: 25517-25526.

Edgar, R.C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Research 32: 1792-1797.

Federici, L., C. Caprari, B. Mattei, C. Savino, A. Di Matteo, G. De Lorenzo, F. Cervone,

and D. Tsernoglou. 2001. Structural requirements of endopolygalacturonase for

the interaction with PGIP (polygalacturonase-inhibiting protein). Proceedings of

the National Academy of Sciences 98: 13425-13430.

Federici, L., A. Di Matteo, J. Fernandez-Recio, D. Tsernoglou, and F. Cervone. 2006.

Polygalacturonase inhibiting proteins: players in plant innate immunity? Trends in

Plant Science 11: 65-70.

Felsenstein, J. 1985a. Phylogenies and the comparative method. American Naturalist 125:

1-15.

52 53

Felsenstein, J. 1985b. Confidence limits on phylogenies: an approach using the bootstrap.

Evolution 783-791.

Gao, S., G.H. Choi, L. Shain, and D.L. Nuss. 1996. Cloning and Targeted Disruption of

enpg-1, Encoding the Major In Vitro Extracellular Endopolygalacturonase of the

Chestnut Blight Fungus, Cryphonectria parasitica . Applied and Environmental

Microbiology 62: 1984-1990.

Garcia-Maceira, F., A. Di Pietro, M.D. Huertas-González, M.C. Ruiz-Roldán, and M.I.G.

Roncero. 2001. Molecular characterization of an endopolygalacturonase from

Fusarium oxysporum Expressed during Early Stages of Infection. Applied and

Environmental Microbiology 67: 2191-2196.

Geer, L.Y., M. Domrachev, D.J. Lipman, and S.H. Bryant. 2002. CDART: Protein

Homology by Domain Architecture. Genome Research 12: 1619-1623.

Geiser, D.M., C. Gueidan, J. Miadlikowska, F. Lutzoni, F. Kauff, V. Hofstetter, E.

Fraker, C.L. Schoch, L. Tibell, and W.A. Untereiner. 2006. Eurotiomycetes:

Eurotiomycetidae and Chaetothyriomycetidae. Mycologia 98: 1053-1064.

Gherardini, P.F., M.N. Wass, M. Helmer-Citterich, and M.J.E. Sternberg. 2007.

Convergent Evolution of Enzyme Active Sites Is not a Rare Phenomenon. Journal

of Molecular Biology 372: 817-845.

Götesson, A., J.S. Marshall, D.A. Jones, and A.R. Hardham. 2002. Characterization and

Evolutionary Analysis of a Large Polygalacturonase Gene Family in the

Oomycete Plant Pathogen Phytophthora cinnamomi . Molecular Plant-Microbe

Interactions 15: 907-921.

53 54

Govrin, E.M. and A. Levine. 2000. The hypersensitive response facilitates plant infection

by the necrotrophic pathogen Botrytis cinerea . Current Biology 10: 751-757.

Guindon, S. and O. Gascuel. 2003. A Simple, Fast, and Accurate Algorithm to Estimate

Large Phylogenies by Maximum Likelihood. Systematic Biology 52: 696-704.

Hadfield, K.A. and A.B. Bennett. 1998. Polygalacturonases: Many Genes in Search of a

Function. Plant Physiology 117: 337-343.

Hammond-Kosack, K.E. and J.J. Rudd. 2008. Plant resistance signaling hijacked by a

necrotrophic fungal pathogen. Plant Signaling & Behavior 3: 993-995.

Henrissat, B. 1991. A classification of glycosyl hydrolases based on amino acid sequence

similarities. Biochemical Journal 280: 309-316.

Henrissat, B. and A. Bairoch. 1993. New families in the classification of glycosyl

hydrolases based on amino acid sequence similarities. Biochemical Journal 293:

781-788.

Henrissat, B. and G. Davies. 1997. Structural and sequence-based classification of

glycoside hydrolases. Current Opinion in Structural Biology 7: 637-644.

Herron, S.R., J.A.E. Benen, R.D. Scavetta, J. Visser, and F. Jurnak. 2000. Structure and

function of pectic enzymes: Virulence factors of plant pathogens. Proceedings of

the National Academy of Sciences 97: 8762-8769.

Hibbett, D.S., M. Binder, J.F. Bischoff, M. Blackwell, P.F. Cannon, O.E. Eriksson, S.

Huhndorf, T. James, P.M. Kirk, R. Lücking H.T. Lumbsch, F. Lutzoni, P.B.

Matheny, D. J. Mclaughlin, M. J. Powell, S. Redhead , C.L. Schoch, J.W.

Spatafora, J.A. Stalpers, R. Vilgalys, M.C. Aime, A. Aptroot, R. Bauer, D.

Begerow, G.L. Benny, L.A. Castlebury, P.W. Crous, Y. Dai, W. Gams, D.M.

54 55

Geiser, G.W. Griffith, C. Gueidan, D.L. Hawksworth, G. Hestmark, K. Hosaka,

R.A. Humber, K.D. Hyde, J.E. Ironside, Urmas Kõljalg, C.P. Kurtzman, K.

Larsson, R. Lichtwardt, J. Longcore, J. Miadlikowska, A. Miller, J. Moncalvo, S.

Mozley-Standridge, F. Oberwinkler, E. Parmasto, V. Reeb, J. D. Rogers, C. Roux,

L. Ryvarden, J.P. Sampaio, A. Schüßler, J. Sugiyama, R. G. Thorn, L. Tibell, W.

A. Untereiner, C. Walker, Z. Wang, A. Weir, M. Weiss, M.M. White, K. Winka,

Y. Yao, and N. Zhang. 2007. A higher-level phylogenetic classification of the

Fungi. Mycological Research 111: 509-547.

Hughes, A.L. 1994. The Evolution of Functionally Novel Proteins after Gene

Duplication. Proceedings: Biological Sciences 256: 119-124.

Hughes, A.L. 2002. Adaptive evolution after gene duplication. Trends in Genetics 18:

433-434.

James, T.Y., F. Kauff, C.L. Schoch, P. B. Matheny, V. Hofstetter, C.J. Cox, G. Celio, C.

Gueidan, E. Fraker, J. Miadlikowska, H.T. Lumbsch, A. Rauhut, V. Reeb, A.E.

Arnold, A. Amtoft, J.E. Stajich, K. Hosaka, G. Sung, D. Johnson, B. O’rourke, M.

Crockett, M. Binder, J.M. Curtis, J.C. Slot, Z. Wang, A.W. Wilson, A. Schüßler,

J.E. Longcore, K. O’donnell, S. Mozley-Standridge, D. Porter, P.M. Letcher, M.J.

Powell, J.W. Taylor, M.M. White, G.W. Griffith, D.R. Davies, R.A. Humber, J.B.

Morton, J. Sugiyama, A.Y. Rossman, J.D. Rogers, D.H. Pfister, D. Hewitt, K.

Hansen, S. Hambleton, R.A. Shoemaker, J. Kohlmeyer, B. Volkmann-Kohlmeyer,

R.A. Spotts, M. Serdani, P.W. Crous, K.W. Hughes, K. Matsuura, E. Langer, G.

Langer, W.A. Untereiner, R. Lücking, B. Büdel, D.M. Geiser, A. Aptroot, P.

Diederich, I. Schmitt, M. Schultz, R. Yahr, D.S. Hibbett, F. Lutzoni, D.J.

55 56

Mclaughlin, J.W. Spatafora, and R. Vilgalys. 2006. Reconstructing the early

evolution of Fungi using a six-gene phylogeny. Nature 443: 818-822.

Jordan, I.K., K.S. Makarova, J.L. Spouge, Y.I. Wolf, and E.V. Koonin. 2001. Lineage-

Specific Gene Expansions in Bacterial and Archaeal Genomes. Genome Research

11: 555-565.

Juge, N. 2006. Plant protein inhibitors of cell wall degrading enzymes. Trends in Plant

Science 11: 359-367.

Karlsson, M. and J. Stenlid. 2008. Comparative Evolutionary Histories of the Fungal

Chitinase Gene Family Reveal Non-Random Size Expansions and Contractions

due to Adaptive Natural Selection. Evolutionary Bioinformatics 4: 47-60.

Kars, I., G. Krooshof, L. Wagemakers, R. Joosten, J.A.E. Benen, and J.A.L. Kan. 2005.

Necrotizing activity of five Botrytis cinerea endopolygalacturonases produced in

Pichia pastoris . The Plant Journal 43: 213-225.

Kim, J., S. Shiu, S. Thoma, W. Li, and S.E. Patterson. 2006. Patterns of expansion and

expression divergence in the plant polygalacturonase gene family. Genome

Biology 7.

Kjøller, A.H. and S. Struwe. 2002. Fungal Communities, Succession, Enzymes, and

Decomposition. In R.G. Burns and R.P. Dick, eds. Enzymes in the environment:

activity, ecology, and applications. New York, NY: Marcel Dekker, Inc.

Kusters-van Someren, M.A., J.A.M. Harmsen, H.C.M. Kester, and J. Visser. 1991.

Structure of the Aspergillus niger pelA gene and its expression in Aspergillus

niger and Aspergillus nidulans . Current Genetics 20: 293-299.

56 57

Lespinet, O., Y.I. Wolf, E.V. Koonin, and L. Aravind. 2002. The Role of Lineage-

Specific Gene Family Expansion in the Evolution of Eukaryotes. Genome

Research 12: 1048-1059.

Lehninger, A.L. 2005. In A.L. Lehninger, D.L. Nelson, and M.M. Cox, eds. Lehninger

Principles of Biochemistry. 4 th Ed. USA: Macmillan

Lynch, M., M. O'Hely, B. Walsh, A. Force. 2001. The Probability of Preservation of a

Newly Arisen Gene Duplicate. Genetics 159: 1789-1804.

Lynch, M. and J.S. Conery. 2003. The Origins of Genome Complexity. Science 302:

1401-1404.

Ma, L., A. Ibrahim, C. Skory, M. Grabherr, G. Burger, M. Butler, M. Elias, A. Idnurm,

B.F. Lang, T. Sone, A. Abe, S.E. Calvo, L.M. Corrochano, R. Engels, J. Fu, W.

Hansberg, J. Kim, C.D. Kodira, M.J. Koehrsen, B. Liu, D. Miranda-Saavedra, S.

O’Leary, L. Ortiz-Castellanos, R. Poulter, J. Rodriguez-Romero, J. Ruiz-Herrera,

Y. Shen, Q. Zeng, J. Galagan, B.W. Birren, C.A. Cuomo, and B.L. Wickes. 2009.

Genomic Analysis of the Basal Lineage Fungus Rhizopus oryzae Reveals a

Whole-Genome Duplication. PLoS Genetics 5: 1-11.

Machida, M, K. Asai, M. Sano, T. Tanaka, T. Kumagai, G. Terai, K.I. Kusumoto, T.

Arima, O. Akita, Y. Kashiwagi, K. Abe, K. Gomi, H. Horiuchi, K. Kitamoto, T.

Kobayashi, M. Takeuchi, D.W. Denning, J.E. Galagan, W.C. Nierman, J. Yu,

D.B. Archer, J.W. Bennett, D. Bhatnagar, T.E. Cleveland, N.D. Fedorova, O.

Gotoh, H. Horikawa, A. Hosoyama, M. Ichinomiya, R. Igarashi, K. Iwashita, P.R.

Juvvadi, M. Kato, Y. Kato, T. Kin, A. Kokubun, H. Maeda, N. Maeyama, J.

Maruyama, H. Nagasaki, T. Nakajima, K. Oda, K. Okada, I. Paulsen, K.

57 58

Sakamoto, T. Sawano, M. Takahashi, K. Takase, Y. Terabayashi, J.R. Wortman,

O. Yamada, Y. Yamagata, H. Anazawa, Y. Hata, Y. Koide, T. Komori, Y.

Koyama, T. Minetoki, S. Suharnan, A. Tanaka, K. Isono, S. Kuhara N.

Ogasawara, and H. Kikuchi. 2005. Genome sequencing and analysis of

Aspergillus oryzae . Nature 438: 1157-1161.

Maddison, W.P. and D.R. Maddison. 2009. Mesquite: a Modular System for

Evolutionary Analysis. Ver. 2.6. USA.

Markovi č, O. and S. Jane ček. 2001. Pectin degrading glycoside hydrolases of family 28:

sequence-structural features, specificities and evolution. Protein Engineering

Design and Selection 14: 615-631.

Martens-Uzunova, E.S., J.S. Zandleven, J.A.E. Benen, H. Awad, H.J. Kools, G.

Beldman, A.G.J. Voragen, J.A. Van Den Berg, and P.J. Schaap. 2006. A new

group of exo-acting family 28 glycoside hydrolases of Aspergillus niger that are

involved in pectin degradation. Biochemistry Journal 400: 43-52.

Martens-Uzunova, E.S. and P.J. Schaap. 2009. Assessment of the pectin degrading

enzyme network of Aspergillus niger by functional genomics. Fungal Genetics

and Biology 46: S170-S179.

Matsunaga, T., T. Ishii, S. Matsumoto, M. Higuchi, A. Darvill, P. Albersheim, and M.A.

O'Neill. 2004. Occurrence of the Primary Cell Wall Polysaccharide

Rhamnogalacturonan II in Pteridophytes, Lycophytes, and Bryophytes.

Implications for the Evolution of Vascular Plants. Plant Physiology 134: 339-351.

Mendgen, K. and M. Hahn. 2002. Plant infection and the establishment of fungal

biotrophy. Trends in Plant Science 7: 352-356.

58 59

Mertens, J.A., R.C. Burdick, and A.P. Rooney. 2008. Identification, biochemical

characterization, and evolution of the Rhizopus oryzae 99–880 polygalacturonase

gene family. Fungal Genetics and Biology 45: 1616-1624.

Midford, P.E., T. Garland, and W.P. Maddison. 2003. PDAP package of Mesquite. USA.

Mohnen, D. 2008. Pectin structure and biosynthesis. Current Opinion in Plant Biology

11: 266-277.

Morgutti, S., N. Negrini, F.F. Nocito, A. Ghiani, D. Bassi, and M. Cocucci. 2006.

Changes in endopolygalacturonase levels and characterization of a putative endo-

PG gene during fruit softening in peach genotypes with nonmelting and melting

flesh fruit phenotypes. New Phytologist 171: 315-328.

Nei, M., X. Gu, and T. Sitnikova. 1997. Evolution by the birth-and-death process in

multigene families of the vertebrate immune system. Proceedings of the National

Academy of Sciences 94: 7799-7806.

Nei, M., and S. Kumar. 2000. Page 43 in Molecular Evolution and Phylogenetics. UK:

Oxford University Press

Nei, M. and A.P. Rooney. 2005. Concerted and Birth-and-Death Evolution of Multigene

Families. Annual Review of Genetics 39: 121-152.

Ohno, S. 1970. Evolution by Gene Duplication. USA: Springer-Verlag

O'neill, M.A., T. Ishii, P. Albersheim, and A.G. Darvill. 2004. Rhamnogalacturonan II:

Structure and Function of a Borate Cross-Linked Cell Wall Pectic Polysaccharide.

Annual Review of Plant Biology 55: 109-139.

59 60

Oliver, R.P. and S.V.S. Ipcho. 2004. Arabidopsis pathology breathes new life into the

necrotrophs-vs.-biotrophs classification of fungal pathogens. Molecular Plant

Pathology 5: 347-352.

Pagel, M. 1994. Detecting Correlated Evolution on Phylogenies: a General Method for

the Comparative Analysis of Discrete Characters. Proceedings: Biological

Sciences: 37-45.

Park, K.-C., S.-J. Kwon, P.-H. Kim, T. Bureau, and N.-S. Kim. 2008. Gene structure

dynamics and divergence of the polygalacturonase gene family of plants and

fungus. Genome 51: 30-40.

Pérez, S., K Mazeau, and C. Hervé du Penhoat. 2000. The three-dimensional structures of

the pectic polysaccharides. Plant Physiology and Biochemistry 38: 37-55.

Powell, A.J., G.C. Conant, D.E. Brown, I. Carbone, and R.A. Dean. 2008. Altered

patterns of gene duplication and differential gene gain and loss in fungal

pathogens. BMC Genomics 9.

Pressey, R. and J.K. Avants. 1973. Separation and Characterization of

Endopolygalacturonase and Exopolygalacturonase from Peaches. Plant

Physiology 52: 252-256.

Prince, V.E. and F.B. Pickett. 2002. Splitting pairs: the diverging fates of duplicated

genes. Nature Reviews - Genetics 3: 827-837.

Proctor, M.R., E.J. Taylor, D. Nurizzo, J.P. Turkenburg, R.M. Lloyd, M. Vardakou, G.J.

Davies, and H.J. Gilbert. 2005. Tailored catalysts for plant cell-wall degradation:

Redesigning the exo/endo preference of Cellvibrio japonicus arabinanase 43A.

Proceedings of the National Academy of Sciences 102: 2697-2702.

60 61

Pruesse, E., C. Quast, K. Knittel, B.M. Fuchs, W. Ludwig, J. Peplies, and F.O. Glöckner.

2007. SILVA: a comprehensive online resource for quality checked and aligned

ribosomal RNA sequence data compatible with ARB. Nucleic Acids Research 35:

7188-7196.

Raiola, A., L. Sella, C. Castiglioni, V. Balmas, and F. Favaron. 2008. A single amino

acid substitution in highly similar endo-PGs from Fusarium verticillioides and

related Fusarium species affects PGIP inhibition. Fungal Genetics and Biology

45: 776-789.

Rambaut, A. 2007. FigTree 1.2.1 Visualization Software. UK.

Reignault, P., O. Valette-Collet, and M. Boccara. 2008. The importance of fungal

pectinolytic enzymes in plant invasion, host adaptability and symptom type.

European Journal of Plant Pathology 120: 1-11.

Richards, T.A. and N.J. Talbot. 2007. Plant Parasitic Oomycetes Such as Phytophthora

Species Contain Genes Derived from Three Eukaryotic Lineages. Plant Signaling

& Behavior 2: 112-114.

Ridley, B.L., M.A. O'Neill, and D. Mohnen. 2001. Pectins: structure, biosynthesis, and

oligogalacturonide-related signaling. Phytochemistry 57: 929-967.

Rouvinen, J., T. Bergfors, T. Teeri, J.K. Knowles, and T.A. Jones. 1990. Three-

Dimensional Structure of Cellobiohydrolase II from Trichoderma reesei . Science

249: 380-386.

61 62

Scott-Craig, J.S., D.G. Panaccione, F. Cervone, and J.D. Walton. 1990.

Endopolygalacturonase Is Not Required for Pathogenicity of Cochliobolus

carbonum on Maize. The Plant Cell Online 2: 1191-1200.

Shieh M.T., R.L. Brown, M.P. Whitehead, J.W. Cary, P.J. Cotty, T.E. Cleveland, and

R.A. Dean. 1997. Molecular Genetic Evidence for the Involvement of a Specific

Polygalacturonase, P2c, in the Invasion and Spread of Aspergillus flavus in Cotton

Bolls. Applied and Environmental Microbiology 63: 3548 -3552.

Sinsabaugh, R.L., M.M. Carreiro, and S. Alvarez. 2002. Enzyme and Microbial

Dynamics of Litter Decomposition. In R.G. Burns and R.P. Dick, eds. Enzymes in

the environment: activity, ecology, and applications. New York, NY: Marcel

Dekker, Inc.

Soanes, D.M., T.A. Richards, and N.J. Talbot. 2007. Insights from Sequencing Fungal

and Oomycete Genomes: What Can We Learn about Plant Disease and the

Evolution of Pathogenicity? The Plant Cell 19: 3318-3326.

Soanes, D.M., I. Alam, M. Cornell, H.M. Wong, C. Hedeler, N.W. Paton, M. Rattray, S.J.

Hubbard, S.G. Oliver, and N.J. Talbot. 2008. Comparative Genome Analysis of

Filamentous Fungi Reveals Gene Family Expansions Associated with Fungal

Pathogenesis. PLoS ONE 3.

Sriamornsak, P. 2003. Chemistry of Pectin and its Pharmaceutical Uses: A Review.

Silpakorn University International Journal 3: 206-228.

Sriamornsak, P., S. Sungthongjeen, and S. Puttipipatkhachorn. 2007. Use of pectin as a

carrier for intragastric floating drug delivery: Carbonate salt contained beads.

Carbohydrate Polymers 67: 436-445.

62 63 ten Have, A., W. Mulder, J. Visser, and J. van Kan. 1998. The Endopolygalacturonase

Gene Bcpg1 is Required for Full Virulence of Botrytis cinerea . Molecular Plant-

Microbe Interactions 11: 1009-1016.

Todd, A.E., C.A. Orengo, and J.M. Thornton. 2002. Plasticity of enzyme active sites.

Trends in Biochemical Sciences 27: 419-426. van Pouderoyen, G., H.J. Snijder, J.A.E. Benen, and B.W. Dijkstra. 2003. Structural

insights into the processivity of endopolygalacturonase I from Aspergillus niger .

FEBS Letters 554: 462-466.

Wagner, F., H. Kusserow, and W. Schafer. 2000. Cloning and targeted disruption of two

polygalacturonase genes in Penicillium olsonii . FEMS Microbiology Letters 186:

293-299.

Walton, J.D. 1994. Deconstructing the cell wall. Plant Physiology 104: 1113-1118.

Wang, D.Y.-C., S. Kumar, S.B. Hedges. 1999. Divergence time estimates for the early

history of animal phyla and the origin of plants, animals and fungi. Proceedings of

the Royal Society B: Biological Sciences 266: 163-171.

Wapinski, I., A. Pfeffer, N. Friedman, and A. Regev. 2007. Natural history and

evolutionary principles of gene duplication in fungi. Nature 449: 54-61.

Willats, W.G.T., L. McCartney, W. Mackie, and J.P. Knox. 2001. Pectin: cell biology

and prospects for functional analysis. Plant Molecular Biology 47: 9-27.

Willats, W.G.T., J.P. Knox, and J.D. Mikkelsen. 2006. Pectin: new insights into an old

polymer are starting to gel. Trends in Food Science & Technology 17: 97-104.

Wymelenberg, A.V., G. Sabat, D. Martinez, A.S. Rajangam, T.T. Teeri, J. Gaskell, P.J.

Kersten, and D. Cullen. 2005. The Phanerochaete chrysosporium secretome:

63 64

Database predictions and initial mass spectrometry peptide identifications in

cellulose-grown medium. Journal of Biotechnology 118: 17-34.

Zhang, J. 2003. Evolution by gene duplication: an update. Trends in Ecology &

Evolution 18: 292-298.

64

65

APPENDIX 1

Appendix 1.a.:Summary Table of Organisms Used in this Study

Genome Biotrophic Necrotrophic Animal Organism SSUrRNA Size GH28 References Pathogen Pathogen Pathogen (Mb) Aspergillus clavatus NRRL 1 AB008398 27.85 3 No No No Fedorova et al. 2008 St. Leger et al. 2000, Aspergillus flavus NRRL3357 D63696 36.79 19 No Yes Yes Cleveland et al. 2009, Krishnan et al. 2009 St. Leger et al. 2000, Aspergillus fumigatus AB008401 29.38 11 No No Yes Takaia and Latgé 2005 Aspergillus nidulans FGSC AB008403 30.07 9 No No No St. Leger et al. 2000 A4 Aspergillus niger CBS 513.88 D63697 37.2 20 No Yes Yes Schuster et al. 2002 Aspergillus oryzae RIB40 EU680477 37.12 17 No No No Machida et al. 2005 Aspergillus terreus AF516138 29.33 7 No No Yes Walsh et al. 2003 Batrachochytrium Piotrowski et al. 2004, AF164301S1 23.72 0 No No Yes dendrobatidis JEL423 James et al. 2009 Blastomyces dermatitidis Bowman et al. 1996, slh14081 (Ajellomyces M63096 75.35 0 No No Yes Burgess et al. 2006 dermatitidis) Botrytis cinerea EF110887 42.66 15 No Yes No van Kan 2006 (Botryotinia fuckeliana) Jones et al. 2004, Candida albicans SC5314 AF114470 14.32 0 No No Yes Braun et al. 2005 Candida glabrata CBS 138 AY046237 12.28 0 No No Yes Fidel et al. 1999 65 65

66

Genome Biotrophic Necrotrophic Animal Organism SSUrRNA Size GH28 References Pathogen Pathogen Pathogen (Mb) Arras et al. 2002, Candida guilliermondii AB013587 10.61 0 No No Yes Desnos-Ollivier et al. (Pichia guilliermondii) 2008 Candida lusitaniae Ruprich-Robert et al. AAFT01000066 12.11 0 No No Yes (Clavispora lusitaniae) 2008 Carruba et al. 1991, Candida parapsilosis AB013588 13.09 0 No No Yes Nosek et al. 2002 Candida tropicalis MYA- EF374095 14.48 0 No No Yes Okawa et al. 2008 3404 Chaetomium globosum CBS J.H. Park et al. 2005, AY545725 34.89 1 No No Yes 148.51 Istifadah et al. 2006 Koufopanou et al. Coccidioides immitis H538.4 X58571 27.37 0 No No Yes 2001, Lopes et al. 2008 Koufopanou et al. Coccidioides posadasii str. ABBB01000249 27.47 0 No No Yes 2001, Mandel et al. Silveira 2006 Lev et al. 1999, Igbaria Cochliobolus heterostrophus AY544727 34.9 4 No Yes No et al. 2008 Coprinopsis cinerea Ulrich et al. 2007, M92991 36.29 2 No No No okayama7#130 Mshandete et al. 2008 Cryptococcus neoformans Ito-Kuwa et al. 2008, BR000310 18.87 1 No No Yes var. grubii Lin 2009 Desnos-Ollivier et al. Debaryomyces hansenii AB070854 12.22 0 No No Yes 2008 Eremothecium gossypii 8.74 Wendland and Walther (Ashbya gossypii ATCC AY046265 0 Yes No Yes 2005 10895) 66

66

67

Genome Biotrophic Necrotrophic Animal Organism SSUrRNA Size GH28 References Pathogen Pathogen Pathogen (Mb) Fusarium graminearum Urban et al. 2003, AB250414 36.45 6 No Yes No (Gibberella zeae) Hussein et al. 2003, Rodríguez-Gálvez and Fusarium oxysporum f. sp. DQ916150 61.36 13 No Yes No Mendgen 1995, lycopersici 4286 Lievens et al. 2007 Fusarium verticillioides (Gibberella moniliformis AAIM02000198 41.78 7 No Yes No Yates et al. 2005 7600) Histoplasma capsulatum Stobierski et al. 1996, nam1 (Ajellomyces X58572 32.99 0 No No Yes Kasuga et al. 2003 capsulatus NAm1) Kluyveromyces lactis NRRL Chen and Clark- AY790534 10.69 0 No No No Y-1140 Walker 1995 Prasad et al. 2005, Kluyveromyces X89526 10.6 0 No No No Kapsopoulou et al. thermotolerans 2005 Martin and Selosse Laccaria bicolor S238N-H82 ABFE01004153 65 4 No No No 2008 Lodderomyces elongisporus X78600 15.51 0 No No Yes Lockhart et al. 2007 NRRL YB-4239 Magnaporthe grisea 70-15 Guerber and TeBeest AB026819 41.7 1 Yes No No (Pyricularia grisea) 2006 Microsporum canis cbs ABVF01000123 25.26 0 No No Yes Vermout et al. 2008 113480 Microsporum gypseum cbs 23.27 Hedayati et al. 2004, 118893 (Arthroderma ABQE01000223 0 No No Yes Sun and Ho 2006 gypseum) 67

67

68

Genome Biotrophic Necrotrophic Animal Organism SSUrRNA Size GH28 References Pathogen Pathogen Pathogen (Mb) Mucor circinelloides Wolff et al. 2002, CBS277.49 AF113427 36.5 2 No Yes Yes Dizbay et al. 2009 (Rhizomucor circinelloides) Rivas et al. 2004, Cruz- Mycosphaerella fijiensis DQ767652 73.4 5 Yes No No Cruz et al. 2009 Mehrabi et al. 2006, Mycosphaerella graminicola EU090238 39.7 2 Yes No No Torriani et al. 2008 González-Candelas and Nectria haematococca AC166539 40 9 No Yes Yes Kolattukudy 1992, (Fusarium solani) O'Donnell 2000 Neosartorya fischeri NFU21299 32.55 12 No No No Fedorova et al. 2008 Borkovich et al. 2004, Neurospora crassa OR74A AY046271 39.23 2 No No No C. Park et al. 2005 Sexton and Howlett Paracoccidioides brasiliensis DQ667982 32.94 0 No No Yes 2006, Bagagli et al. Pb01 2008 Phanerochaete AF026593 35.1 2 No No No Martinez et al. 2004 chrysosporium RP-78 Burkholder and Phycomyces blakesleeanus AY635837 55.9 7 No No No McVeigh 1940 Phytophthora ramorum AAQX01002092 65 15 No Yes No Grünwald et al. 2008 Phytophthora sojae AY742749 95 23 No Yes No Tyler 2007 Pichia stipitis CBS 6054 AB054280 15.44 0 No No No Agbogbo et al. 2007 Podospora anserina X54864 35.7 0 No No No Espagne et al. 2008 Prunus persica (pear tree) PRUEAA 290 7 No No No 68

68

69

Genome Biotrophic Necrotrophic Animal Organism SSUrRNA Size GH28 References Pathogen Pathogen Pathogen (Mb) Sun and Steffenson Puccinia graminis f. sp. tritici AY125409 88.64 0 Yes No No 2005, Broeker et al. CRL 75-36-700-3 2006 Strelkov and Lamari Pyrenophora tritici-repentis 2003, Perello et al. AY544716 37.84 5 No Yes No Pt-1C-BFP 2006, Istifadah et al. 2006 Yoshida et al. 2003, Rhizopus oryzae RA 99-880 AF113440 46.09 18 No Yes Yes Ibrahim et al. 2005 Saccharomyces bayanus X97777 11.54 3 No No No Replansky et al. 2008 MCYC 623 Saccharomyces castellii Z75577 12 0 No No No Replansky et al. 2008 NRRL Y-12630 Saccharomyces cerevisiae Wheeler et al. 2003, EU011664 11.74 1 Yes No No RM11-1a Replansky et al. 2008 Saccharomyces kluyveri NRRL Y-12651 (Lachancea Z75580 12.6 0 No No No Replansky et al. 2008 kluyveri) Saccharomyces kudriavzevii AB040997 10.6 1 No No No Naumov et al. 2000 Schizophyllum commune X54865 38.5 2 No No Yes Buzina et al. 2001 Schizosaccharomyces AB243296 11.3 0 No No No Bozsik et al. 2002 japonicus yFS275 Schizosaccharomyces ABHY02000007 11.22 0 No No No Carballeira et al. 2004 octosporus yFS286 Schizosaccharomyces pombe 12.57 Moreno et al. 1991 Z19578 0 No No No 972h- 69

69

70

Genome Biotrophic Necrotrophic Animal Organism SSUrRNA Size GH28 References Pathogen Pathogen Pathogen (Mb) Sclerotinia sclerotiorum 1980 L37541 38.33 13 No Yes No Marina et al. 2008 Sporobolomyces roseus DQ832235 21.2 0 No No No Janisiewicz et al. 1994 Stagnospora nodorum Solomom et al. 2006, (Phaeosphaeria nodorum EU189213 37.24 4 No Yes No Abramova et al. 2008 SN15) Trichoderma reesei QM6a AF548103 34.1 4 No No No Martinez et al. 2008 (Hypocrea jecorina) Trichophyton equinum Gräser et al. 2006, ABWI01001612 24.25 0 No No Yes cbs127.97 Brasch et al. 2009 Bowman et al. 1996, Uncinocarpus reesii 1704 URU29394 22.33 0 No No No Koufopanou et al. 2001 McCann and Snetselaar Ustilago maydis 521 X62396 19.68 1 Yes No No 2008 Verticillium albo-atrum Fradin and Thomma ABPE01001451 32.83 11 No Yes No VaMs.102 2006 Fradin and Thomma Verticillium dahliae VdLs.17 VDU33637 33.83 11 No Yes No 2006 Yarrowia lipolytica CLIB122 DQ438182 20.5 0 No No No Nicaud et al. 2006 de Montigny et al. Zygosaccharomyces rouxii AM943655 12.8 0 No No No 2000, Martorell et al. 2007

70

70 71

Appendix 1.b.: Literature cited in Appendix 1.a.

Abramova, S.L., D.Y. Ryazantsev, T.M. Voinova, and S.K. Zavriev. 2008. Diagnostics

of phytopathogen fungi Septoria tritici and Stagonospora nodorum by fluorescent

amplification-based specific hybridization (FLASH) PCR. Russian Journal of

Bioorganic Chemistry 34: 97-102.

Agbogbo, F.K., G. Coward-Kelly, M. Torry-Smith, K. Wenger, and T.W. Jeffries. 2007.

The effect of initial cell concentration on xylose fermentation by Pichia stipitis .

Applied Biochemistry and Biotechnology 137:653-662.

Arras, G., B. Scherm, and Q. Migheli. 2002. Improving Biocontrol Activity of Pichia

guillermondii Against Post-harvest Decay of Oranges in Commercial Packing-

houses by Reduced Concentrations of Fungicides. Biocontrol Science and

Technology 12: 547-553.

Bagagli, E., R.C. Theodoro, S.M.G. Bosco, and J.G. McEwen. 2008. Paracoccidioides

brasiliensis : phylogenetic and ecological aspects. Mycopathologia 165: 197-207.

Borkovich, K.A., L.A. Alex, O. Yarden, M. Freitag, G.E. Turner, N.D. Read, S. Seiler, D.

Bell-Pedersen, J. Paietta, and N. Plesofsky et al. 2004. Lessons from the genome

sequence of Neurospora crassa : tracing the path from genomic blueprint to

multicellular organism. Microbiology and Molecular Biology Reviews 68: 1-108.

Bowman, H., T.J. White, and J.W. Taylor. 1996. Human pathogeneic fungi and their

close nonpathogenic relatives. Molecular Phylogenetics and Evolution 6: 89-96.

Bozsik, A., Z. Szilagyi, Z. Benko, M. Sipiczki. 2002. Marker construction and cloning of

a cut1-like sequence with ARS activity in the fission yeast Schizosaccharomyces

japonicus . Yeast 19: 485-498.

71 72

Brasch, J., B. Lögering, and Y. Gräser. 2009. Tinea capitis caused by Trichophyton

equinum . Acta Dermato-Venereology 89: 204-205.

Braun, B.R. and M. van het Hoog. 2005. A human-curated annotation of the Candida

albicans genome. PLoS Genetics 1:36-57.

Broeker, K., S. Fehser, and B.M. Moerschbacher. 2006. Survey and expression analysis

of five new chitin synthase genes in the biotrophic rust fungus Puccinia graminis .

Current Genetics 50: 295-305.

Burgess, J.W., W.R. Schwan, and T. J. Volk. 2006. PCR-based detection of DNA from

the human pathogen Blastomyces dermatitidis from natural soil samples. Medical

Mycology 44: 741-748.

Burkholder and McVeigh. 1940. Growth of Phycomyces blakesleeanus in relation to

varied environmental conditions. American Journal of Botany 27: 634-640.

Buzina, W., D. Lang-Loidolt, H. Braun, K. Freudenschuss, and H. Stammberger. 2001.

Development of molecular methods for identification of Schizophyllum commune

from clinical samples. Journal of Clinical Microbiology 39: 2391-2396.

Carballeira, J.D., M. Valmaseda, E. Alvarez, and J.V.S. Gago. 2004. Gongronella butleri ,

Schizosaccharomyces octosporus and Diplogelasinospora grovesii : novel

microorganisms useful for the stereoselective reduction of ketones. Enzyme and

Microbial Technology 34: 611-623

Carruba, G., E. Pontieri, F. De Bernardis, P. Martino, and A. Cassone. 1991. DNA

fingerprinting and electrophoretic karyotype of environmental and clinical isolates

of Candida parapsilosis . Journal of Clinical Microbiology 29: 916-922.

72 73

Chen, X.J. and G.D. Clark-Walker. 1995. Specific mutations in alpha- and gamma-

subunits of F1-ATPase affect mitochondrial genome integrity in the petite-

negative yeast Kluyveromyces lactis . EMBO Journal 14: 3277–3286.

Cleveland, T.E., J. Yu, N. Fedorova, D. Bhatnagar, G.A. Payne, W.C. Nierman, and J.W.

Bennett. 2009. Potential of Aspergillus flavus genomics for applications in

biotechnology. Trends in Biotechnology 27: 151-157.

Cruz-Cruz, C.A., K. García-Sosa, F. Escalante-Erosa, and L.M. Peña-Rodríguez. 2009.

Production of hydrophilic phytotoxins by Mycosphaerella fijiensis . Journal of

General Plant Pathology 75: 191-195.

de Montigny, J., M.L. Straub, S. Potier, F. Tekaia, B. Dujon, P. Wincker, F. Artiguenave,

and J.L. Souciet. 2000. Genomic exploration of the hemiascomycetous yeasts: 8.

Zygosaccharomyces rouxii . FEBS letters 487: 52-55.

Desnos-Ollivier, M., M. Ragon, V. Robert, D. Raoux, J.-C Gantier, and F. Dromer. 2008.

Debaryomyces hansenii ( Candida famata ), a Rare Human Fungal Pathogen Often

Misidentified as Pichia guilliermondii ( Candida guilliermondii ). Journal of

Clinical Microbiology 46: 3237-3242.

Dizbay, M., E. Adisen, S. Kustimur, N. Sari, B. Cengiz, B. Yalcin, A. Kalkanci, I.I.

Gonul, and T. Sugita. 2009. Fungemia and cutaneous zygomycosis due to Mucor

circinelloides in an intensive care unit patient: Case report and review of

literature. Japanese Journal of Infectious Disease 62: 146-148.

Espagne, E., O. Lespinet, F. Malagnac, C. Da Silva, O. Jaillon, B. Porcel, A. Couloux,

J.M. Aury, B. Ségurens, and J. Poulain et al. 2008. The genome sequence of the

model ascomycete fungus Podospora anserina . Genome Biology 9: R77.

73 74

Fedorova, N.D., N. Khaldi, V.S. Joardar, R. Maiti, P. Amedeo, M.J. Anderson, J.

Crabtree, J.C. Silva, J.H. Badger, and A. Albarraq et al. 2008. Genomic islands in

the pathogenic filamentous fungus Aspergillus fumigatus . PLoS Genetics 4:1-13.

Fidel Jr., P.L., J.A. Vazquez, and J.D. Sobel. 1999. Candida glabrata : review of

epidemiology, pathogenesis, and clinical disease with comparison to C. albicans .

Clinical Microbiology Reviews 12: 80-96.

Fradin, E.F. and B.P.H.J. Thomma. 2006. Physiology and molecular aspects of

Verticillium wilt diseases caused by V. dahliae and V. albo-atrum . Molecular

Plant Pathology 7:71-86.

Gonzalez-Candelas, L. and P.E. Kolattukudy. 1992. Isolation and analysis of a novel

inducible pectate lyase gene from the phytopathogenic fungus Fusarium solani f.

sp. pisi ( Nectria haematococca , mating population VI). Journal of

Bacteriology174: 6343-6349.

Gräser, Y., S. De Hoog, and R. C. Summerbell. 2006. Dermatophytes: recognizing

species of clonal fungi. Medical Mycology 44: 199-209.

Grünwald, N.J., E.M. Goss, M.M. Larsen, C.M. Press, V.T. McDonald, L. Blomquist and

S.L. Thomas. 2008. Phytophthora ramorum : a pathogen with a remarkably wide

host range causing sudden oak death on oaks and ramorum blight on woody

ornamentals. Molecular Plant Pathology 9: 729-740.

Guerber, C. and D.O. TeBeest. 2006. Infection of rice seed grown in Arkansas by

Pyricularia grisea and transmission to seedlings in the field. Plant Disease

90:170-176.

74 75

Hedayati, M.T., A. Mohseni-Bandpi, and S. Moradi. 2004. A survey on the pathogenic

fungi in soil samples of potted plants from Sari hospitals, Iran Journal of Hospital

Infection 58: 59-62.

Hussein, H.M., M.J. Christensen, and M. Baxter. 2003. Occurrence and distribution of

Fusarium species in maize fields in New Zealand. Mycopathologia 156: 25-30.

Ibrahim, A.S., B. Spellberg, V. Avanessian, Y. Fu, and J.E. Edwards Jr. 2005. Rhizopus

oryzae adheres to, is phagocytosed by, and damages endothelial cells in vitro.

Infection and immunity 73: 778-783.

Igbaria, A., S. Lev, M.S. Rose, B.N. Lee, R. Hadar, O. Degani, and B.A. Horwitz. 2008.

Distinct and combined roles of the MAP kinases of Cochliobolus heterostrophus

in virulence and stress responses. Molecular Plant-Microbe Interactions 21: 769-

780.

Istifadah, N. and P.A. McGee. 2006. Endophytic Chaetomium globosum reduces

development of tan spot in wheat caused by Pyrenophora tritici-repentis .

Australasian Plant Pathology 35: 411-418.

Ito-Kuwa, S., K. Nakamura, B. Valderrama, S. Aoki, V. Vidotto, and T. Osafune. 2008.

Diversity of laccase among Cryptococcus neoformans serotypes. Microbiology

and Immunology 52: 492-498.

James, T.Y., A.P. Litvintseva, R. Vilgalys, J.A.T. Morgan, J.W. Taylor, M.C. Fisher, L.

Berger, C. Weldon, L. du Preez, and J.E. Longcore. 2009. Rapid Global

Expansion of the Fungal Disease Chytridiomycosis into Declining and Healthy

Amphibian Populations. PLoS Pathogens 5:1-12.

75 76

Janisiewicz, W.J., D.L. Peterson, and R. Bors. 1994. Control of storage decay of apples

with Sporobolomyces roseus . Plant Disease 78: 466-470.

Jones, T., N.A. Federspiel, H. Chibana, J. Dungan, S. Kalman, B.B. Magee, G. Newport,

Y.R. Thorstenson, N. Agabian, P.T. Magee, R.W. Davis, and S. Scherer. 2004.

The diploid genome sequence of Candida albicans . Proceedings of the National

Academy of Sciences 101: 7329-7334.

Kapsopoulou, K., A. Kapaklis, and H. Spyropoulos. 2005. Growth and fermentation

characteristics of a strain of the wine yeast Kluyveromyces thermotolerans

isolated in Greece. World Journal of Microbiology and Biotechnology 21: 1599-

1602.

Kasuga, T., T.J. White, G. Koenig, J. Mcewen, A. Restrepo, E. Castaneda, C. Da Silva

Lacaz, E.M. Heins-Vaccari, R.S. De Freitas, and R.M. Zancopé-Oliveira et al.

2003. Phylogeography of the fungal pathogen Histoplasma capsulatum .

Molecular Ecology 12: 3383-3401.

Koufopanou, V., A. Burt, T. Szaro, and J.W. Taylor. 2001. Gene genealogies, cryptic

species, and molecular evolution in the human pathogen Coccidioides immitis and

relatives (Ascomycota, Onygenales). Molecular Biology and Evolution 18: 1246-

1258.

Krishnan, S., E.K. Manavathu, and P.H. Chandrasekar. 2009. Aspergillus flavus : an

emerging non-fumigatus Aspergillus species of significance. Mycoses 52: 206-

222.

Lev, S., A. Sharon, R. Hadar, H. Ma, and B.A. Horwitz. 1999. A mitogen-activated

protein kinase of the corn leaf pathogen Cochliobolus heterostrophus is involved

76 77

in conidiation, appressorium formation, and pathogenicity: diverse roles for

mitogen-activated protein kinase homologs in foliar pathogens. Proceedings of the

National Academy of Sciences 96: 13542-13547.

Lievens, B., L. Claes, D.J. Vakalounakis, A.C. Vanachter, and B.P. Thomma. 2007. A

robust identification and detection assay to discriminate the cucumber pathogens

Fusarium oxysporum f. sp. cucumerinum and f. sp. radicis-cucumerinum .

Environmental Microbiology 9: 2145-2161.

Lin, X. 2009. Cryptococcus neoformans : Morphogenesis, infection, and evolution.

Infection, Genetics and Evolution 9: 401-416.

Lockhart, S.R., S.A. Messer, M.A. Pfaller, D.J. Diekema. 2008. Lodderomyces

elongisporus masquerading as Candida parapsilosis as a cause of blood stream

infections. Journal of Clinical Microbiology 46: 374-376.

Lopes, B.G.B., A.L.S. Santos, C.C.F. Bezerra, B. Wanke, M. dos Santos Lazéra, M.M.

Nishikawa, A.M. Mazotto, V.M. Kussumi, R.M.T. Haido, and A.B. Vermelho.

2008. A 25-kDa Serine Peptidase with Keratinolytic Activity Secreted by

Coccidioides immitis . Mycopathologia 166: 35-40.

Machida, M., K. Asai, M. Sano, T. Tanaka, T. Kumagai, G. Terai, K.I. Kusumoto, T.

Arima, O. Akita, and Y. Kashiwagi et al. 2005. Genome sequencing and analysis

of Aspergillus oryzae . Nature. 438: 1157-1161.

Mandel, M.A., J.N. Galgiani, S. Kroken, and M.J. Orbach. 2006. Coccidioides posadasii

contains single chitin synthase genes corresponding to classes I to VII. Fungal

Genetics and Biology 43: 775-788.

77 78

Marina, M., S.J. Maiale, F.R. Rossi, M.F. Romero, E.I. Rivas, A. Garriz, O.A. Ruiz, and

F.L. Pieckenstain. 2008. Apoplastic polyamine oxidation plays different roles in

local responses of tobacco to infection by the necrotrophic fungus Sclerotinia

sclerotiorum and the biotrophic bacterium Pseudomonas viridiflava . Plant

Physiology 147: 2164-2178.

Martin, F. and M.A. Selosse. 2008. The Laccaria genome: a symbiont blueprint decoded.

New Phytologist 180: 296-310.

Martinez, D., L.F. Larrondo, N. Putnam, M.D.S. Gelpke, K. Huang, J. Chapman, K.G.

Helfenbein, P. Ramaiya, J.C. Detter, and F. Larimer et al. 2004. Genome

sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium

strain RP 78. Nature Biotechnology 22: 695-700.

Martinez, D., R.M. Berka, B. Henrissat, M. Saloheimo, M. Arvas, S.E. Baker, J.

Chapman, O. Chertkov, P.M. Coutinho, and D. Cullen et al. 2008. Genome

sequencing and analysis of the biomass-degrading fungus Trichoderma reesei

(syn. Hypocrea jecorina ). Nature Biotechnology 26: 553-560.

Martorell, P., M. Stratford, H. Steels, M.T. Fernández-Espinar, and A. Querol. 2007.

Physiological characterization of spoilage strains of Zygosaccharomyces bailii

and Zygosaccharomyces rouxii isolated from high sugar environments.

International Journal of Food Microbiology 114 234-242.

McCann, M. and K. Snetselaar. 2008. A genome-based analysis of amino acid

metabolism in the biotrophic plant pathogen Ustilago maydis . Fungal Genetics

and Biology 45: S77-S87.

78 79

Mehrabi, R., L.H. Zwiers, M.A. de Waard, and G.H.J. Kema. 2006. MgHog1 regulates

dimorphism and pathogenicity in the fungal wheat pathogen Mycosphaerella

graminicola . Molecular Plant-Microbe Interactions 19: 1262-1269.

Moreno, S., A. Klar, and P. Nurse. 1991. Molecular genetic analysis of fission yeast

Schizosaccharomyces pombe . Methods in Enzymology. 194:795-823.

Mshandete, A.M. and J. Cuff. 2008. Cultivation of three types of indigenous wild edible

mushrooms: Coprinus cinereus , Pleurotus flabellatus and Volvariella volvocea on

composted sisal decortications residue in Tanzania. African Journal of

Biotechnology 7: 4551-4562.

Naumov, G.I., S.A. James, E.S. Naumova, E.J. Louis, and I.N. Roberts. 2000. Three new

species in the Saccharomyces sensu stricto complex: Saccharomyces cariocanus,

Saccharomyces kudriavzevii and Saccharomyces mikatae . International Journal of

Systematic and Evolutionary Microbiology 50: 1931-1942.

Nicaud, J.M., C. Madzak, P. van den Broek, C. Gysler, P. Duboc, P. Niederberger, and C.

Gaillardin. 2002. Protein expression and secretion in the yeast Yarrowia

lipolytica . FEMS Yeast Research 2: 371-380.

Nosek, J. 2002. Mitochondrial telomeres as molecular markers for identification of the

opportunistic yeast pathogen Candida parapsilosis . Journal of Clinical

Microbiology 40: 1283-1289.

O'Donnell, K. 2000. Molecular phylogeny of the Nectria haematococca -Fusarium solani

species complex. Mycologia 92: 919-938.

79 80

Okawa, Y., M. Miyauchi, and H. Kobayashi. 2008. Comparison of Pathogenicity of

Various Candida tropicalis Strains. Biological & Pharmaceutical Bulletin 31:

1507-1510.

Park, C., B. Bennion, I.E.J.A. Francois, K.K.A. Ferket, B. Cammue, K. Thevissen, and

S.B. Levery. 2005. Neutral glycolipids of the filamentous fungus Neurospora

crassa : altered expression in plant defensin-resistant mutants. The Journal of

Lipid Research 46: 759-768.

Park, J.H., G.J. Choi, K.S. Jang, H.K. Lim, H.T. Kim, K.Y. Cho, and J.C. Kim. 2005.

Antifungal activity against plant pathogenic fungi of chaetoviridins isolated from

Chaetomium globosum . FEMS Microbiology Letters 252: 309-314.

Perello, A., C. Monaco, M. Moreno, C.A. Cordo, and M. Simon. 2006. The effect of

Trichoderma harzianum and T. koningii on the control of tan spot ( Pyrenophora

tritici-repentis ) and leaf blotch ( Mycosphaerella graminicola ) of wheat under

field conditions in Argentina. Biocontrol Science and Technology 16: 803-813.

Piotrowski, J.S., S.L. Annis, and J.E. Longcore. 2004. Physiology of Batrachochytrium

dendrobatidis , a chytrid pathogen of amphibians. Mycologia 96: 9-15.

Prasad, S., D.R. Sharma, and T.C. Bhalla. 2005. Nitrile-and Amide-hydrolysing Activity

in Kluyveromyces thermotolerans MGBY 37. World Journal of Microbiology and

Biotechnology 21: 1447-1450.

Replansky, T., V. Koufopanou, D. Greig, and G. Bell. 2008. Saccharomyces sensu stricto

as a model system for evolution and ecology. Trends in Ecology & Evolution 23:

494-501.

80 81

Rivas, G.G., M.F. Zapater, C. Abadie, and J. Carlier. 2004. Founder effects and

stochastic dispersal at the continental scale of the fungal pathogen of bananas

Mycosphaerella fijiensis . Molecular Ecology 13: 471-482.

Rodríguez-Gálvez, E. and K. Mendgen. 1995. The infection process of Fusarium

oxysporum in cotton root tips. Protoplasma 189:61-72.

Ruprich-Robert, G., F. Chapeland-Leclerc, S. Boisnard, M. Florent, G. Bories, and N.

Papon. 2008. Contributions of the Response Regulators Ssk1p and Skn7p in the

Pseudohyphal Development, Stress Adaptation, and Drug Sensitivity of the

Opportunistic Yeast Candida lusitaniae . Eukaryotic Cell 7: 1071-1074.

Schuster, E., N. Dunn-Coleman, J. Frisvad, P. van Dijck. 2002. On the safety of

Aspergillus niger –a review. Applied Microbiology and Biotechnology 59: 426-

435.

Sexton, A.C. and B.J. Howlett. 2006. Parallels in Fungal Pathogenesis on Plant and

Animal Hosts. Eukaryotic Cell 5: 1941-1949.

Solomon, P.S., R.G. Lowe, K.C. Tan, O.D. Waters, and R.P. Oliver. 2006. Stagonospora

nodorum : cause of Stagonospora nodorum blotch of wheat. Molecular Plant

Pathology 7: 147-156.

St. Leger, R.J., S.E. Screen, and B. Shams-Pirzadeh. 2000. Lack of host specialization in

Aspergillus flavus . Applied and Environmental Microbiology 66: 320-324.

Stobierski, M.G., C.J. Hospedales, W.N. Hall, B. Robinson-Dunn, D. Hoch, and D.A.

Sheill. 1996. Outbreak of histoplasmosis among employees in a paper factory--

Michigan, 1993. Journal of Clinical Microbiology 34: 1220-1223.

81 82

Strelkov, S.E., and L. Lamari, 2003. Host-parasite interactions in tan spot [ Pyrenophora

tritici-repentis ] of wheat. Canadian Journal of Plant Pathology 25: 339-349.

Sun, Y., and B.J. Steffenson. 2005. Reaction of barley seedlings with different stem rust

resistance genes to Puccinia graminis f. sp. tritici and Puccinia graminis f. sp.

secalis . Canadian Journal of Plant Pathology 27: 80-89.

Sun, P.L. and H.T. Ho. 2006. Concentric rings: an unusual presentation of tinea corporis

caused by Microsporum gypseum . Mycoses 49: 150-151.

Tekaia, F. and J.P. Latgé. 2005. Aspergillus fumigatus : saprophyte or pathogen? Current

Opinion in Microbiology 8: 385-392.

Torriani, S.F.F., S.B. Goodwin, G.H.J. Kema, J.L. Pangilinan, and B.A. McDonald. 2008.

Intraspecific comparison and annotation of two complete mitochondrial genome

sequences from the plant pathogenic fungus Mycosphaerella graminicola . Fungal

Genetics and Biology 45: 628-637.

Tyler, B.M. 2007. Phytophthora sojae : root rot pathogen of soybean and model

oomycete. Molecular Plant Pathology 8: 1-8.

Ulrich, C.E., A.C. Gathman, and W.W. Lilly. 2007. Amino acid pool composition of the

basidiomycete Coprinus cinereus. Canadian Journal of Microbiology 53: 1278-

1281.

Urban, M., E. Mott, T. Farley, and K. Hammond-Kosack. 2003. The Fusarium

graminearum MAP1 gene is essential for pathogenicity and development of

perithecia. Molecular Plant Pathology 4: 347-359. van Kan, J.A.L. 2006. Licensed to kill: the lifestyle of a necrotrophic plant pathogen.

Trends in Plant Science 11: 247-253.

82 83

Vermout, S., J. Tabart, A. Baldo, A. Mathy, B. Losson, and B. Mignon. 2008.

Pathogenesis of dermatophytosis. Mycopathologia 166: 267-275.

Walsh, T.J., V. Petraitis, R. Petraitiene, A. Field-Ridley, D. Sutton, M. Ghannoum, T.

Sein, R. Schaufele, J. Peter, and J. Bacher. 2003. Experimental pulmonary

aspergillosis due to Aspergillus terreus : pathogenesis and treatment of an

emerging fungal pathogen resistant to amphotericin B. The Journal of Infectious

Diseases 188: 305-319.

Wendland, J. and A. Walther. 2005. Ashbya gossypii : a model for fungal developmental

biology. Nature Reviews Microbiology 3: 421–429.

Wheeler, R.T., M. Kupiec, P. Magnelli, C. Abeijon, and G.R. Fink. 2003. A

Saccharomyces cerevisiae mutant with increased virulence. Proceedings of the

National Academy of Sciences 100: 2766-2770.

Wolff, A.M. and J. Arnau. 2002. Cloning of glyceraldehyde-3-phosphate dehydrogenase-

encoding genes in Mucor circinelloides (Syn. racemosus ) and use of the gpd1

promoter for recombinant protein production. Fungal Genetics and Biology 35

21-29.

Yates, I.E., N.W. Widstrom, C.W. Bacon, A. Glenn, D.M. Hinton, D. Sparks, and A.J.

Jaworski. 2005. Field performance of maize grown from Fusarium verticillioides -

inoculated seed. Mycopathologia 159: 65-73.

Yoshida, S., S. Tsuyumu, and T. Tsukiboshi. 2003. Macerating enzymes produced by

Rhizopus oryzae in infected mulberry roots. Journal of Phytopathology 151: 436-

441.

83

84

APPENDIX 2

FASTA Files of 6 representative GH28s from Aspergillus niger

>DQ374422 Aspergillus niger strain CBS 513.88 putative exo-polygalacturonase X (pgaX) gene, complete cds TTCGTTTCCCCGGATATGGAGCACAGCGAAATCCCCAACTTGAAGGATCAATGGTGTGGTCAGTGTGGGCAAGACTGCGGGGAGATGAT GCCTACTCGATGCAATGGATATAAATTCCAGAGGCGACCGTCATTCCTTTGCATTGACTTTGTTCAAGCTCCGCTCGTGAAACCGGACT TGTCACCTGTCAATCTCTCACAATGAGACTCACGCACGTTCTCTCTCACACGCTTGGCCTTCTTGCGCTAGGAGCAACAGCAGAAGCTT TCTCCCGGTCCAGAGAAGCCGCCTGCAGCCCGAAAAAGCCTTTCCGGCCTCTACCTACAAGCTCGAGCAGGGACAAGACCTGCCATGTC CGCAGCCATGGTGACGGCAGTGACGACTCTGATTACATCCTCTCCGCACTGCACCAATGTAATCACGGTGGAAAGGTTGTTTTCGATGA GGACAAGGAGTACATTATCGGCACAGCGTTGAATATGACCTTCCTGAAGAACATTGACCTAGGTGCCTATTCTGCAGATCCGTCGATCG TCAAGTTGAACATTGACTAACGCTTATGGTTCAACAGAGGTCCTCGGAACGATCTTATTCACCAACGATACAGACTACTGGCAAGCCAA TTCCTTCAAACAAGGCTTTCAGAATGCCACGACCTTTTTCCAGCTCGGTGGTGAAGATGTGAACATGTACGGTGGTGGTACCATCAATG GCAACGGACAGGTCTGGTATGATCTGTATGCGGAAGATGATCTCATTCTGCGTCCCATCTTGATGGGCATCATCGGGCTGAATGGAGGC ACAATCGGTCCGTTGAAGTTGCGGTACTCGCCGCAGTACTACCACTTCGTGGCTAATTCGTCGAATGTCCTCTTTGATGGGATTGACAT TTCGGGTTATAGTAAGAGCGATAACGAGGCGAAGAACACCGATGGATGGTGCGTTTCTATACCCGATATTGCCTTGAGTGTTATACTAA TTCGTCGTTCTGTAGGGATACCTATCGCTCGAACAATATCGTCATCCAGAACTCGGTGATCAACAACGGTGATGGTAAGTCCAACCTGA AGAAGCGTTATGTCCCAACAATTCTAACCTACAAAGACTGCGTCTCCTTCAAGCCAAACAGCACCAACATTCTCGTTCAGAATCTTCAC TGCAATGGCTCCCACGGCATTTCCGTTGGCTCTCTCGGCCAATACAAGGACGAGGTTGACATCGTTGAGAATGTTTATGTGTACAATAT CTCCATGTTCAATGCTTCGGTGTGTCTGACTCTAACATGCATATATATTTCTTACTAACTTGTTTTGCAGGACATGGCCCGCATCAAGG TTTGGCCTGGTACTCCATCTGCACTATCTGCCGATCTTCAAGGCGGCGGTGGCTCGGGCAGCGTAAAGAACATCACCTACGACACCGCA CTCATTGATAATGTCGACTGGGCTATTGAAATCACGCAGTGCTATGGGCAGAAAAATACTACCTTGTGCAACGAGTACCCGGTTAGTAG ACCTTTCAACCGCTTCCCGTGAAGTATTTCTAACGTGCAAGCAGAGCTCTCTCACCATTTCAGACGTCCACATCAAGAACTTCCGCGGA ACGACGTCGGGATCCGAAGATCCCTATGTTGGAACAATTGTCTGTTCAAGTCCTGATGTAGGTGCCCAGTAGTATAGGCGTCTGGTGCG CAATAGGCTGACACTCAATAGACTTGCTCGGACATCTATACGTCTAATATCAATGTGACAAGCCCGGACGGAACCAACGACTTTGTCTG CGATAATGTGAGTTCTTAGATTAACCCTAGGCAGAGATCGTGGCTAATGCTGTCCAGGTCGATGAGAGTCTTCTGAGTGTCAACTGTAC CGCCACTTCTGATTGAATCAAGATGCCTGTTATTATGCGCTGGAAGTCAGGCCTTACTTAGACGGATGAAAAAACGTGTATATATTACA TTAGGGCTCGATTTTGTATATACGTGAACGAATGCCTACTGTCTGCTTTTGACTCAAGGAAGGTCAGGCGACAAGAAGCTTTTGGTTCG AACTTTGATATTGGTTCTTACTAGACACTCCTGCTTTT

>DQ374425 Aspergillus niger strain CBS 513.88 putative exo-polygalacturonase C (pgxC) gene, complete cds CTACTCGCGGCCTCTTGAGGAAATTTCCCGGTTAATGGACCTGAGAGATTTGCAAATTTCCGAACGCTTGTCATGTCTAATGGCATGGC AATTGGAGACCCTGAACCTCGGGAGCGCAACATTATGTTGTAATATAAGTAAGGGTACGTATGCAAGTGTTACTGGTTATTCAGTGAGC TACTGGCTATTCACGCATCGTCATGTCTGTCTTCAAGGCATCATTCCTATTTCTTCTTTCCTCCTCACTAGTCCACGGGGTTCCACACT CCAGCAGAGCATCTCGGAGCCAACAATGCGTGGTTCCGTCCAAATACCAGGCATCGAATGGAATGGCTGATGACTCGGTTGCTGTCTCC CAGGCCTTTGCACAATGCGCGACTGACTCGGTTATTATTTTCGAGGAGGGTGTCAACTATAACATCTTTCAGCCGATCACCGCCACCAA CCTCAGCAATGTGGAAATCCGGATGCACGGCAACCTGCATCTGCCACAGAATATCACTGCGGTGCAGAATATAGTCAGTGACGGTACTT CTACATGGTTTACCCTAGAAGGACCAAAAGTGGACTGGATTGGTCCTGAAGACGTGAACAATGGTTGGATTGACTCGTACGGACAACCG TGGTGGGATGCGAACCCTGCAGGTAGTTCAGGCATCGATAACCGTCCGCATCTCATGAGCTTCAAGTCTAGCCAAGCCACTATGAAATA CTTCAGGTCTAGGAAGCCCATCGCCTGGAATGTCAAACTGCATGGACAAGACATTACAGTCAGCCACGCTATTATCGACGCTACCTCGA CAGGTAGCTTCCCATTCAACACTGACGGTTTCGATGTTGAGGGTACCAATATCCAGATCACCGACAGTATCATGTACAACGGCGACGAT GCGATTGCAGTAGGCGCGGACTCGCACGACACACTTTTCACAAGAAACACCATCGGCTACCAGACTCACGGCATGAGCATTGGATCGCT GGGAAAGGATCCCACAGACTTCGCCAATATCAGCAACATCCGCTTTGACGATGTGACTGTTGTCGATGGGCTCTACGCAGCACGCTTCA AGTCATGGAGCGGAGGGACCGGACTCGTCAAGAATGTGACCTGGAACAATATTAGAGTCTTCAACGTGACGTTCCCGATCTTTGTGACT CAGAGTTATAGCGACCAAGGCGCCTCCCGGTCTGGAACTGTCAATGCTAGTTCGGCTGTGATGATGGAGGATTTTACCTGGTCTGACTT TGCTGGCTCGATCAATACGTACCAGCCTGGTGACGGTTCTTGCGTTTCCGACCCTTGCTGGTACAACGTTGGGCTGCCAAATTTGAAGC ATACGGAGGCCCTCATTATCGAATGCCATACTGCTCAATCTTGTAAGAACTTTGTGACGGACAACATCCAGCTATACCCGCAGGTTCTG GAACCAGCGAGTGTGATCTGCATGAACGCAACGGCAGCCCTCAATCCTGATCTTGGATTTACATGTAAAAACGGGACCTACAGCCCATT ATCTAATTAATGGAAACTAGTGATAATACAGATACTTGATATCCAGTCCACCTTACCGCTTTATCCAAAGTGGCCTAAGCCATCCACAG GAAGCCACACCCAACACATCGACTTCCGGGAAGGCACACCCAAACTAAGCATATACAATAATCAATCCAAAAAAACTCCTCTACTGTAC TCCTTCTCATACCCAGTATTTATCGCTGATAC

>DQ374426 Aspergillus niger strain CBS 513.88 putative exo-rhamnogalacturonase A (rgxA) gene, complete cds TTGACTTCAGTGCGGACAAATCGCGTCGTACTCTGCCTCCGCATGGCTGCCGATCCTCCTTGCATCCCCTCACAACAACAACGGCATTT TAGGCTCAATCGCCGACATTCCGCACATAAAAACCCACTGTCGGAAATGCCCAACAAAGCCCGTGCTGGACTCTTGACGGGTATCGAGG TGAGCCAGGAAAACGGAAGAAGATGAGAATGCCCTCAGCCATCAGTATTGGAGTGATCGCGGGCCTGAGTGTCGCTGCTTCGGCCGTAC CTTCTCTCCAGAAGAATGGCACTACCTGCACCGTCATCCCTTTAGGAAACGGACAGGATGATGTCCCCAACATCCTCTCGGCCGTTGAC GAATGTGGCCAGACCTCTGGAGGGAGAGTTGTTCTCCCAGCGCCGTATACCTACCGAATTAACCAACGGATGACGACTCACCTGACCGA TTCCCGACTCGAGATCGGTGGTACGCTTCTCTTCAGCGACGATATCGACTACTGGGTCAACAACTCCTACCGGGTGGACTTTCAGAATC AGTCAAGTGCCTGGCGTATCACGGGTCATGACTATGTTGTGGATGGAGGTCCACGTCAAGGTGGAGTGGATGGGAATGGACAGCTGTGG TACACTTGGGCCAAGGGAGGAAGCAATGTCTTCGGACGACCGATGCCAGTGCATGTGTTCGAGTCGACGCGAGCAACCCTGCGTAACCT GGCAATCCGGCAGCCTCAGTTTTGGGCTGTTCTTGTCGATTCCTCTTCGCATATCAACCTCGATAATTTTTACGTGAATGCCACAAACC ATGACTCCTCGGTGAGCCCAGAGGGCGAGTGGGTGCAGAATACGGATGGGATCGACACGTACCGATCCGACCATATTACGGTTACCAAC TGGGTGTACCAAGGCGGAGACGATGCAGTGGCTTTCAAAGGGAACTCGACGAACATACATGTAGAGAATGTCACGGTTTACGGCGGACC GGGCATCGCTTTTGGGTCGCTGGGACAATACCCCGACCGGACGGATATTGTGGAGAATGTGACGGTTCGGAATGTTCGAGTAAGTAAGG CTCAGAGGCATGATGGCATTTGAATTCACAGGTATAGGTGCAACCGTCCTTCCAACGGGCGATGAATTCCGGGGTTTACTTCAAGAGCT GGTAGGTACCATGTCCTTCACAGCGATCCCTGGCTGACCAGCTAGGATCGGGGTCAATTATGGTGTTCCTCCGAATGGTGGCGGGGGCG GCCATGGATACGTGCGCAACGTCTCAGTCGAAAACCTTCGACTCAAGGATG TGCAGTTACCTGTGTATATTGACACCTGGTGAGGGCGA TACCACCATGTTTGAGGTACTCGGCTAACCCGGGCAGCTTGAGCTATCTCTTCAGCGAGAACATCACGCAGTATTGTGACACATCGACG TACGAATTCGAGGACCTCCACTTCAGAAACATCAGCGGCAATGGACTCGCAACGGTGACTGATTACCCGGGGAAGAATATCAGCTTCGC CGTGGCTTTGCTTTGTTCTGAGAAGGCACCGTGTACGGACTTGACCTTCCAGGACATCAGTATTACGCTTCCAGGGAACTATACTGGCA AACATGTACTGTGCGAGAATGCTGAGGCGGAGGGGCTCCCATGCAATTCGTGAGCTGTCGCTGAATGAGACAGATCGTGTCCATAAATA GAAGTCAGATGCATGTCTCACATGATTGCTCGCTTGCTGTTGGTAAGGTTTGACAATCACCCCAGTTGTGCAGCGAAGTTAAGTCACAT TGGATGACTTTGGGGTTCCAATCGGATCTCGTTTCCATAGGACCAAATCATGATTATGTGGAAAGCGAAAGTTCG

84 85

>DQ374431 Aspergillus niger strain CBS 513.88 putative endo-xylogalacturonan hydrolase A (xghA) gene, complete cds ATGACAGGGCCTGCCTCGGCGTCCCACAGCCCTCACTGATGTATGCCTCTGCAAAGAGATGGTAACCACTGCATGCCACGCAGTTCCGT ACACCTCCGGGCAGGATGCGAGTCGTATATAGTGGGCTAGACATCGCCAGACTGGTCACCACCTCAACCTGTGCAACGATCCCATAGTC ATTGGCACAATTAGTGTTCACCATGACGCTATATCGCAATCTTCTGCTTTTGGCCAGCCTTGGACTGAGCTATGCTGCTCCCTCTAAGG TCCAACGTGCCCCTGATTCGTCCCTCCATGCTCGTGCCGTCTGTACCCCAACCGCAGGAGGCGATTCTTCCACCGACGATGTGCCCGCC ATCACCGAGGCTCTCAGCTCGTGCGGGAACGGGGGCACCATTGTATTCCCGGAGGGCAGCACCTACTACCTCAACAGTGTGCTTGACTT GGGCAACTGCAGTAATTGCGACATCCAGGTGGAAGGTCTTTTGAAGTTCGCCAGCGACACCGATTACTGGAGCGGTCGCACCGCCATGA TCAGTGTATCCGATGTGGATGGCCTGAAGCTGCGCTCATTGACTGGGTCGGGTGTCATCGATGGCAATGGCCAGGATGCGTACGTGATC ACCATTCTCGGAAGCAAGCCTCCCAGTCCATTTAGCTGACCGATGCAATTTAGGTGGGATCTCTTTGCGAGTGACAGCAGTTACTCACG CCCAACGCTCCTGTACATCACTGGCGGCAGCAACCTCGAAATCTCCGGGCTGCGTCAGAAGAACCCACCCAACGTGTTCAACTCAGTCA AGGGTGGCGCCACTAACGTCGTCTTCTCCAACCTGAAGATGGATGCAAACTCCAAGTCAGACAACCCGCCCAAGAACACTGATGGCTTC GACATCGGCGAGAGTACCTATGTAACCATCACTGAGGTCACCGTCGTCAACGATGATGACTGTGTGGCCCTGAAGCCCAGCTCCAACTA CGTGACCGTCGACACCATCAGCTGCACCGGCTCCCATGGCATTTCCGTGGGGTCGCTGGGCAAGTCCAGCGACGACTCGGTCAAGAATA TCTATGTCACGGGCGCAACCATGATCAACTCCACCAAAGCCGCCGGAATCAAGACTTATCCGAGTGGAGGCGACCACGGCACTTCCACG GTCAGCAATGTGACGTTCACCGATTTCACCGTAGACAACTCCGACTATGCCTTCCAGATCCAGAGTTGTTATGGCGAGGACGATGACTA CTGCGAGGAGAACCCGGGCAACGCCAAGCTGACCGATATTGTCGTCTCGAGCTTCAGCGGCACAACCAGTGACAAGTACGACCCGGTTG TGGCCAACATCGACTGCGGTTCGGATGGAACGTGTGGCATCTCCATCAGTGGGTTCGATGTGAAGGCGCCGTCGGGCAAGTCTGAAGTG CTGTGCGCCAACACCCCGTCTGACTTGGGCGTCACCTGCACTTCAGGAGCATCGGGCTAAATAGCTTCGGCCAAAAATGATTTCTGTAT CCACTAGCTATCGATCATCATCAGATCTAGGAGTTAGCATGGTAGTGTACATAGCAGAATGTAATCAATTCCCTGACGATGCTGCAACT ACAAATATGGAAGTATCATCATTACACATGAGACACAACGACGACTTTCTCGGTTTATAATTGTTGTAATGACCGACCTGAT

>XM_001389525 Aspergillus niger CBS 513.88 polygalacturonase pgaI-Aspergillus niger (pgaI) partial mRNA AUGCACUCUUACCAGCUUCUUGGCCUGGCCGCUGUCGGCUCCCUCGUCUCUGCCGCCCCCGCUCCUUCUCGCGUCUCCGAGUUCGCUAA GAAGGCCUCUACCUGCACCUUCACCUCUGCCUCUGAGGCCAGCGAGAGCAUCUCCAGCUGCUCCGAUGUUGUCCUGAGCAGCAUCGAGG UCCCCGCUGGCGAGACCCUGGACCUGUCCGAUGCUGCUGAUGGCUCCACCAUCACCUUCGAGGGCACCACUUCCUUCGGAUACAAGGAA UGGAAGGGUCCCCUGAUCCGCUUCGGUGGUAAGGAUCUGACCGUCACCAUGGCCGACGGCGCUGUCAUCGACGGUGACGGUUCCCGCUG GUGGGACAGCAAGGGUACCAACGGUGGCAAGACCAAGCCCAAGUUCAUGUACAUCCACGACGUUGAGGACUCGACCUUCAAGGGCAUCA ACAUCAAGAAUACUCCCGUCCAGGCCAUCAGUGUCCAGGCUACCAACGUCCACCUGAACGACUUCACCAUCGACAACUCCGACGGUGAU GACAACGGUGGCCACAACACCGACGGUUUCGACAUCAGCGAGUCCACCGGUGUCUACAUCAGCGGUGCUACCGUCAAGAACCAGGACGA CUGCAUUGCCAUCAACUCUGGCGAGAGCAUCUCUUUCACCGGCGGUACCUGCUCCGGUGGCCACGGUCUCUCCAUCGGCUCUGUCGGUG GCCGUGAUGACAACACCGUCAAGAACGUGACCAUCUCCGACUCCACUGUCAGCAACUCCGCCAAUGGUGUCCGCAUCAAGACCAUCUAC AAGGAGACCGGCGAUGUCAGCGAGAUCACCUACUCCAACAUCCAGCUCUCCGGCAUCACCGACUACGGUAUCGUCAUCGAGCAGGACUA CGAGAACGGCUCUCCCACCGGCACCCCCUCCACCGGUAUCCCCAUCACUGAUGUCACUGUUGACGGUGUCACCGGCACUCUUGAGGAUG ACGCCACCCAGGUCUACAUUCUCUGCGGUGACGGCUCUUGCUCUGACUGGACCUGGUCCGGUGUUGACCUCUCUGGUGGCAAGACCAGC GAUAAAUGCGAGAACGUUCCUUCCGGUGCUUCUUGCUAA

>XM_001395147 Aspergillus niger CBS 513.88 rhamnogalacturonase rhgA-Aspergillus niger (rhgA) partial mRNA AUGCCUGCUCUUCCCAUCCUCGCCCUUGCCCUCGCCCCGUUGCUGGUCAACGGCCAGCUCUCCGGUAGCGUCGGUCCGCUCACUUCGGC ACACUCCAAGGCUGCGACCAAGACGUGUAACGUGCUGGACUAUGGUGCUGUGGCGGACAACUCCACCGACAUUGGGUCCGCCCUCUCAG AAGCCUGGGAUGCGUGCUCGGAUGGAGGUCUGAUCUAUAUUCCUCCUGGUGAUUAUGCGAUGGAUACCUGGGUGUCUCUGUCGGGAGGC AAGGCGACCGCCAUCAUAUUAGACGGCACUAUCUACCGCACUGGCACCGACGGAGGUAAUAUGAUUCUAGUGGAGAAUUCUUCCGACUU UGAGUUGUACAGCAACUCGUCCUCUGGUGCCGUCCAGGGAUUUGGAUAUGUGUACCACCGGGAGGGUGAUCUUGAUGGGCCACGGAUUU UGCGACUCCAGGACGUGAGCAAUUUCGCGGUUCAUGAUAUUAUCCUGGUGGACGCGCCGGCUUUCCACUUCGUCAUGGACGACUGCUCC GAUGGGGAGGUGUACAACAUGGCCAUUCGCGGUGGUAACUCCGGCGGCUUGGAUGGGAUUGAUGUGUGGGGUAGCAACAUCUGGGUCCA CGAUGUCGAGGUGACCAACAAGGAUGAAUGUGUCACGGUCAAGAGCCCUGCCAACAACAUCCUUGUGGAAAGUAUCUACUGCAACUGGA GUGGAGGUUGUGCGAUGGGAUCUCUCGGCGCGGACACCGAUAUCACUGAUAUUCUGUACCGCAACGUUUACACCUGGAGUUCCAACCAG AUGUACAUGAUCAAGAGCAACGGCGGCAGUGGGACAGUCAAUAACACCGUUCUGGAGAACUUCAUUGGACACGGCAACGCUUAUUCUCU GGACGUUGACAGCUACUGGAGCAGCAUGACAGCCGUGGAUGGCGACGGUGUGCAACUGAGCAACAUCACGUUCAAGAACUGGAAGGGAA CGGAGGCGGAUGGCGCCGAACGCGGGCCCAUCAAGGUGGUAUGCUCAGACACGGCCCCUUGCACCGACAUCACCAUCGAGGAUUUUGCC AUGUGGACCGAAAGCGGCGAUGAGCAGACCUACACCUGCGAGUCGGCGUAUGGCGAUGGAUUCUGCCUCGAAGACAGCGAUUCCACCAC CUCGUACACGACCACCCAGACUGUCACCACGGCGCCCUCGGGAUAUUCGGCAACCACGAUGGCAGCGGAUCUCACCACGGACUUUGGCA CGACCGCGUCCAUCCCCAUCCCUACCAUCCCGACUUCCUUCUAUCCCGGCUUGACGGCGAUCAGUCCGUUGGCAUCGGCUGCCACCACG GCAUGA

85

86

APPENDIX 3: Neighbor-Joining Gene Tree Clades

Figure A.3 Neighbor-Joining Gene Tree. Bootstrap values <50 have been removed.

86 87

Figure A.3.a: Clade A

87 88

Figure A.3.b: Clade B (Clade B1 and Clade B2)

88 89

Figure A.3.c: Clade C (Clade C1 and Clade C2)

89 90

Figure A.3.d: Clade D

90 91

Figure A.3.e: Clade E

91 92

Figure A.3.f: Clade F

92 93

Figure A.3.g: Mucoromycotina Clade

93 94

Figure A.3.h: Stramenopile Clade

94

95

APPENDIX 4: Maximum-Likelihood Gene Tree Clades

Figure A.4 Maximum-Likelihood Gene Tree. Bootstrap values <50 have been removed.

95 96

Figure A.4.a: Clade A

96 97

Figure A.4.b: Clade B (Clade B1 and Clade B2)

97 98

Figure A.4.c: Clade C (Clade C1 and Clade C2)

98 99

Figure A.4.d: Clade D

99 100

Figure A.4.e: Clade E

100 101

Figure A.4.f: Clade F

101 102

Figure A.4.g: Mucoromycotina Clade

102 103

Figure A.4.h: Stramenopile Clade

103