Published OnlineFirst January 14, 2016; DOI: 10.1158/1535-7163.MCT-15-0214 Companion Diagnostics and Cancer Biomarkers Molecular Cancer Therapeutics Choline Kinase Alpha (CHKa) as a Therapeutic Target in Pancreatic Ductal Adenocarcinoma: Expression, Predictive Value, and Sensitivity to Inhibitors Jose M. Mazarico1, Victor J. Sanchez-Ar evalo Lobo1, Rosy Favicchio2, William Greenhalf3, Eithne Costello3, Enrique Carrillo-de Santa Pau1, Miriam Marques 1, Juan C. Lacal4, Eric Aboagye2, and Francisco X. Real1,5 Abstract Choline kinase a (CHKa) plays a crucial role in the regulation pancreatic tumors. While cytoplasmic CHKa did not relate to of membrane phospholipid synthesis and has oncogenic prop- survival, nuclear CHKa distribution was observed in 43% of erties in vitro. We have analyzed the expression of CHKa in cell samples and was associated with longer survival, especially lines derived from pancreatic ductal adenocarcinoma (PDAC) among patients with well/moderately differentiated tumors. To and have found increased CHKa expression, associated with identify the mechanisms involved in resistance to CHKa inhibi- differentiation. CHKa protein expression was directly correlated tors, we cultured IMIM-PC-2 cells with increasingly higher con- with sensitivity to MN58b, a CHKa inhibitor that reduced cell centrations of MN58b and isolated a subline with a 30-fold higher growth through the induction of apoptosis. Accordingly, CHKa IC50. RNA-Seq analysis identified upregulation of ABCB1 and knockdown led to reduced drug sensitivity. In addition, we found ABCB4 multidrug resistance transporters, and functional studies that gemcitabine-resistant PDAC cells displayed enhanced sensi- confirmed that their upregulation is the main mechanism tivity to CHKa inhibition and, in vitro, MN58b had additive or involved in resistance. Overall, our findings support the notion synergistic effects with gemcitabine, 5-fluorouracil, and oxalipla- that CHKa inhibition merits further attention as a therapeutic tin, three active drugs in the treatment of PDAC. Using tissue option in patients with PDAC and that expression levels may microarrays, CHKa was found to be overexpressed in 90% of predict response. Mol Cancer Ther; 15(2); 1–11. Ó2016 AACR. Introduction curative intent (2). There is also a lack of effective therapies for advanced disease. Gemcitabine has been the gold-standard treat- Pancreatic adenocarcinoma (PDAC) is the fourth cause of ment for metastatic disease. The combination of 5-fluorouracil (5- cancer-related death in the Western world, with a 5-year survival FU), oxaliplatin, and irinotecan (FOLFIRINOX) and the combi- of <5%. During the last two decades, PDAC-related deaths have nation of gemcitabine with nab-paclitaxel and gemcitabine with only decreased marginally (1). There are multiple reasons for this erlotinib have shown increased antitumor activity (3–6), but there poor outcome. A majority of cases with PDAC are diagnosed at an is a need to identify new therapeutic targets and drugs. advanced stage, with either local (26%) or distant metastases In the last years, there has been a renewed interest in exploiting (53%), and only 20% of patients are candidates for surgery with the metabolic reprogramming that cells undergo upon malignant transformation (7). One promising metabolite deregulated in cancer is choline, an essential nutrient of the B vitamin family that 1Epithelial Carcinogenesis Group, Cancer Cell Biology Programme, Spanish National Cancer Research Center-CNIO, Madrid, Spain. 2Com- is necessary for the synthesis of phosphatidylcholine. Phospha- prehensive Cancer Imaging Centre, Department of Surgery & Cancer, tidylcholine is the most abundant phospholipid of the eukaryotic Imperial College London, Hammersmith Hospital, London, United cell membrane. Tumors show an active choline metabolism Kingdom. 3The NIHR Liverpool Pancreas Biomedical Research Unit, Liverpool, United Kingdom. 4Division of Translational Oncology, manifested by an increase of phosphocholine and total choline Department of Oncology, Fundacion Jimenez Díaz, Madrid, Spain. metabolites required to sustain cell growth and transformation 5 Departament de Ciencies Experimentals i de la Salut, Universitat (8). Phosphatidylcholine is also the precursor of important sec- Pompeu Fabra, Barcelona, Spain. ond messengers and mitogenic signals, such as diacylglycerol or Note: Supplementary data for this article are available at Molecular Cancer arachidonic acid, through its hydrolysis by phospholipases. The Therapeutics Online (http://mct.aacrjournals.org/). first enzyme of the Kennedy pathway, choline kinase, phosphor- Corresponding Authors: Francisco X. Real, Centro Nacional de Investigaciones ylates free choline and generates phosphocholine. Two enzymes Oncologicas, Melchor Fernandez Almagro 3, Madrid 28029, Spain. Phone: 349- have been identified in mammals: choline kinase a (CHKa), of 1732-8000; Fax: 349-1224-6923; E-mail: [email protected]; and Víctor J. Sanchez- which two isoforms are generated by alternative splicing, and Arevalo Lobo, E-mail: [email protected] choline kinase b (CHKb; ref. 9). CHKb has not been reported to be doi: 10.1158/1535-7163.MCT-15-0214 oncogenic (10), but CHKa has been proposed to participate in Ó2016 American Association for Cancer Research. initiation and progression of several tumors (11–14). These www.aacrjournals.org OF1 Downloaded from mct.aacrjournals.org on September 30, 2021. © 2016 American Association for Cancer Research. Published OnlineFirst January 14, 2016; DOI: 10.1158/1535-7163.MCT-15-0214 Mazarico et al. findings render CHKa an attractive therapeutic target. Several 50% weekly at each passage of the cells (split 1:3 when confluent); choline kinase inhibitors (CHKI) have been developed from final concentration was 8 mmol/L. hemicholinium-3. MN58b, a first-generation CHKI-competitive To generate gemcitabine-resistant PDAC cell lines, an incre- inhibitor, has antiproliferative and antitumoral activity in vitro mental dose approach was used. The starting concentration was and in vivo (11, 15–18). Second-generation CHKIs are in phase I 35 nmol/L 20-deoxy-20,20-difluorocytidine monohydrochloride clinical trials (19). (Eli Lilly Ltd). Gemcitabine concentration was maintained con- We aimed to assess the importance of CHKa in PDAC and to stant and was increased 1.5- to 2-fold at each cell passage. The final test the efficacy of its pharmacologic inhibition as a single agent or concentration was 250 nmol/L. Resistant cells were authenticated in combination with the drugs most commonly used in this by STR profiling. tumor. CHKa levels are predictive of drug sensitivity and CHKa downregulation sensitizes cells to other anticancer drugs. We have Growth and viability assays fi identi ed a novel mechanism of acquired resistance to CHKIs, Cells (5  104 per well) were seeded in triplicate in 6-well resulting from the upregulation of multidrug resistant (MDR) plates, trypsinized, and counted. To determine viability, cells proteins. (2  104 per well) were seeded in 24-well plates. After 24 hours, medium was removed and MN58b was added; after 72 hours, Material and Methods cells were fixed with 3% formaldehyde, washed twice with PBS, Cell culture and incubated with 0.5% crystal violet in 25% methanol; crystal The following PDAC cell lines were used: SK-PC-1, SK-PC-3, violet was eluted with 10% acetic acid and the OD590 nm was and IMIM-PC-2 (20); Suit2 007, Suit2 028, T3M4, and PATU 8988 determined. To assess colony formation, cells (5  104 per well) T (M. Buchholz, University of Marburg, Germany); Panc-1, were seeded in 6-well plates and medium was replaced 24 hours RWP-1, BxPC-3 (ATCC); PK-9 (C. Iacobuzzio-Donahue, Memo- later with medium containing MN58b. After 72 hours, cells were rial Sloan Kettering Cancer Center, New York, NY); MZ-PC-4 processed as described earlier. (University of Zurich,€ Switzerland). Oncogene-immortalized HPDE (M. Tsao, University Health Network, Toronto, Canada) Apoptosis assays and hTERT-immortalized human ductal pancreatic cells (HPNE, Cells (5  104 per well) were seeded in 6-well plates in the T. Gress) were used as controls (21). Nonpancreatic cells used presence of increasing concentrations of MN58b. After 24 and were J82, RT112, and HT1376 (bladder; F. Radvanyi, I. Curie, 48 hours, cells were washed with PBS, resuspended in Annexin Paris, France); HT-29 (colon; A. Zweibaum, INSERM, Villejuif, V binding buffer, and incubated with APC-Annexin V (BD – France); human embryonic kidney (HEK) 293T (ATCC); SK- Biosciences) in the dark for 15 to 20 minutes. DAPI was added BR-3, MDA-MB-231 (breast; ATCC). The identity of the lines was for 15 minutes, and viability was assessed in a FACS Canto II fi fi con rmed using short tandem repeat (STR) ngerprinting. Cells flow cytometer (BD Biosciences). Results were quantified using were cultured in DMEM supplemented with 10% FBS, 1% Na FlowJo software (FlowJo version 7.6.1, TreeStar Inc.). pyruvate, and 1% penicillin/streptomycin. All cells were free of mycoplasma contamination. Control nontargeting or CHKa-tar- geting lentiviral particles were produced in HEK-293T cells using Drug synergy assays  4 Sigma Mission plasmids following the manufacturer's instruc- Cells (2 10 per well) were seeded in 24-well plates. After tions. The interfering sequences were: 24 hours, medium was removed and drugs (MN58b, gemcita- bine, oxaliplatin, and 5-FU) were added for 72 hours, alone or Sh-1: GTACCGGGTGTTACTTGCAGGTACTTTGCTCGAGCAAA- in combination, at a range of doses according to the previously GTACCTGCAAGTAACACTTTTTTG;