This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Cellular/Molecular Sodium channel β2 subunits prevent action potential propagation failures at axonal branch points. In Ha Cho1, Lauren C. Panzera1, Morven Chin1 and Michael B. Hoppa1 1Department of Biology, Dartmouth College DOI: 10.1523/JNEUROSCI.0891-17.2017 Received: 2 April 2017 Revised: 21 August 2017 Accepted: 22 August 2017 Published: 4 September 2017 Author Contributions : Conceptualization, M.B.H. and I.H.C.; Methodology, M.B.H., L.C.P., M.C. and I.H.C.; Blind analysis of axon morphology, M.C.; Investigation, M.B.H., L.C.P. M.C. and I.H.C.; Writing -- Original Draft, M.B.H and I.H.C.; Writing -- Review & Editing, M.B.H., L.C.P., M.C. and I.H.C.; Funding Acquisition, M.B.H.; Resources, M.B.H.; Supervision, M.B.H. Conflict of Interest: The authors declare no competing financial interests. Corresponding Author: [email protected] Cite as: J. Neurosci ; 10.1523/JNEUROSCI.0891-17.2017 Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted version of this article is published. Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading process. Copyright © 2017 the authors 1 Sodium channel β2 subunits prevent action potential propagation failures at axonal branch 2 points. 3 In Ha Cho1, Lauren C. Panzera1, Morven Chin1, Michael B. Hoppa1* 4 5 Affiliations 6 1Department of Biology, Dartmouth College 7 Contact 8 *Corresponding Author: [email protected] 9 10 11 Running Title 12 Sodium β Subunits and Axonal Action Potential Waveforms 13 14 Key Words 15 Sodium channels; action potential; sodium beta subunits; propagation; axon branch points; neural excita- 16 bility; axon; synapses; scn2b; synaptic transmission; ion channel. 17 18 Introduction 19 636 words 20 21 Character Count 22 47621 1 23 Abstract + 24 Neurotransmitter release depends on voltage-gated Na channels (Navs) to successfully propa- 25 gate an action potential (AP) from the axon hillock to a synaptic terminal. Unmyelinated sections 26 of axon are very diverse structures encompassing branch points and numerous presynaptic termi- 27 nals with undefined molecular partners of Na+ channels. Using optical recordings of Ca2+ and + 28 membrane voltage, we demonstrate that Na channel β2 subunits (Navβ2) are required to prevent 29 AP propagation failures across the axonal arborization of cultured rat hippocampal neurons 30 (mixed male and female). When Navβ2 expression is reduced, we identify two specific pheno- 31 types: (1) membrane excitability and AP-evoked Ca2+ entry are impaired at synapses and (2) AP 32 propagation is severely compromised with over 40% of axonal branches no longer responding to 33 AP-stimulation. We go on to show that a great deal of electrical signaling heterogeneity exists in 34 AP waveforms across the axonal arborization independent of axon morphology. Thus, Navβ2 is a 35 critical regulator of axonal excitability and synaptic function in unmyelinated axons. 36 37 Significance Statement 38 Voltage-gated Ca2+ channels are fulcrums of neurotransmission that convert electrical inputs into 39 chemical outputs in the form of vesicle fusion at synaptic terminals. However, the role of the 40 electrical signal, the presynaptic AP, in modulating synaptic transmission is less clear. What is 41 the fidelity of a propagating AP waveform in the axon and what molecules shape it throughout 42 the axonal arborization? Our work identifies several new features of AP propagation in unmye- 43 linated axons: (1) Branches of a single axonal arborization have variable AP waveforms inde- 44 pendent of morphology; (2) Na+ channel β2 subunits modulate AP-evoked Ca2+-influx; and (3) 45 β2 subunits maintain successful AP propagation across the axonal arbor. These findings are rele- 46 vant to understanding the flow of excitation in the brain. 47 48 49 Introduction 50 The cycle of synaptic transmission is set in motion by an action potential (AP) invading the pre- 51 synaptic terminal (Lisman et al., 2007). Although individual synapses along an axon can have 52 substantially different responses in vesicle release probability and Ca2+ influx (Rosenmund et al., 2 53 1993; Koester and Sakmann, 2000; Ariel et al., 2012; Ermolyuk et al., 2012), the AP is often ig- 54 nored as a source of this variability because of its perception as a uniform “all-or-none” signal. 55 In essence, the AP waveform is a command signal that forces closed voltage-gated Ca2+ channels 56 (Cavs) through a series of conformational transitions to their open-state, a process that is steeply 57 dependent on membrane voltage (Vm) (Li et al., 2007). At the same time, vesicle fusion is also a 58 supra-linear process that is steeply dependent (by a 3rd-4th order power-law) on Ca2+ entry at the 59 synapse (Dodge and Rahamimoff, 1967; Augustine et al., 1985). Therefore the AP shape can ex- 60 ert enormous impact on neurotransmission (Siegelbaum et al., 1982; Sabatini and Regehr, 1997; 61 Borst and Sakmann, 1999; Bischofberger et al., 2002; Rama et al., 2015). 62 Much of what we know about AP shape in mammalian neurons has come from whole-cell re- 63 cordings, with few recordings from axons or synaptic terminals due to their fine structure (Bean, 64 2007). Recent optical measurements of the axonal AP demonstrated localized voltage-gated K+ 65 channel (Kv)3 activity between presynaptic terminals of cerebellar stellate cells (Rowan et al., 66 2014; Rowan et al., 2016). Additionally, subcellular heterogeneities in axonal voltage-gated Na+ 67 channel (Nav) enrichment between the axon and synapse has been demonstrated in inhibitory 68 basket cells (Hu and Jonas, 2014), the calyx of Held (Leao et al., 2005), and Purkinje cells 69 (Kawaguchi and Sakaba, 2015). Taken together, these results suggest that AP shape and mem- 70 brane excitability may in some cases be controlled locally within discrete sections of the axon 71 and/or synaptic terminals. However, the mechanism(s) that define local excitability and ion 72 channel function has yet to be determined for unmyelinated axons. 73 In terms of successful AP propagation, Navs are the critical drivers for active conduction. In the 74 brain Navs are often found as complexes between the pore-forming α-subunit and transmembrane 75 β-subunits (Hartshorne et al., 1982; Isom et al., 1994; Yu et al., 2003; Namadurai et al., 2015). + 76 Na channel β2 subunits (Navβ2) have been shown to regulate membrane trafficking of the pore- 77 forming α subunit (Navα), with acutely-isolated somata from the hippocampus of Navβ2 null 78 mice displaying a ~50% reduction in Na+ current density (Isom et al., 1995; Chen et al., 2002). 79 Additionally, the integral of compound APs recorded from optic nerved bundles was also re- 80 duced, demonstrating a role for Navβ2 to modulate Nav density in the myelinated axon (Chen et 81 al., 2002). Interestingly, NaVβ2 null mice display a resistance to neurodegeneration in an exper- 82 imental model of multiple sclerosis, suggesting an important role for Navβ2 in demyelinated ax- 3 83 ons (O'Malley et al., 2009). As a result of this data, we hypothesized that Navβ2 may play a criti- 84 cal role modulating the AP within normal unmyelinated sections of axon that form en passant 85 synaptic terminals in many regions of they brain. We explore this hypothesis using a combina- 2+ 86 tion of genetically encoded Ca and Vm indicators within single axonal arborizations in dissoci- 87 ated hippocampal neurons. First, we find that normal axons have a large degree of heterogeneity 88 in the waveform throughout the axonal aborization that is independent of axon morphology. Sec- 2+ 89 ond, we demonstrate that depletion of Navβ2 subunits impairs AP-evoked presynaptic Ca in- 90 flux. Third, we report that the Navβ2 subunit plays a critical role in maintaining AP propagation 91 across axonal ramifications of excitatory hippocampal neurons. Taken together, our results point 92 to a fundamental role for Navβ2 for controlling AP waveform fidelity in unmyelinated branches 93 of axonal arborizations and an important role for branch points in axonal signaling beyond con- 94 trolling the timing of synaptic transmission. 95 96 Experimental Procedures 97 Cell culture 98 Hippocampal CA1-CA3 regions were dissected with dentate gyrus removed from P1 Sprague- 99 Dawley rats of either sex (mixed litter), dissociated (bovine pancreas trypsin; 5 min at room tem- 100 perature), and plated on polyornithine-coated coverslips inside a 6 mm diameter cloning cylinder 101 as previously described (Hoppa et al., 2012). Calcium phosphate mediated transfection was per- 102 formed on 5-day-old cultured neurons with the described plasmids (below). All measurements, 103 unless otherwise noted, are from mature 14-24 day old neurons. Experiments with Sprague- 104 Dawley rats were approved by Dartmouth College’s Institutional Animal Care and Use Commit- 105 tee (IACUC). INS-1 cell lines (823/13, passage 47-50) were obtained from Dr. Justin Taraska 106 (NIH). INS-1 cells were cultured and transfected as previously described (Hoppa et al., 2012). 107 108 Plasmids 109 SypGCaMP and α2δ-1 were obtained as previously described (Hoppa et al., 2012) and QuasAr 110 was acquired from Addgene (Plasmid 51692: FCK-QuasAr2-mO2). For knockdown of endoge- 111 nous Navβ2 or Navβ4, prevalidated shRNA plasmids were purchased from Origene against 4 112 mRNA target sequences were (GCTATACCGTGAACCACAAGCAGTTCTCT) and 113 (TACTTCAGGTGGTCCTACAATAACAGCGA), respectively. To confirm shRNA-mediated 114 knockdown data, we inserted sgRNA targeting Navβ2 (CACCGCCACTCTTAG- 115 TGTCCTCAAC) into pU6-(BbsI)CBh-Cas9-T2A-mCherry plasmid purchased from Addgene 116 (Plasmid 64324). For expression of human Navβ2 (NM_004588.3) (Plasmid RC207778).