KNIME Bioinformatics Extensions Karol Kozak ETH Zurich January 2011, Zurich, KNIME SIG your name Start HCS your name HCS Experiments and Informatics your name HCS & Open Source HCDB – OpenBIS & Library Database Bioinformatics KNIME KNIME Matlab Off-Target LIMS WEKA Nodes KNIME, Java Cell Classifiers Spotfire KNIME KNIME Matlab your name Research interest Role Software Classification Database engineering + RNA technology Pattern understanding modeling recognition Annotation database Role of Bioinformatics in RNAi technology to detect functionality of Off-target genes in mammalian cells prediction -New prediction algorithms including Kernel methods -Post analysis of existing hits 2D/3D Structure relationships -Traditional bioinformatics: homology, blast, alignment score -Database development Gene functionality your name RNAi Libraries - Genome wide - Functional groups (Kinases..) - n - Ologinucleotides - Pooled your name RNAi Libraries - Qiagen - Thermo Fisher Scientific (Dharmacon) - Applied Biosystems (Ambion) - Sigma-Aldrich (esiRNA) your name RNAi Library evlolution V1 Purchase Sigma esiRNA AppBiosyst Qiagen TFisher annot annot annot Annot database database database database V2 Dharmacon annot TIME database V3 Less genes Dharmacon More known oligo Today annot New design database Transcripts analysis Off-target information your name Annotation of human genome & Meier Roger Reliability of siRNA libraries Qiagen genome wide siRNA library (HsDgV3 (Human Druggable Genome siRNA Set V3); HsNmV1 (Human Refseq Xm siRNA Set V1); HsXmV1 (Human Predicted genome Set V1)) 2006: 22’832 genes / 90’728 siRNAs 2010: 16’199 genes 0.07 % 0.11 % 0.01 % 0.23 % 0.01 % % of genes target by: 12.512.5% % 10.310.3% % 1 siRNA 2 siRNA 30.630.6% % 41 % 3939% % 3 siRNA 16.516.5% % 41% 25.625.6% % 4 siRNA 71 % 5 siRNA 71% 6 siRNA 3333% % 7 siRNA 2020% % 8 siRNA 9 siRNA target genes with off target(s) siRNAs with off target(s) wrong predicted genes siRNAs against wrong predicted genes target genes siRNAs w/o off target(s) your name Based on GENEID your name Annotated off-target by companies How did companies select these off targets siRNA ? - There are eliminated a lot of Ribosomal siRNA - There are eliminated a lot of siRNA against "membrane" proteins (2061 in old list, 945 in clean list) - did not eliminate many siRNA against "kinase" proteins (2624 in old list, 1605 in list) - besides the 2800 proteins that there are discarded slightly enriched in virus related pathways your name Library reduction • siRNA without geneID? • The web site shows the gene that the siRNA matched at the time it was selected. The database table from which we get current annotation shows what the siRNA matches in the current Refseq. your name Library handling From pooled 2 Oligo based Library analysis your name Bioinformatics - RNAi -Off-target effect UUGCCGUACAGGAUGGACGtg UUAACUGAUGUUCCAAUCCtg your name Sandra Kaestner Bioinformatics your name Bioinformatics your name Workflow your name Project Ribosome biogenesis translation of ribosomal proteins maturation and export of 80S ribosome ribosomal mRNAs ribosomal proteins 80S ribosome Pol II mRNA mature 40S subunit transcription of ribosomal mRNAs maturation and export of pre-40S particle mature 60S subunit pre-40S particle final maturation 90S particle pre-60S particle large ribosomal proteins Pol I Pol III maturation and 35S rRNA 5S rRNA export of pre-60Sparticle small ribosomal rDNA proteins transcription of ribosomal RNAs trans-acting nucleolus nucleoplasm cytoplasm factors 18S rRNA maturation 18S 5.8S 25S 18S 18S 18S 35S rRNA 23S rRNA 20S rRNA 20S rRNA 18S rRNAyour name Thomas Wild The Rps2-YFP read out 80S ribosome ribosomal proteins 80S ribosome mature 40S subunit mature 60S subunit Nucleolus Nucleoplasm Cytoplasm your name The Rps2-YFP read out 80S ribosome ribosomal proteins 80S ribosome mature 40S subunit mature 60S subunit Nucleolus Nucleoplasm Cytoplasm your name The Rps2-YFP read out 80S ribosome ribosomal proteins 80S ribosome mature 40S subunit mature 60S subunit Nucleolus Nucleoplasm Cytoplasm your name The Rps2-YFP read out 80S ribosome ribosomal proteins 80S ribosome mature 40S subunit mature 60S subunit Nucleolus Nucleoplasm Cytoplasm your name Biogenesis siRNA 84062- DTNBP1 AACCTTCAAAGCTGAACTAGA DTNBP1 HCDC RPS3 Transcript NM_001005 your name Results Biogenesis Results RNAi RNAi Library Hit Library + Results = Wonder Eg. 4 oligo Hit LIST Off-target Real in HIT LIST Off-target in Potential Off-targets Hit LIST Results HIT LIST your name Analysis Off targets Known Off-targets Build model your name AllStars MVP_si03 MVP_si06 Uncoating Acidification AllStars si03 si06 MVP Tubulin your name Virus screen 1 out of 3 siRNA TGGGCCTGAGATGCAGGTAAA MVP NM_003010 HCDC Qiagen off-target SM MAP2K4 MAP2K4 6416|NM_003010|2890|AS your name mRNA 2D variants mRNA siRNA - 2D structure relation to Off-target effects - We can model 2D structures quite robust (Metaserver, Python) - We can predict potential-target effects - We must find relation? your name mRNA We want to identify structural motifs in a set of mRNA sequences your name mRNA 3D Structure Nature Movie Nature Movie - Dicer, tRNA, - Off-target relations RNA-RNA i RNP-RNA - Model how RISC is related to microRNA/siRNA and how it finds own target and bind to him your name RNA 3D your name your name Workflow ModeRNA Python BioPython for parsing structural data from the PDB format your name DatabaseHCS and architecture databases (LIMS) Library and annotation But need maintenance Screening experiment Sample, Results, Management, View Done Public database Phenotypic data your name OpenBis - Open Source database your name Screen DB Open Source database HCDB - OpenBIS your name Open Source database OpenBIS (ETH) -web client -Command line client -Java technology, GWT Google your name Screen DB Open Source database HCDB - OpenBIS your name Screen DB Open Source database HCDB - OpenBIS Adam Srebniak your name Screen DB Open Source database HCDB - OpenBIS your name Image Processing and KNIME your name Adam Srebniak Open Source KNIME WEB DESKTOP your name Dharmaco Qiagen Ambion nannot annot Annot database database database Library Oligo dharmacon Oligo qiagen Oligo ambion files With target gene With target gene With target gene www External databases Gene Cross reference database for gene/oligo annotation + Workflow off-target prediction OpenBis your name Image Processing One of the first Open Source: CellProfiler your name High Content Image Processing (HCIP) your name High Content Image Processing (HCIP) your name Teaching module Slawek Mazur your name HCDC-HITS Bio-Formats developed by OME software (Jason Swedlow), UW-Madisonyour name LOCI and Glencoe Software. Gabor Bakos HCDC-HITS your name Gabor Bakos HCDC-HITS your name HCDC-HITS your name HCDC-HITS your name Visualization Improvement your name Lukasz Zwolinski, ETH – PWR Student Acknowledgement Bioquant Heidelberg and ETH Holger Erfle, Karol Kozak, Berend Rind Juergen Reymann, Gabor Csucs, Adam Srebniak Slawek Mazur, Sandra Kaestner Welcome to join TU Konstanz Trinity College IR MPI-IB, Berlin DE TU Breslau: Dorit Merhof Anthony Davies Peter Braun Karol Kozak Andre Maeurer Lukasz Miroslaw your name .