THAT HAD TORTE I USUNA 20180016601A1ALTRA MANIAN LITERATURA UNA ( 19) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2018 / 0016601 A1 Qi et al. ( 43 ) Pub . Date: Jan . 18 , 2018 ( 54 ) METHODS FOR MODULATING GENOME C12N 15 / 10 (2006 .01 ) EDITING A6IK 38 / 46 ( 2006 .01 ) A61K 31 /365 (2006 .01 ) ( 71) Applicants: The Board of Trustees of the Leland A61K 31/ 63 ( 2006 .01 ) Stanford Junior University , Palo Alto , A61K 31 /513 ( 2006 . 01 ) CA (US ) ; The J . David Gladstone A61K 31 /505 ( 2006 .01 ) Institutes , a Testamentary Trust C12Q 1 / 68 ( 2006 .01 ) established under the Will of J . David C12N 9 / 22 ( 2006 . 01 ) Glads, San Francisco , CA ( US) ; The (52 ) U . S . CI. Regents of the University of CPC . .. - . C12N 15/ 907 ( 2013 .01 ) ; C12Q 1 /68 California , Oakland , CA (US ) ( 2013 . 01 ) ; C12Q 1 /44 ( 2013 .01 ) ; C12N 15 / 1024 (2013 .01 ) ; C12N 9 /22 ( 2013. 01 ) ; ( 72 ) Inventors : Lei S . Qi, Palo Alto , CA (US ) ; Sheng A61K 31/ 365 ( 2013 . 01) ; A61K 31 /63 Ding , Orinda , CA ( US ) ; Chen Yu , San ( 2013 .01 ) ; A61K 31/ 513 ( 2013 . 01 ) ; A61K Francisco , CA (US ) 31/ 505 ( 2013. 01 ) ; A61K 38 /465 (2013 . 01 ) (57 ) ABSTRACT ( 21 ) Appl. No. : 15 / 649, 304 Provided herein are methods and kits for modulating (22 ) Filed : Jul. 13 , 2017 genome editing of target DNA . The invention includes using small molecules that enhance or repress homology - directed Related U . S . Application Data repair (HDR ) and / or nonhomologous end joining (NHEJ ) (63 ) Continuation of application No . PCT /US2016 / repair of double - strand breaks in a target DNA sequence . 013375 , filed on Jan . 14 , 2016 . Also provided herein are methods for preventing or treating (60 ) Provisional application No . 62 / 104, 035 , filed on Jan . a genetic disease in a subject by enhancing precise genome 15 , 2015 . editing to correct a mutation in a target gene associated with the genetic disease . Further provided herein are systems and Publication Classification methods for screening small molecule libraries to identify (51 ) Int . Cl. novel modulators of genome editing . The present invention C12N 15 / 90 (2006 .01 ) can be used with any cell type and at any gene locus that is C12Q 1 /44 ( 2006 .01 ) amenable to nuclease -mediated genome editing technology . Patent Application Publication Jan . 18 , 2018 Sheet 1 of 13 US 2018 /0016601 A1 SgNanog 0% template 0.05%. 000000000000000000000000000000000000000 FIG.10 *Caso SgNanog 16.79% iFi SgNanog template 0.26% ensdeconsumoosobnossono * wwwwwww????? FIG.1B ZZZZ X2404040404oco440000000000ococo400000000000ococo40000004cococo Vzd Nanog3'HA neprimerset1 Primersat2 togta5: ascati G winniin SORNAtargetsite www SCHNLO2A- Loftarm(1.8kb)Mightam24 STOFFPLS2A- ML 34horas HOR WOWILS 230 2)DI Mathimit PAM Nanog5'HA SfGFP ECIOCACCAGOR3GAGGTGONDOL insomethinnainen FIG.1A Nanog I. Nanog CCACAAGCCTTGGAATTATTCCTGAACTACTCTGTGACTCCACCAGGTGAAATAGCTACTAACTTCAGCCTGCTGA GAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATGAGACTTACGCAACATCTGGGCITZZZZZZZZZZZZZZZZZZZZZZZZ Patent Application Publication Jan . 18 , 2018 Sheet 2 of 13 US 2018 /0016601 A1 5.9ko5.0kb 3.4kb Jadua: 4,000 96 2 Mean 884 AZT AETA ABrefeldin '. TUE 185241|1 L755507\ Statisticsofsequencedalleles 19296 2,000 Jayquapipunodwoo DMSO 614 0 98 Brefeldinu .6756507 primerset1 primerset2 Chr19 Correct{nsert Alleles Sequenced 1F.FIG 08 OC OLO Bonu + d29 % 6.78% TFT 6,05% cellsCulture w Valdatein12wellplates Seedcells Scanandanalyze + Dectroporation 33.3% BrefeldinA 27.2% L765507 000000000 w 177%- Escels 0% 384-wellplate DMSO Addcompounds Veveria Www SIGFP 00000000000 Counts. ,FIG.1D H FIG.1E Patent Application Publication Jan . 18 , 2018 Sheet 3 of 13 US 2018 / 0016601 A1 www OH ww. Concentration(M) 5.1001 W MO wWww wWw wWw w 0.25 * * * * Mais * * Concentration(UM) 5.1001 * ome * H * 1.00-* ullall0.75 0.50 0.25 Concentration(UM) ho BrefeldinA 001010.105' 2.5 Hey hey 1,5 02 bogen-1. Concentration(M) t755507Alt 0.0115 FIG.1G OSWO 01 paziewou Sie d0 % Patent Application Publication Jan . 18 , 2018 Sheet 4 of 13 US 2018 / 0016601 A1 FIG . 2A PAM SORNA target site 5 * GAAGccGGGccTTCCATTGTCCACCGCAAATGCT 3 * *3 ' CTTCGGCCCGGAAGGTAACAGGTGGCGTTTACGA 5 ! - 8 - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . ????2 12A - Venus Left arm (750 bp ) Right arm (675 bp ) HDR t2A - Venus - B 9 ACTA2 Patent Application Publication Jan . 18 , 2018 Sheet 5 of 13 US 2018 / 0016601 A1 ?????????????????? t2A ACTA23'HA E????????????????????????????????. ?????????????????????????????????GCCGCCGGGATCACTUTCGCCATGGACGAGCTOTACAAGTAATAGGGTACCACTITCCTOc?? FIG.2B ACTA25'HA Venus GGGCTCCATTGTCCACCGCAAATGCTTCGGTACCAGCGGCAGCGGAGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCC . Patent Application Publication Jan . 18 , 2018 Sheet 6 of 13 US 2018 /0016601 A1 PAMSORNAtargetsite wildtype5:GAAGGCCGZETEICOLELAGCSEREGGCC3*SOD13'CTTCCGGCAACCORDANODOSLOGG5* FIG,2D SSOON template WW A4VmutationGTC wildtypeSOD1GCC DMSODMSQ coilstem neural 01755507 X drived-hESCs HUVEC * Fibroblast)2097 -CRL ( K562 FIG.2E FIG,2C Hela SNURA * * ** * * * * * * * * * * * * CCTCGGAACCAGGACCTCGGCGTGGCCTAGCGAGTTATGGCGACGAAGGTCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAAT Patent Application Publication Jan . 18 , 2018 Sheet 7 of 13 US 2018 /0016601 A1 AZT 4. * * * * * * * * * * * * * * * * * * * * * ** * * * ** * * ** * * * * * * * ** ** * * ** * ** * * * * * * * * * * * * * * * * * ** * * Eddoos Sexy 1755507 2987 %260 Cd1905 44444 wwwwwwwwwwwwww 4 - 6 - 764444444 - X , With 2-300I DMSO W0 . 90 999999999 , , , , , , , , 44444444444444444444444 wwwwwwwwwwwwwwwwww FL2 1908 Zdoos Ed 90s 1904 ????????????????????????????? Nanog-sfGFP EScells Nanog 0.41% FIG.2G chools SOGAL4 0.35%(1/288) 3.13%(6/192) 33.3%(32/96) 31.9%(92/288) 27.6%(53/192) 4 40 frequency(26) 3 Indetallelefrequency(%) 30 44Vmutantallele 2 20 1 10 0 0 = {? ????? FIG.2F L755507 Notemplate 209994 }{q Patent Application Publication Jan . 18 , 2018 Sheet 8 of 13 US 2018/ 0016601 A1 Validateusing12-wellplates ? "4 -4 ?? " - INCellAnalyzer* - ? Achemicalscreeningplatformforgenomeinsertion 3daysofculture 1 AddcompoundsSeedcells(2,000/well)Scanandanalyze "h Cas9+SERNAtemplate Electroporation "?? ) cellsEsmouse3x10 ?????????447hh BrefeldinA 3rFle. "4h h ? - « ?F NanogHAS 101102103104 ??????????? -??? 77-44 { ??????????? 2448hh ????????????? -*}{at 101102103104 ??- FIG,3c ? ? ? ? FIG.3A {} ??? FF Patent Application Publication Jan . 18 , 2018 Sheet 9 of 13 US 2018 /0016601 A1 TFT AZT ho L755507DMSO** template*No*** * Cells E14 to normalized m Viability Cell % FIG.3E TFT AZThtttt ABrefeldin11 L755507DMSO oo om templateNo 6 )' 10 * ( Number Cell FIG.3D Patent Application Publication Jan . 18 , 2018 Sheet 10 of 13 US 2018 /0016601 A1 yurish 5:8Kb 3.4kb ngguna104 cellsES 101102103104 103 84.52% 755507 8424% sfGFP-Nanog OMSO Swapumpunganpe101102 cellsES 104 103 Isotype *107102103104 AZT 85.11 wayanngayongtao101102 FIG.4B Primerset1 Primerset2 Nanog FIG.4D oooooooooooooooooooooooooooooooooooooo Count DAPI Resistant Rightarm 2000000000000000000000000000000000000000000000000 Sox2 1 02AWL6SICFO comam 00000 DAPI 2. 29 Sena Oct4 Vanogallele1 Nanogallele2 Primerset2 AZT FIG.4A 000000000000000000000000000000000 FIG.4C L755507 X900 Patent Application Publication Jan . 18 , 2018 Sheet 11 of 13 US 2018 /0016601 A1 Merge DAP! SGFP Nanog DMSO L755507 FIG.44 AZT Merge DAPI SGFP Nanog AZT cels ES 1 SGGFP 2 - SgGFP 3- SgGFP FIG.4E sfGFP- Nanog FIG.4G Patent Application Publication Jan . 18 , 2018 Sheet 12 of 13 US 2018 /0016601 A1 FIG . 5 OMO L755507 ZT winninneneinaniniwinteiiniiniiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiindet mutaion Total reads 24. 998149 ,211 21. 313: 57 202 49 ,067 /63 , 075 Indel 38 50 . 80 % 47 74 % maininnnnnnnnnn ws un59 ,06 % Patent Application Publication Jan . 18 , 2018 Sheet 13 of 13 US 2018 /0016601 A1 No HR No compound * * * * * * * * * * * dog amentinin n ??????????????????????????????????????????????????? 9994444444444 0 . 19 + 0 .09 wanamtamatondobo 9 . 16 # 1 .85 whiratininwinninanaiskonsantren pratamata Winning L755507 SCR7a L755507 + SCR7a : Meeresbian ???????????????????? : www : OSS 14 .67 + 0 .42 14 .7310 .40 melder 21. 90 + 1 .67 hommes times lacouturistiwatiwww itulacionsionistiwww down phomanswww whatsside GFP FIG . 6 US 2018 / 0016601 A1 Jan . 18 , 2018 METHODS FOR MODULATING GENOME BRIEF SUMMARY OF THE INVENTION EDITING 0005 ] The present invention provides methods and kits for modulating genome editing of target DNA . The inven CROSS -REFERENCES TO RELATED tion includes using small molecules that enhance or repress APPLICATIONS homology - directed repair (HDR ) and / or nonhomologous [ 0001 ] The present application is a Continuation of PCT/ end joining (NHEJ ) repair of double - strand breaks in a target US2016 /013375 filed Jan . 14 , 2016 ; which claims priority to DNA sequence . The present invention also provides meth ods for preventing or treating a disease in a subject by U . S . Provisional Patent Application No . 62 / 104 ,035 filed enhancing precise genome editing to correct a mutation in a Jan . 15 , 2015 ; the disclosures which are hereby incorporated target gene associated with the disease . The present inven by reference in their entirety for all purposes . tion further provides systems and methods for screening small molecule libraries to identify novel modulators of STATEMENT AS TO RIGHTS TO INVENTIONS genome editing . The present invention can be used with any MADE