Differential Effects of Oxytocin Receptor Antagonists, Atosiban and Nolasiban, on Oxytocin Receptor–Mediated Signaling in Human Amnion and Myometrium S

Differential Effects of Oxytocin Receptor Antagonists, Atosiban and Nolasiban, on Oxytocin Receptor–Mediated Signaling in Human Amnion and Myometrium S

Supplemental material to this article can be found at: http://molpharm.aspetjournals.org/content/suppl/2017/02/10/mol.116.106013.DC1 1521-0111/91/4/403–415$25.00 http://dx.doi.org/10.1124/mol.116.106013 MOLECULAR PHARMACOLOGY Mol Pharmacol 91:403–415, April 2017 Copyright ª 2017 by The Author(s) This is an open access article distributed under the CC BY-NC Attribution 4.0 International license. Differential Effects of Oxytocin Receptor Antagonists, Atosiban and Nolasiban, on Oxytocin Receptor–Mediated Signaling in Human Amnion and Myometrium s Sung Hye Kim, Oliver Pohl, Andre Chollet, Jean-Pierre Gotteland, Adam D. J. Fairhurst, Phillip R. Bennett, and Vasso Terzidou Institute of Reproductive and Developmental Biology, Hammersmith Hospital Campus (S.H.K., A.D.J.F., P.R.B., V.T.) and Chelsea and Westminster Hospital (V.T.), Imperial College London, London, United Kingdom; and ObsEva SA, Geneva, Switzerland (O.P., A.C., J.-P.G.) Downloaded from Received August 31, 2016; accepted January 30, 2017 ABSTRACT One of the most established roles of oxytocin (OT) is in inducing kinase activation in both myometrial and amnion cells. Consistent uterine contractions and labor. Apart from inducing contractions, with the activation of these inflammatory mediators, OT led to molpharm.aspetjournals.org our recent studies showed that OT can also activate proinflamma- increases in the expression of cyclooxygenase-2 and phosphor- tory pathways in both human myometrial and amnion cells, which ylated cytosolic phospholipase A2, which was reflected in prosta- suggests that the proinflammatory role of OT should be taken into glandin E2 synthesis. Inhibition of NF-kB activation by nolasiban account when developing tocolytics targeting the OT/oxytocin also translated to suppression of downstream prolabor gene receptor (OTR) system. The OTR antagonist, atosiban, is currently expression, such as cyclooxygenase-2, C-C motif chemokine used therapeutically for the treatment of preterm labor. We ligand 2, interleukin-6, and interleukin-8. We also demonstrated previously showed that atosiban fails to inhibit the proinflammatory that nolasiban treatment alone has no significant stimulatory effect effects of OT in human amnion; atosiban alone activates nuclear on both the myometrium and amnion. In conclusion, our findings factor-kB(NF-kB) and mitogen activated protein kinases, thus indicate that nolasiban possesses promising potential as a novel upregulating downstream prolabor genes. In contrast with our tocolytic agent for both acute and maintenance therapy, as it at ASPET Journals on September 26, 2021 findings with atosiban, the presence of the orally active OTR inhibits both myometrial contractions and the proinflammatory antagonist, nolasiban, reduced the effect of OT on NF-kBandp38 effects of OT without the biased agonist effects. Introduction The 2012 World Health Organization report Born Too Soon (Howson et al., 2013) highlighted the need for effective Complications arising from preterm labor account for 65% of tocolytic drugs to delay preterm birth in women with preterm neonatal deaths and 50% of neurologic disabilities worldwide. contractions. Advances in the care of preterm infants have dramatically Infection and/or inflammation is associated with activation increased rates of survival, which rise sharply from 1% at of contractile pathways leading to both term and preterm 23 weeks to 99% at 32 weeks. However, this is associated with labor. Furthermore, infection/inflammation and subsequent a reciprocal increase in the risk of complications (Lawn et al., increases in proinflammatory cytokines were found to be 2013). Although advances have been made in the prediction one of the most potent causes of perinatal brain injury and prevention of preterm birth in women identified at high (Dommergues et al., 2000; Thornton et al., 2012). In normal risk based on past history, the overall rate has not decreased. birth weight infants at term, chorioamnionitis and intrauter- ine exposure to maternal infection are associated with peri- This research was supported in part by the Genesis Research Trust [Grant P14758] and the National Institute for Health Research Biomedical Research ventricular leukomalacia and cerebral palsy (Grether and Centre based at Imperial College Healthcare NHS Trust [Grant P45272] and Nelson, 1997; Wu and Colford, 2000). In the case of established Imperial College London. V.T. has worked as a consultant to GlaxoSmithKline. P.R.B. has worked as a consultant to Boehringer Ingelheim, GlaxoSmithKline, chorioamnionitis, it is possible that an effective tocolytic drug Merck Serono, ObsEva SA, and Tokyo Tanabe Pharmaceuticals, drug based solely on the inhibition of uterine contractions could companies with an interest in the pharmacological effects of oxytocin and oxytocin antagonists. P.R.B. holds shares of ObsEva SA. O.P., A.C., and J.-P.G. result in prolonged exposure of the fetus to an adverse are salaried employees of ObsEva SA. environment. Therefore, an optimal tocolytic should also have dx.doi.org/10.1124/mol.116.106013. s This article has supplemental material available at molpharm. anti-inflammatory activity. Although the precise mechanisms aspetjournals.org. responsible for initiating labor in humans remain ambiguous, ABBREVIATIONS: AVP, arginine vasopressin; CCL, C-C motif chemokine ligand; COX, cyclooxygenase; DMEM, Dulbecco’s modified Eagle’s medium; DMSO, dimethylsulfoxide; ERK, extracellular signal–regulated kinase; GPCR, G protein–coupled receptor; 1H NMR, proton nuclear magnetic resonance spectroscopy; IL, interleukin; MAPK, mitogen-activated protein kinase; NF-kB, nuclear factor-kB; OT, oxytocin; OTR, oxytocin receptor; PG, prostaglandin; p-cPLA2, phosphorylated cytosolic phospholipase A2; TLC, thin layer chromatography. 403 404 Kim et al. TABLE 1 Primer sequences for real-time polymerase chain reaction Target Gene Forward Primer Sequence (59 to 39) Reverse Primer Sequence (59 to 39) L19 GCGGAAGGGTACAGCCAAT GCAGCCGGCGCAAA GAPDH TGATGACATCAAGAAGGTGGTGAAG TCCTTGGAGGCCATGTAGGCCAT CCL2 TCTGTGCCTGCTGCTCATAG AGATCTCCTTGGCCACAATG CCL5 CCATATTCCTCGGACACCAC TGTACTCCCGAACCCATTTC COX-2 TGTGCAACACTTGAGTGGCT ACTTTCTGTACTGCGGGTGG IL-6 CCTTCCAAAGATGGCTGAAA AGCTCTGGCTTGTTCCTCAC IL-8 GCCTTCCTGATTTCTGCAGC CGCAGTGTGGTCCACTCTCA SOD2 TTGGCCAAGGGAGATGTTAC AGTCACGTTTGATGGCTTCC GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SOD, superoxide dismutase it is well established that the oxytocin (OT)/oxytocin receptor In this study, we investigated whether the OTR antagonist (OTR) system plays a central role in the biochemistry of nolasiban can inhibit OT-driven activation of the inflamma- term/preterm labor. Functional OTR is expressed both in the tory response in human gestational tissues, and we compared myometrium and fetal membranes (amnion and chorion). OT and contrasted the effects of nolasiban with the currently Downloaded from is widely used for induction/augmentation of both preterm and licensed OTR antagonist atosiban. term labor, and OT binding to its receptor leads to OTR coupling with both Gaq/11 and Gai/o G proteins (Phaneuf et al., 1993). Gaq/11 signaling in the myometrium activates phospho- Materials and Methods lipase C to drive increases in intracellular Ca21 via inositol Cell Culture. Placentas with fetal membranes and myometrial molpharm.aspetjournals.org triphosphate, ultimately leading to contractions. Previous biopsies were collected from term (38–40 weeks of pregnancy), studies showed that OTR signaling through Gai/o reduces nonlaboring women with singleton pregnancies undergoing scheduled cAMP by inhibition of adenylate cyclase activity (Blanks and low-risk elective caesarean section. This study excluded individuals Thornton, 2003; Busnelli et al., 2012). We recently demon- who had preexisting medical conditions, preeclampsia, and/or multi- strated a novel mechanism for OT driving proinflammatory ple pregnancies or had received uterotonics prior to their caesarean effects in human gestational tissues (Kim et al., 2015). In the sections. Samples were collected after participants gave informed consent and the study was approved by the local research ethics amnion, this was found to be via Gai signaling, which leads to activation of mitogen-activated protein kinases (MAPKs) and committees of Queen Charlotte’s and Chelsea Hospital (placenta, nuclear factor-kB(NF-kB), and a subsequent increase in the RREC 2002-6283; and myometrium, RREC 1997-5089). The amnion layer from the placenta was pulled apart from the expression of NF-kB–regulated genes including prostaglandin at ASPET Journals on September 26, 2021 chorion to use for culture. Primary amnion epithelial cells were (PG) synthetic enzymes and inflammatory chemokines/cytokines. established from fetal membranes, as previously described (Bennett OTR antagonists are used in clinical practice for the et al., 1987). For myometrial smooth muscle cell isolation, the biopsies treatment of preterm labor through inhibition of myometrial were dissected into fine pieces and digested in filter-sterilized contractility, but their effect on the proinflammatory effects of collagenase mix [1 mg/ml collagenase 1A, 1 mg/ml collagenase X, OT has been largely ignored. We recently showed that these and 2 mg/ml bovine serum albumin in 1:1 ratio of Dulbecco’s modified OT-driven proinflammatory effects in the amnion are not Eagle’s medium (DMEM)/Ham’s F-12 Nutrient Mixture and serum- inhibited by atosiban. Conversely, atosiban alone results in free DMEM; Sigma-Aldrich, St. Louis, MO] for 45 minutes

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    13 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us