Metabolic stress promotes stop-codon readthrough and phenotypic heterogeneity Hong Zhanga,1, Zhihui Lyua,1, Yongqiang Fanb,c,d,1, Christopher R. Evansb,1, Karl W. Barbere,f, Kinshuk Banerjeeg,2, Oleg A. Igoshing,h, Jesse Rineharte,f, and Jiqiang Linga,3 aDepartment of Cell Biology and Molecular Genetics, The University of Maryland, College Park, MD 20742; bDepartment of Microbiology and Molecular Genetics, McGovern Medical School, University of Texas Health Science Center, Houston, TX 77030; cCollege of Life and Health Sciences, Northeastern University, 110819 Shenyang, People’s Republic of China; dShenyang National Laboratory for Materials Science, Northeastern University, 110819 Shenyang, People’s Republic of China; eDepartment of Cellular & Molecular Physiology, Yale University, New Haven, CT 06520; fSystems Biology Institute, Yale University, New Haven, CT 06520; gCenter for Theoretical Biological Physics, Rice University, Houston, TX 77005; and hDepartment of Bioengineering, Rice University, Houston, TX 77005 Edited by Barry S. Cooperman, University of Pennsylvania, Philadelphia, PA, and accepted by Editorial Board Member Yale E. Goldman August 4, 2020 (received for review July 2, 2020) Accurate protein synthesis is a tightly controlled biological process readthrough also yields a functional peroxisomal lactate dehy- with multiple quality control steps safeguarded by aminoacyl-transfer drogenase in mammals (18) and alters protein localization in RNA (tRNA) synthetases and the ribosome. Reduced translational ac- fungi and animals (19, 20). Furthermore, targeting readthrough curacy leads to various physiological changes in both prokaryotes and of premature stop codons has been actively explored as a ther- eukaryotes. Termination of translation is signaled by stop codons and apeutic strategy to treat genetic diseases (21, 22). In bacteria, catalyzed by release factors. Occasionally, stop codons can be sup- readthrough of stop codons regulates the expression levels of RF2 pressed by near-cognate aminoacyl-tRNAs, resulting in protein variants and amino acid biosynthesis genes (13, 23, 24). Despite these well- with extended C termini. We have recently shown that stop-codon read- established examples of specific functional readthrough products, through is heterogeneous among single bacterial cells. However, little is how global stop-codon readthrough alters during environmental known about how environmental factors affect the level and heteroge- shifts and affects cell fitness remains largely unknown. neity of stop-codon readthrough. In this study, we have combined dual- We have previously developed dual-fluorescence reporters to fluorescence reporters, mass spectrometry, mathematical modeling, and conveniently quantitate stop-codon readthrough levels in the BIOPHYSICS AND COMPUTATIONAL BIOLOGY single-cell approaches to demonstrate that a metabolic stress caused by population and single bacterial cells (15). In a screen for growth excess carbon substantially increases both the level and heterogeneity of stop-codon readthrough. Excess carbon leads to accumulation of acid conditions that affect stop-codon readthrough using these re- metabolites, which lower the pH and the activity of release factors to porters in E. coli, we have uncovered that excess carbon in media promote readthrough. Furthermore, our time-lapse microscopy experi- substantially increases the readthrough levels of UAA, UAG, and ments show that single cells with high readthrough levels are more UGA codons. We further show that such an increase depends on a adapted to severe acid stress conditions and are more sensitive to an drop of pH during bacterial growth in excess carbon. Interestingly, aminoglycoside antibiotic. Our work thus reveals a metabolic stress that excess carbon and low pH not only increase the average level of promotes translational heterogeneity and phenotypic diversity. Significance aithful gene expression demands high fidelity during DNA Freplication, transcription, and translation (1–7). A critical Protein synthesis is a fundamental cellular process that occurs from step to maintain such accuracy is proper termination of protein bacteria to humans. Highly accurate protein synthesis has been synthesis at UAA, UAG, and UGA stop codons, which is cata- shown to be critical for the fitness of the cell and is controlled by lyzed by release factors (RFs) (8, 9). In bacteria, RF1 catalyzes sophisticated molecular mechanisms. One such mechanism is the release of peptides from the peptidyl-transfer RNA (tRNA) at release of mature proteins at stop codons to prevent readthrough. UAA and UAG codons, whereas RF2 releases growing peptides Here we identify an environmental stress that substantially in- at UAA and UGA codons. In eukaryotes, a single class I release creases the level of stop-codon readthrough during protein syn- factor, eRF1, terminates translation at all three stop codons on thesis in bacteria and provide insights into the underlying the ribosome. In nature and in the laboratory, stop codons can be mechanism. Intriguingly, the level of readthrough fluctuates ex- read through with high efficiency by suppressor tRNAs, which tensively among single cells that are genetically identical and grown carry mutations in the anticodon to match the stop codons (10). under the same stress condition. Cells with different levels of This approach is widely used to site-specifically insert non- readthrough vary in phenotypes, and individual cells with high canonical amino acids into proteins of interest (11, 12). Even in readthrough recover better from the acid stress. cells lacking cognate suppressor tRNA, readthrough of stop codons is still prevalent, albeit at lower rates. A global analysis of translation Author contributions: H.Z., Z.L., Y.F., C.R.E., K.W.B., K.B., O.A.I., J.R., and J.L. designed research; H.Z., Z.L., Y.F., C.R.E., K.W.B., K.B., and J.L. performed research; H.Z., Z.L., Y.F., termination in Escherichia coli with ribosome profiling reveals that C.R.E., K.W.B., K.B., O.A.I., J.R., and J.L. analyzed data; and H.Z., Z.L., Y.F., C.R.E., K.W.B., ribosomes occupy the messenger RNA (mRNA) region following K.B., O.A.I., J.R., and J.L. wrote the paper. the stop codons of hundreds of genes (13). Proteomic analyses also The authors declare no competing interest. demonstrate that near-cognate aminoacyl-tRNAs are able to read This article is a PNAS Direct Submission. B.S.C. is a guest editor invited by the stop codons (14, 15). For example, glutamine and tryptophan sup- Editorial Board. press UAG and UGA codons, respectively. In addition, readthrough Published under the PNAS license. of stop codons are programmed events in multiple mammalian and 1H.Z., Z.L., Y.F., and C.R.E. contributed equally to this work. viral genes (16, 17). 2Present address: Department of Chemistry, Acharya Jagadish Chandra Bose College, Stop-codon readthrough adds an extended amino acid se- Kolkata 700020, India. quence to the C terminus and has been shown to be critical for 3To whom correspondence may be addressed. Email: [email protected]. expression of functional protein variants. For example, read- This article contains supporting information online at https://www.pnas.org/lookup/suppl/ through of a UAG stop codon in gag is critical for expression of a doi:10.1073/pnas.2013543117/-/DCSupplemental. protein variant and assembly of retrovirus (17). Stop-codon www.pnas.org/cgi/doi/10.1073/pnas.2013543117 PNAS Latest Articles | 1of6 Downloaded by guest on September 28, 2021 readthrough, but also enhance its fluctuation among single bac- Results terial cells. The individual cells with low and high readthrough Excess Carbon Promotes Stop-Codon Readthrough. To date, little is levels are better prepared for distinct stress conditions, suggesting known about how environmental factors affect stop-codon read- that the metabolic stress caused by excess carbon promotes het- through. To address this question, we used our previously devel- erogeneity of stop-codon readthrough and phenotypic diversity. oped dual-fluorescence reporter system (15) to screen the UGA A B mCherry-TGA-YFP Readthrough or frameshift% Readthrough or C GCTATCTGATCGAATCCACTGATCTGA D mCherry-TGA-YFP XIC= WLQTSAGEAAAK (m/z 616.8171 +2) CspC-TGA-YFP-1: YFP MG1655-LB+Glc rpsD*-LB+Glc 2-PFY-AGT-CpsC : PFY 100% 100% CspC-TGA- CspC-TGA- 9.95E+08 7.67E+09 YFP-1 YFP-2 (Peak Area) (Peak Area) Glucose - + - + Rel. intensity 0 0 α-YFP 105 110 105 110 Retention Time (min) Retention Time (min) α-RpoB RpsG 5 LB LB+glucose XIC= QPALGYLNWTPK (m/z 694.3720 +2) 4 ** P < 0.01 rpsD*-LB+Glc ** MG1655-LB+Glc 100% ** 100% 3 3.79E+07 5.54E+07 (Peak Area) (Peak Area) 2 Rel. intensity 0 0 1 205 210 205 210 Relative readthrough Relative Retention Time (min) Retention Time (min) 0 CspC-TGA-YFP-112 CspC-TGA-YFP-2 Fig. 1. Excess carbon increases the level of stop-codon readthrough. E. coli cells were grown in LB or LB with 1% glucose for 24 h before testing. (A)Dual- fluorescence reporters were used to determine the levels of stop-codon readthrough and frameshift as described previously (15). Fluorescence was quantitated with a plate reader. (B) Western blotting of cell extracts from MG1655 or rpsD* carrying the mCherry-TGA-YFP reporter using an antibody against mCherry. Readthrough of the UGA codon following mCherry yielded the mCherry-YFP fusion protein. (C) An in-frame YFP tag was inserted immediately after the first TGA codon of the native cspC gene (CspC-TGA-YFP-1) or before the second stop codon (CspC-TGA-YFP-2) in E. coli MG1655. The nucleotide sequence of the 3′-end of the cspC gene is shown. Red letters indicate the first and second stop codons. Western blotting shows that readthrough of the cspC UGA codon significantly increased after addition of glucose. Another chromosomal constitutively expressed protein, RpoB, was used as a loading control during Western blotting. (D) Label-free quantitative mass spectrometry analysis of UGA readthrough in the dual-fluorescence reporter protein (mCherry-TGA-YFP) or the native RpsG protein.