DOCSLIB.ORG

Sodium Channel Β2 Subunits Prevent Action Potential Propagation Failures at Axonal Branch Points

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sodium Channel Β2 Subunits Prevent Action Potential Propagation Failures at Axonal Branch Points This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Cellular/Molecular Sodium channel β2 subunits prevent action potential propagation failures at axonal branch points. In Ha Cho1, Lauren C. Panzera1, Morven Chin1 and Michael B. Hoppa1 1Department of Biology, Dartmouth College DOI: 10.1523/JNEUROSCI.0891-17.2017 Received: 2 April 2017 Revised: 21 August 2017 Accepted: 22 August 2017 Published: 4 September 2017 Author Contributions : Conceptualization, M.B.H. and I.H.C.; Methodology, M.B.H., L.C.P., M.C. and I.H.C.; Blind analysis of axon morphology, M.C.; Investigation, M.B.H., L.C.P. M.C. and I.H.C.; Writing -- Original Draft, M.B.H and I.H.C.; Writing -- Review & Editing, M.B.H., L.C.P., M.C. and I.H.C.; Funding Acquisition, M.B.H.; Resources, M.B.H.; Supervision, M.B.H. Conflict of Interest: The authors declare no competing financial interests. Corresponding Author: [email protected] Cite as: J. Neurosci ; 10.1523/JNEUROSCI.0891-17.2017 Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted version of this article is published. Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading process. Copyright © 2017 the authors 1 Sodium channel β2 subunits prevent action potential propagation failures at axonal branch 2 points. 3 In Ha Cho1, Lauren C. Panzera1, Morven Chin1, Michael B. Hoppa1* 4 5 Affiliations 6 1Department of Biology, Dartmouth College 7 Contact 8 *Corresponding Author: [email protected] 9 10 11 Running Title 12 Sodium β Subunits and Axonal Action Potential Waveforms 13 14 Key Words 15 Sodium channels; action potential; sodium beta subunits; propagation; axon branch points; neural excita- 16 bility; axon; synapses; scn2b; synaptic transmission; ion channel. 17 18 Introduction 19 636 words 20 21 Character Count 22 47621 1 23 Abstract + 24 Neurotransmitter release depends on voltage-gated Na channels (Navs) to successfully propa- 25 gate an action potential (AP) from the axon hillock to a synaptic terminal. Unmyelinated sections 26 of axon are very diverse structures encompassing branch points and numerous presynaptic termi- 27 nals with undefined molecular partners of Na+ channels. Using optical recordings of Ca2+ and + 28 membrane voltage, we demonstrate that Na channel β2 subunits (Navβ2) are required to prevent 29 AP propagation failures across the axonal arborization of cultured rat hippocampal neurons 30 (mixed male and female). When Navβ2 expression is reduced, we identify two specific pheno- 31 types: (1) membrane excitability and AP-evoked Ca2+ entry are impaired at synapses and (2) AP 32 propagation is severely compromised with over 40% of axonal branches no longer responding to 33 AP-stimulation. We go on to show that a great deal of electrical signaling heterogeneity exists in 34 AP waveforms across the axonal arborization independent of axon morphology. Thus, Navβ2 is a 35 critical regulator of axonal excitability and synaptic function in unmyelinated axons. 36 37 Significance Statement 38 Voltage-gated Ca2+ channels are fulcrums of neurotransmission that convert electrical inputs into 39 chemical outputs in the form of vesicle fusion at synaptic terminals. However, the role of the 40 electrical signal, the presynaptic AP, in modulating synaptic transmission is less clear. What is 41 the fidelity of a propagating AP waveform in the axon and what molecules shape it throughout 42 the axonal arborization? Our work identifies several new features of AP propagation in unmye- 43 linated axons: (1) Branches of a single axonal arborization have variable AP waveforms inde- 44 pendent of morphology; (2) Na+ channel β2 subunits modulate AP-evoked Ca2+-influx; and (3) 45 β2 subunits maintain successful AP propagation across the axonal arbor. These findings are rele- 46 vant to understanding the flow of excitation in the brain. 47 48 49 Introduction 50 The cycle of synaptic transmission is set in motion by an action potential (AP) invading the pre- 51 synaptic terminal (Lisman et al., 2007). Although individual synapses along an axon can have 52 substantially different responses in vesicle release probability and Ca2+ influx (Rosenmund et al., 2 53 1993; Koester and Sakmann, 2000; Ariel et al., 2012; Ermolyuk et al., 2012), the AP is often ig- 54 nored as a source of this variability because of its perception as a uniform “all-or-none” signal. 55 In essence, the AP waveform is a command signal that forces closed voltage-gated Ca2+ channels 56 (Cavs) through a series of conformational transitions to their open-state, a process that is steeply 57 dependent on membrane voltage (Vm) (Li et al., 2007). At the same time, vesicle fusion is also a 58 supra-linear process that is steeply dependent (by a 3rd-4th order power-law) on Ca2+ entry at the 59 synapse (Dodge and Rahamimoff, 1967; Augustine et al., 1985). Therefore the AP shape can ex- 60 ert enormous impact on neurotransmission (Siegelbaum et al., 1982; Sabatini and Regehr, 1997; 61 Borst and Sakmann, 1999; Bischofberger et al., 2002; Rama et al., 2015). 62 Much of what we know about AP shape in mammalian neurons has come from whole-cell re- 63 cordings, with few recordings from axons or synaptic terminals due to their fine structure (Bean, 64 2007). Recent optical measurements of the axonal AP demonstrated localized voltage-gated K+ 65 channel (Kv)3 activity between presynaptic terminals of cerebellar stellate cells (Rowan et al., 66 2014; Rowan et al., 2016). Additionally, subcellular heterogeneities in axonal voltage-gated Na+ 67 channel (Nav) enrichment between the axon and synapse has been demonstrated in inhibitory 68 basket cells (Hu and Jonas, 2014), the calyx of Held (Leao et al., 2005), and Purkinje cells 69 (Kawaguchi and Sakaba, 2015). Taken together, these results suggest that AP shape and mem- 70 brane excitability may in some cases be controlled locally within discrete sections of the axon 71 and/or synaptic terminals. However, the mechanism(s) that define local excitability and ion 72 channel function has yet to be determined for unmyelinated axons. 73 In terms of successful AP propagation, Navs are the critical drivers for active conduction. In the 74 brain Navs are often found as complexes between the pore-forming α-subunit and transmembrane 75 β-subunits (Hartshorne et al., 1982; Isom et al., 1994; Yu et al., 2003; Namadurai et al., 2015). + 76 Na channel β2 subunits (Navβ2) have been shown to regulate membrane trafficking of the pore- 77 forming α subunit (Navα), with acutely-isolated somata from the hippocampus of Navβ2 null 78 mice displaying a ~50% reduction in Na+ current density (Isom et al., 1995; Chen et al., 2002). 79 Additionally, the integral of compound APs recorded from optic nerved bundles was also re- 80 duced, demonstrating a role for Navβ2 to modulate Nav density in the myelinated axon (Chen et 81 al., 2002). Interestingly, NaVβ2 null mice display a resistance to neurodegeneration in an exper- 82 imental model of multiple sclerosis, suggesting an important role for Navβ2 in demyelinated ax- 3 83 ons (O'Malley et al., 2009). As a result of this data, we hypothesized that Navβ2 may play a criti- 84 cal role modulating the AP within normal unmyelinated sections of axon that form en passant 85 synaptic terminals in many regions of they brain. We explore this hypothesis using a combina- 2+ 86 tion of genetically encoded Ca and Vm indicators within single axonal arborizations in dissoci- 87 ated hippocampal neurons. First, we find that normal axons have a large degree of heterogeneity 88 in the waveform throughout the axonal aborization that is independent of axon morphology. Sec- 2+ 89 ond, we demonstrate that depletion of Navβ2 subunits impairs AP-evoked presynaptic Ca in- 90 flux. Third, we report that the Navβ2 subunit plays a critical role in maintaining AP propagation 91 across axonal ramifications of excitatory hippocampal neurons. Taken together, our results point 92 to a fundamental role for Navβ2 for controlling AP waveform fidelity in unmyelinated branches 93 of axonal arborizations and an important role for branch points in axonal signaling beyond con- 94 trolling the timing of synaptic transmission. 95 96 Experimental Procedures 97 Cell culture 98 Hippocampal CA1-CA3 regions were dissected with dentate gyrus removed from P1 Sprague- 99 Dawley rats of either sex (mixed litter), dissociated (bovine pancreas trypsin; 5 min at room tem- 100 perature), and plated on polyornithine-coated coverslips inside a 6 mm diameter cloning cylinder 101 as previously described (Hoppa et al., 2012). Calcium phosphate mediated transfection was per- 102 formed on 5-day-old cultured neurons with the described plasmids (below). All measurements, 103 unless otherwise noted, are from mature 14-24 day old neurons. Experiments with Sprague- 104 Dawley rats were approved by Dartmouth College’s Institutional Animal Care and Use Commit- 105 tee (IACUC). INS-1 cell lines (823/13, passage 47-50) were obtained from Dr. Justin Taraska 106 (NIH). INS-1 cells were cultured and transfected as previously described (Hoppa et al., 2012). 107 108 Plasmids 109 SypGCaMP and α2δ-1 were obtained as previously described (Hoppa et al., 2012) and QuasAr 110 was acquired from Addgene (Plasmid 51692: FCK-QuasAr2-mO2). For knockdown of endoge- 111 nous Navβ2 or Navβ4, prevalidated shRNA plasmids were purchased from Origene against 4 112 mRNA target sequences were (GCTATACCGTGAACCACAAGCAGTTCTCT) and 113 (TACTTCAGGTGGTCCTACAATAACAGCGA), respectively. To confirm shRNA-mediated 114 knockdown data, we inserted sgRNA targeting Navβ2 (CACCGCCACTCTTAG- 115 TGTCCTCAAC) into pU6-(BbsI)CBh-Cas9-T2A-mCherry plasmid purchased from Addgene 116 (Plasmid 64324). For expression of human Navβ2 (NM_004588.3) (Plasmid RC207778).
Load more

Recommended publications
  • The Mineralocorticoid Receptor Leads to Increased Expression of EGFR
    www.nature.com/scientificreports OPEN The mineralocorticoid receptor leads to increased expression of EGFR and T‑type calcium channels that support HL‑1 cell hypertrophy Katharina Stroedecke1,2, Sandra Meinel1,2, Fritz Markwardt1, Udo Kloeckner1, Nicole Straetz1, Katja Quarch1, Barbara Schreier1, Michael Kopf1, Michael Gekle1 & Claudia Grossmann1* The EGF receptor (EGFR) has been extensively studied in tumor biology and recently a role in cardiovascular pathophysiology was suggested. The mineralocorticoid receptor (MR) is an important efector of the renin–angiotensin–aldosterone‑system and elicits pathophysiological efects in the cardiovascular system; however, the underlying molecular mechanisms are unclear. Our aim was to investigate the importance of EGFR for MR‑mediated cardiovascular pathophysiology because MR is known to induce EGFR expression. We identifed a SNP within the EGFR promoter that modulates MR‑induced EGFR expression. In RNA‑sequencing and qPCR experiments in heart tissue of EGFR KO and WT mice, changes in EGFR abundance led to diferential expression of cardiac ion channels, especially of the T‑type calcium channel CACNA1H. Accordingly, CACNA1H expression was increased in WT mice after in vivo MR activation by aldosterone but not in respective EGFR KO mice. Aldosterone‑ and EGF‑responsiveness of CACNA1H expression was confrmed in HL‑1 cells by Western blot and by measuring peak current density of T‑type calcium channels. Aldosterone‑induced CACNA1H protein expression could be abrogated by the EGFR inhibitor AG1478. Furthermore, inhibition of T‑type calcium channels with mibefradil or ML218 reduced diameter, volume and BNP levels in HL‑1 cells. In conclusion the MR regulates EGFR and CACNA1H expression, which has an efect on HL‑1 cell diameter, and the extent of this regulation seems to depend on the SNP‑216 (G/T) genotype.
    [Show full text]
  • Towards Mutation-Specific Precision Medicine in Atypical Clinical
    International Journal of Molecular Sciences Review Towards Mutation-Specific Precision Medicine in Atypical Clinical Phenotypes of Inherited Arrhythmia Syndromes Tadashi Nakajima * , Shuntaro Tamura, Masahiko Kurabayashi and Yoshiaki Kaneko Department of Cardiovascular Medicine, Gunma University Graduate School of Medicine, Maebashi 371-8511, Gunma, Japan; [email protected] (S.T.); [email protected] (M.K.); [email protected] (Y.K.) * Correspondence: [email protected]; Tel.: +81-27-220-8145; Fax: +81-27-220-8158 Abstract: Most causal genes for inherited arrhythmia syndromes (IASs) encode cardiac ion channel- related proteins. Genotype-phenotype studies and functional analyses of mutant genes, using heterol- ogous expression systems and animal models, have revealed the pathophysiology of IASs and enabled, in part, the establishment of causal gene-specific precision medicine. Additionally, the utilization of induced pluripotent stem cell (iPSC) technology have provided further insights into the patho- physiology of IASs and novel promising therapeutic strategies, especially in long QT syndrome. It is now known that there are atypical clinical phenotypes of IASs associated with specific mutations that have unique electrophysiological properties, which raises a possibility of mutation-specific precision medicine. In particular, patients with Brugada syndrome harboring an SCN5A R1632C mutation exhibit exercise-induced cardiac events, which may be caused by a marked activity-dependent loss of R1632C-Nav1.5 availability due to a marked delay of recovery from inactivation. This suggests that the use of isoproterenol should be avoided. Conversely, the efficacy of β-blocker needs to be examined. Patients harboring a KCND3 V392I mutation exhibit both cardiac (early repolarization syndrome and Citation: Nakajima, T.; Tamura, S.; paroxysmal atrial fibrillation) and cerebral (epilepsy) phenotypes, which may be associated with a Kurabayashi, M.; Kaneko, Y.
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Investigating Unexplained Deaths for Molecular Autopsies
    The author(s) shown below used Federal funding provided by the U.S. Department of Justice to prepare the following resource: Document Title: Investigating Unexplained Deaths for Molecular Autopsies Author(s): Yingying Tang, M.D., Ph.D, DABMG Document Number: 255135 Date Received: August 2020 Award Number: 2011-DN-BX-K535 This resource has not been published by the U.S. Department of Justice. This resource is being made publically available through the Office of Justice Programs’ National Criminal Justice Reference Service. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. Final Technical Report NIJ FY 11 Basic Science Research to Support Forensic Science 2011-DN-BX-K535 Investigating Unexplained Deaths through Molecular Autopsies May 28, 2017 Yingying Tang, MD, PhD, DABMG Principal Investigator Director, Molecular Genetics Laboratory Office of Chief Medical Examiner 421 East 26th Street New York, NY, 10016 Tel: 212-323-1340 Fax: 212-323-1540 Email: [email protected] Page 1 of 41 This resource was prepared by the author(s) using Federal funds provided by the U.S. Department of Justice. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. Abstract Sudden Unexplained Death (SUD) is natural death in a previously healthy individual whose cause remains undetermined after scene investigation, complete autopsy, and medical record review. SUD affects children and adults, devastating families, challenging medical examiners, and is a focus of research for cardiologists, neurologists, clinical geneticists, and scientists.
    [Show full text]
  • Non-Coding Rnas in the Cardiac Action Potential and Their Impact on Arrhythmogenic Cardiac Diseases
    Review Non-Coding RNAs in the Cardiac Action Potential and Their Impact on Arrhythmogenic Cardiac Diseases Estefania Lozano-Velasco 1,2 , Amelia Aranega 1,2 and Diego Franco 1,2,* 1 Cardiovascular Development Group, Department of Experimental Biology, University of Jaén, 23071 Jaén, Spain; [email protected] (E.L.-V.); [email protected] (A.A.) 2 Fundación Medina, 18016 Granada, Spain * Correspondence: [email protected] Abstract: Cardiac arrhythmias are prevalent among humans across all age ranges, affecting millions of people worldwide. While cardiac arrhythmias vary widely in their clinical presentation, they possess shared complex electrophysiologic properties at cellular level that have not been fully studied. Over the last decade, our current understanding of the functional roles of non-coding RNAs have progressively increased. microRNAs represent the most studied type of small ncRNAs and it has been demonstrated that miRNAs play essential roles in multiple biological contexts, including normal development and diseases. In this review, we provide a comprehensive analysis of the functional contribution of non-coding RNAs, primarily microRNAs, to the normal configuration of the cardiac action potential, as well as their association to distinct types of arrhythmogenic cardiac diseases. Keywords: cardiac arrhythmia; microRNAs; lncRNAs; cardiac action potential Citation: Lozano-Velasco, E.; Aranega, A.; Franco, D. Non-Coding RNAs in the Cardiac Action Potential 1. The Electrical Components of the Adult Heart and Their Impact on Arrhythmogenic The adult heart is a four-chambered organ that propels oxygenated blood to the entire Cardiac Diseases. Hearts 2021, 2, body. It is composed of atrial and ventricular chambers, each of them with distinct left and 307–330.
    [Show full text]
  • Atrial Fibrillation (ATRIA) Study
    European Journal of Human Genetics (2014) 22, 297–306 & 2014 Macmillan Publishers Limited All rights reserved 1018-4813/14 www.nature.com/ejhg REVIEW Atrial fibrillation: the role of common and rare genetic variants Morten S Olesen*,1,2,4, Morten W Nielsen1,2,4, Stig Haunsø1,2,3 and Jesper H Svendsen1,2,3 Atrial fibrillation (AF) is the most common cardiac arrhythmia affecting 1–2% of the general population. A number of studies have demonstrated that AF, and in particular lone AF, has a substantial genetic component. Monogenic mutations in lone and familial AF, although rare, have been recognized for many years. Presently, mutations in 25 genes have been associated with AF. However, the complexity of monogenic AF is illustrated by the recent finding that both gain- and loss-of-function mutations in the same gene can cause AF. Genome-wide association studies (GWAS) have indicated that common single-nucleotide polymorphisms (SNPs) have a role in the development of AF. Following the first GWAS discovering the association between PITX2 and AF, several new GWAS reports have identified SNPs associated with susceptibility of AF. To date, nine SNPs have been associated with AF. The exact biological pathways involving these SNPs and the development of AF are now starting to be elucidated. Since the first GWAS, the number of papers concerning the genetic basis of AF has increased drastically and the majority of these papers are for the first time included in a review. In this review, we discuss the genetic basis of AF and the role of both common and rare genetic variants in the susceptibility of developing AF.
    [Show full text]
  • 72X36 Poster Template
    Circulating microRNA evaluated in the early aftermath of motor vehicle collision predict widespread pain development in African Americans and provide potential pathogenic insights: results of a preliminary analysis Linnstaedt S1,2, Walker M1,2, Parker J3, Sons RL4, Zinny E5, Lewandowski C5, Hendry PL6, Damiron K7 , Pearson C8, Velilla MA9, Jones J10, Domeier R11, Swor R12, Hammond SM4, McLean S1,2,13 From the 1TRYUMPH Research Program, 2Department of Anesthesiology, UNC-CH and 3Lineberger Comprehensive Cancer Center, UNC-CH; 4Department of Cell Biology and Physiology, UNC-CH; 5Department of Emergency Medicine Henry Ford Hospital; 6Department of Emergency Medicine Shands Jacksonville Medical Center; 7Department of Emergency Medicine Albert Einstein Medical Center; 8Department of Emergency Medicine Detroit Receiving; 9Department of Emergency Medicine Sinai Grace; 10Department of Emergency Spectrum Health-Butterworth Campus; 11 Department of Emergency Medicine St. Joseph Mercy Health System; 12Department of Emergency Medicine William Beaumont Hospital; 13Department of Emergency Medicine, UNC-CH INTRODUCTION FIGURE 1. Study sites and methods TABLE 1. Study characteristics RESULTS microRNA (miRNA) are small non-coding RNA molecules that regulate gene Participant characteristics are shown in Table 1. NGS resulted in an average of 9 expression by binding target mRNA. miRNA are highly stable in blood. Characteristic million sequencing reads per individual, 95% of which aligned to miRNA (Figure 1). Participants, n 75 During the past decade, the study of miRNA has transformed understanding of Fractionate miRNA, Age, yrs, mean (SD) 36 (12) Even in this small sample, 11 miRNA were expressed at significantly different levels in the regulation of major biological pathways and advanced understanding of the prepare for Females, n (%) 44 (58) AA who subsequently did and did not develop WP 6 weeks after MVC (Table 2).
    [Show full text]
  • Spatial Distribution of Leading Pacemaker Sites in the Normal, Intact Rat Sinoa
    Supplementary Material Supplementary Figure 1: Spatial distribution of leading pacemaker sites in the normal, intact rat sinoatrial 5 nodes (SAN) plotted along a normalized y-axis between the superior vena cava (SVC) and inferior vena 6 cava (IVC) and a scaled x-axis in millimeters (n = 8). Colors correspond to treatment condition (black: 7 baseline, blue: 100 µM Acetylcholine (ACh), red: 500 nM Isoproterenol (ISO)). 1 Supplementary Figure 2: Spatial distribution of leading pacemaker sites before and after surgical 3 separation of the rat SAN (n = 5). Top: Intact SAN preparations with leading pacemaker sites plotted during 4 baseline conditions. Bottom: Surgically cut SAN preparations with leading pacemaker sites plotted during 5 baseline conditions (black) and exposure to pharmacological stimulation (blue: 100 µM ACh, red: 500 nM 6 ISO). 2 a &DUGLDFIoQChDQQHOV .FQM FOXVWHU &DFQDG &DFQDK *MD &DFQJ .FQLS .FQG .FQK .FQM &DFQDF &DFQE .FQM í $WSD .FQD .FQM í .FQN &DVT 5\U .FQM &DFQJ &DFQDG ,WSU 6FQD &DFQDG .FQQ &DFQDJ &DFQDG .FQD .FQT 6FQD 3OQ 6FQD +FQ *MD ,WSU 6FQE +FQ *MG .FQN .FQQ .FQN .FQD .FQE .FQQ +FQ &DFQDD &DFQE &DOP .FQM .FQD .FQN .FQG .FQN &DOP 6FQD .FQD 6FQE 6FQD 6FQD ,WSU +FQ 6FQD 5\U 6FQD 6FQE 6FQD .FQQ .FQH 6FQD &DFQE 6FQE .FQM FOXVWHU V6$1 L6$1 5$ /$ 3 b &DUGLDFReFHSWRUV $GUDF FOXVWHU $GUDD &DY &KUQE &KUP &KJD 0\O 3GHG &KUQD $GUE $GUDG &KUQE 5JV í 9LS $GUDE 7SP í 5JV 7QQF 3GHE 0\K $GUE *QDL $QN $GUDD $QN $QN &KUP $GUDE $NDS $WSE 5DPS &KUP 0\O &KUQD 6UF &KUQH $GUE &KUQD FOXVWHU V6$1 L6$1 5$ /$ 4 c 1HXURQDOPURWHLQV
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Pflugers Final
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Serveur académique lausannois A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Sylvain Pradervand2, Annie Mercier Zuber1, Gabriel Centeno1, Olivier Bonny1,3,4 and Dmitri Firsov1,4 1 - Department of Pharmacology and Toxicology, University of Lausanne, 1005 Lausanne, Switzerland 2 - DNA Array Facility, University of Lausanne, 1015 Lausanne, Switzerland 3 - Service of Nephrology, Lausanne University Hospital, 1005 Lausanne, Switzerland 4 – these two authors have equally contributed to the study to whom correspondence should be addressed: Dmitri FIRSOV Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925406 Fax: ++ 41-216925355 e-mail: [email protected] and Olivier BONNY Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925417 Fax: ++ 41-216925355 e-mail: [email protected] 1 Abstract The distal parts of the renal tubule play a critical role in maintaining homeostasis of extracellular fluids. In this review, we present an in-depth analysis of microarray-based gene expression profiles available for microdissected mouse distal nephron segments, i.e., the distal convoluted tubule (DCT) and the connecting tubule (CNT), and for the cortical portion of the collecting duct (CCD) (Zuber et al., 2009). Classification of expressed transcripts in 14 major functional gene categories demonstrated that all principal proteins involved in maintaining of salt and water balance are represented by highly abundant transcripts. However, a significant number of transcripts belonging, for instance, to categories of G protein-coupled receptors (GPCR) or serine-threonine kinases exhibit high expression levels but remain unassigned to a specific renal function.
    [Show full text]
  • Sodium Channel Mutations in Epilepsy and Other Neurological Disorders
    Sodium channel mutations in epilepsy and other neurological disorders Miriam H. Meisler, Jennifer A. Kearney J Clin Invest. 2005;115(8):2010-2017. https://doi.org/10.1172/JCI25466. Review Series Since the first mutations of the neuronal sodium channelS CN1A were identified 5 years ago, more than 150 mutations have been described in patients with epilepsy. Many are sporadic mutations and cause loss of function, which demonstrates haploinsufficiency of SCN1A. Mutations resulting in persistent sodium current are also common. Coding variants of SCN2A, SCN8A, and SCN9A have also been identified in patients with seizures, ataxia, and sensitivity to pain, respectively. The rapid pace of discoveries suggests that sodium channel mutations are significant factors in the etiology of neurological disease and may contribute to psychiatric disorders as well. Find the latest version: https://jci.me/25466/pdf Review series Sodium channel mutations in epilepsy and other neurological disorders Miriam H. Meisler and Jennifer A. Kearney Department of Human Genetics, University of Michigan, Ann Arbor, Michigan, USA. Since the first mutations of the neuronal sodium channel SCN1A were identified 5 years ago, more than 150 muta- tions have been described in patients with epilepsy. Many are sporadic mutations and cause loss of function, which demonstrates haploinsufficiency of SCN1A. Mutations resulting in persistent sodium current are also common. Coding variants of SCN2A, SCN8A, and SCN9A have also been identified in patients with seizures, ataxia, and sen- sitivity to pain, respectively. The rapid pace of discoveries suggests that sodium channel mutations are significant factors in the etiology of neurological disease and may contribute to psychiatric disorders as well.
    [Show full text]
  • Graded Co-Expression of Ion Channel, Neurofilament, and Synaptic Genes in Fast- Spiking Vestibular Nucleus Neurons
    Research Articles: Cellular/Molecular Graded co-expression of ion channel, neurofilament, and synaptic genes in fast- spiking vestibular nucleus neurons https://doi.org/10.1523/JNEUROSCI.1500-19.2019 Cite as: J. Neurosci 2019; 10.1523/JNEUROSCI.1500-19.2019 Received: 26 June 2019 Revised: 11 October 2019 Accepted: 25 October 2019 This Early Release article has been peer-reviewed and accepted, but has not been through the composition and copyediting processes. The final version may differ slightly in style or formatting and will contain links to any extended data. Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fully formatted version of this article is published. Copyright © 2019 the authors 1 Graded co-expression of ion channel, neurofilament, and synaptic genes in fast-spiking 2 vestibular nucleus neurons 3 4 Abbreviated title: A fast-spiking gene module 5 6 Takashi Kodama1, 2, 3, Aryn Gittis, 3, 4, 5, Minyoung Shin2, Keith Kelleher2, 3, Kristine Kolkman3, 4, 7 Lauren McElvain3, 4, Minh Lam1, and Sascha du Lac1, 2, 3 8 9 1 Johns Hopkins University School of Medicine, Baltimore MD, 21205 10 2 Howard Hughes Medical Institute, La Jolla, CA, 92037 11 3 Salk Institute for Biological Studies, La Jolla, CA, 92037 12 4 Neurosciences Graduate Program, University of California San Diego, La Jolla, CA, 92037 13 5 Carnegie Mellon University, Pittsburgh, PA, 15213 14 15 Corresponding Authors: 16 Takashi Kodama ([email protected]) 17 Sascha du Lac ([email protected]) 18 Department of Otolaryngology-Head and Neck Surgery 19 The Johns Hopkins University School of Medicine 20 Ross Research Building 420, 720 Rutland Avenue, Baltimore, Maryland, 21205 21 22 23 Conflict of Interest 24 The authors declare no competing financial interests.
    [Show full text]