Song et al. Page 1
Table S1. Strains used in this study
ESCRT regulates transcription Song et al. Page 2
Strain Genotype Reference of source
BY4741 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 - Euroscarf FY124 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 rad6Δ::KanMX4 Euroscarf FY325 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps27Δ::KanMX4 Euroscarf FY326 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 hse1Δ::KanMX4 Euroscarf FY214 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps23Δ::KanMX4 Euroscarf FY207 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps28Δ::KanMX4 Euroscarf FY208 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps37Δ::KanMX4 Euroscarf FY209 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 mvb12Δ::KanMX4 Euroscarf FY327 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps22Δ::KanMX4 Euroscarf FY328 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps25Δ::KanMX4 Euroscarf FY329 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps36Δ::KanMX4 Euroscarf FY330 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps20Δ::KanMX4 Euroscarf FY331 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps24Δ::KanMX4 Euroscarf FY332 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps32Δ::KanMX4 Euroscarf FY333 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps4Δ::KanMX4 Euroscarf FY334 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 did2Δ::KanMX4 Euroscarf FY335 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vta1Δ::KanMX4 Euroscarf FY336 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps60Δ::KanMX4 Euroscarf FY337 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 bro1Δ::KanMX4 Euroscarf FY339 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps15Δ::KanMX4 Euroscarf FY338 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 vps34Δ::KanMX4 Euroscarf FY235 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 asf1Δ::KanMX4 FY317 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 RPD3-MYC13::HIS3 (Govind et al. (H4228) gcn4Δ::KanMX4 2010) Euroscarf FY420 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 rim8Δ::KanMX4 Euroscarf FY421 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 rim9Δ::KanMX4 Euroscarf FY424 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 rim21Δ::KanMX4 Euroscarf FY426 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 dfg16Δ::KanMX4 Euroscarf FY422 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 rim13Δ::KanMX4 Euroscarf FY423 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 rim20Δ::KanMX4 Euroscarf FY425 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 rim101Δ::KanMX4 Euroscarf FY427 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 ygr122wΔ::KanMX4 FY304 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 VPS27-TAP Open Biosystems tag::HIS3MX6 FY210 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 VPS23-TAP Open Biosystems tag::HIS3MX6 FY305 MATa his3Δ 1 leu2 Δ 0 met15 Δ 0 ura3 Δ 0 VPS22-TAP Open Biosystems
ESCRT regulates transcription Song et al. Page 3
ESCRT regulates transcription Song et al. Page 4
Table S2. Plasmids used in this study
Plasmid Description Reference of source
(Strathern and Higgins pRS316 lca URA3 1991) (Zhang et al. 2008; pKN7 lc URA3 with HIS3-GUS reporter Natarajan et al. 1998) (Hinnebusch et al. 1985; pHYC2 hcb URA3 with UAS ::CYC1-lacZ reporter GCRE Zhang et al. 2008) alc, low-copy number. bhc, high-copy number.
Table S3. Oligonucleotides used in this study
ESCRT regulates transcription Song et al. Page 5
Name Sequence Reference of source
PMA1 PRO-for #1 GGTACCGCTTATGCTCCCCTCCAT (Ahn et al. 2004; Ahn et (630-653) al. 2009) PMA1 PRO-rev #1 CTTTTGAATGTGTGTATAAAAGAGAG (Ahn et al. 2004; Ahn et (886-911) al. 2009) PMA1 CDS1-for #2 CGACGACGAAGACAGTGATAACG (Ahn et al. 2004; Ahn et (1168-1190) al. 2009) PMA1 CDS1-rev #2 ATTGAATTGGACCGACGAAAAACATAAC (Ahn et al. 2004; Ahn et (1349-1376) al. 2009) PMA1 CDS2-for #3 AAGTCGTCCCAGGTGATATTTTGCA (Ahn et al. 2004; Ahn et (1584-1608) al. 2009) PMA1 CDS2-rev #3 AACGAAAGTGTTGTCACCGGTAGC (Ahn et al. 2004; Ahn et (1784-1807) al. 2009) PMA1 CDS4-for #5 CTATTATTGATGCTTTGAAGACCTCCAG (Ahn et al. 2004; Ahn et (3018-3045) al. 2009) PMA1 CDS4-rev #5 TGCCCAAAATAATAGACATACCCCATAA (Ahn et al. 2004; Ahn et (3263-3290) al. 2009) PMA1 UTR2-for #7 GAAAATATTTGGTATCTTTGCAAGATG (Ahn et al. 2004; Ahn et (4287-4313) al. 2009) PMA1 UTR2-rev #7 GTAAATTTGTATACGTTCATGTAAGTG (Ahn et al. 2004; Ahn et (4474-4500) al. 2009) ChrV NO-ORF-for GGCTGTCAGAATATGGGGCCGTAGTA (Ahn et al. 2004; Ahn et (931-956)a al. 2009) ChrV NO-ORF-rev CACCCCGAAGCTGCTTTCACAATAC (Ahn et al. 2004; Ahn et (1054-1078)a al. 2009) aThese primers were used for the amplification of a non-transcribed region of chromosome V.
ESCRT regulates transcription Song et al. Page 6
Supporting information, figure legends
Figure. S1. β-galactosidase reporter assay in ESCRT mutant strains: (A) Schematic diagram of pHYC2 as described in Fig. 3D; (B) β -galactosidase reporter assay in the indicated deletion stains harboring CYC1-lacZ reporter plasmid pHYC2. The expression of the CYC1- lacZ reporter in the indicated mutant strains was measured as described in Fig. 3D. The means and standard deviations from experiment performed in triplicate are plotted as percentages of the WT value.
Figure. S2. Analyses of the global histone H2B ubiquitylation and H3 lysine methylation in
ESCRT-I mutant strains: (A) FLAG purification of H2B from YKH045 (Flag-HTB1),
YKH046 (Flag-htb1-K123R), YKH047 (ubp8Δ) and ESCRT-I mutants in an YKH045 background was probed using an anti-FLAG antibody to monitor both unmodified and modified FLAG-tagged H2B; (B) Whole cell extracts from the strains shown in (A) were subjected to SDS-PAGE and probed with antibodies directed against trimethylated H3 on lysine residues 4, 36 and 79. Histone H3 was used as a loading control.
ESCRT regulates transcription Song et al. Page 7
Supporting information, literature cited
Ahn SH, Keogh MC, Buratowski S (2009) Ctk1 promotes dissociation of basal transcription factors from elongating RNA polymerase II. The EMBO journal 28 (3):205-212. doi:10.1038/emboj.2008.280 Ahn SH, Kim M, Buratowski S (2004) Phosphorylation of serine 2 within the RNA polymerase II C-terminal domain couples transcription and 3' end processing. Molecular cell 13 (1):67-76 Govind CK, Qiu H, Ginsburg DS, Ruan C, Hofmeyer K, Hu C, Swaminathan V, Workman JL, Li B, Hinnebusch AG (2010) Phosphorylated Pol II CTD recruits multiple HDACs, including Rpd3C(S), for methylation-dependent deacetylation of ORF nucleosomes. Mol Cell 39 (2):234-246. doi:10.1016/j.molcel.2010.07.003 Hinnebusch AG, Lucchini G, Fink GR (1985) A synthetic HIS4 regulatory element confers general amino acid control on the cytochrome c gene (CYC1) of yeast. Proceedings of the National Academy of Sciences 82 (2):498-502 Lee KK, Florens L, Swanson SK, Washburn MP, Workman JL (2005) The deubiquitylation activity of Ubp8 is dependent upon Sgf11 and its association with the SAGA complex. Molecular and cellular biology 25 (3):1173-1182. doi:10.1128/MCB.25.3.1173-1182.2005 Natarajan K, Jackson BM, Rhee E, Hinnebusch AG (1998) yTAFII61 has a general role in RNA polymerase II transcription and is required by Gcn4p to recruit the SAGA coactivator complex. Molecular cell 2 (5):683 Strathern JN, Higgins DR (1991) Recovery of plasmids from yeast into Escherichia coli: shuttle vectors. Methods Enzymol 194:319-329 Zhang F, Gaur NA, Hasek J, Kim S-j, Qiu H, Swanson MJ, Hinnebusch AG (2008) Disrupting vesicular trafficking at the endosome attenuates transcriptional activation by Gcn4. Molecular and cellular biology 28 (22):6796-6818
ESCRT regulates transcription