DOCSLIB.ORG

Differential Effects of Oxytocin Receptor Antagonists, Atosiban and Nolasiban, on Oxytocin Receptor–Mediated Signaling in Human Amnion and Myometrium S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differential Effects of Oxytocin Receptor Antagonists, Atosiban and Nolasiban, on Oxytocin Receptor–Mediated Signaling in Human Amnion and Myometrium S Supplemental material to this article can be found at: http://molpharm.aspetjournals.org/content/suppl/2017/02/10/mol.116.106013.DC1 1521-0111/91/4/403–415$25.00 http://dx.doi.org/10.1124/mol.116.106013 MOLECULAR PHARMACOLOGY Mol Pharmacol 91:403–415, April 2017 Copyright ª 2017 by The Author(s) This is an open access article distributed under the CC BY-NC Attribution 4.0 International license. Differential Effects of Oxytocin Receptor Antagonists, Atosiban and Nolasiban, on Oxytocin Receptor–Mediated Signaling in Human Amnion and Myometrium s Sung Hye Kim, Oliver Pohl, Andre Chollet, Jean-Pierre Gotteland, Adam D. J. Fairhurst, Phillip R. Bennett, and Vasso Terzidou Institute of Reproductive and Developmental Biology, Hammersmith Hospital Campus (S.H.K., A.D.J.F., P.R.B., V.T.) and Chelsea and Westminster Hospital (V.T.), Imperial College London, London, United Kingdom; and ObsEva SA, Geneva, Switzerland (O.P., A.C., J.-P.G.) Downloaded from Received August 31, 2016; accepted January 30, 2017 ABSTRACT One of the most established roles of oxytocin (OT) is in inducing kinase activation in both myometrial and amnion cells. Consistent uterine contractions and labor. Apart from inducing contractions, with the activation of these inflammatory mediators, OT led to molpharm.aspetjournals.org our recent studies showed that OT can also activate proinflamma- increases in the expression of cyclooxygenase-2 and phosphor- tory pathways in both human myometrial and amnion cells, which ylated cytosolic phospholipase A2, which was reflected in prosta- suggests that the proinflammatory role of OT should be taken into glandin E2 synthesis. Inhibition of NF-kB activation by nolasiban account when developing tocolytics targeting the OT/oxytocin also translated to suppression of downstream prolabor gene receptor (OTR) system. The OTR antagonist, atosiban, is currently expression, such as cyclooxygenase-2, C-C motif chemokine used therapeutically for the treatment of preterm labor. We ligand 2, interleukin-6, and interleukin-8. We also demonstrated previously showed that atosiban fails to inhibit the proinflammatory that nolasiban treatment alone has no significant stimulatory effect effects of OT in human amnion; atosiban alone activates nuclear on both the myometrium and amnion. In conclusion, our findings factor-kB(NF-kB) and mitogen activated protein kinases, thus indicate that nolasiban possesses promising potential as a novel upregulating downstream prolabor genes. In contrast with our tocolytic agent for both acute and maintenance therapy, as it at ASPET Journals on September 26, 2021 findings with atosiban, the presence of the orally active OTR inhibits both myometrial contractions and the proinflammatory antagonist, nolasiban, reduced the effect of OT on NF-kBandp38 effects of OT without the biased agonist effects. Introduction The 2012 World Health Organization report Born Too Soon (Howson et al., 2013) highlighted the need for effective Complications arising from preterm labor account for 65% of tocolytic drugs to delay preterm birth in women with preterm neonatal deaths and 50% of neurologic disabilities worldwide. contractions. Advances in the care of preterm infants have dramatically Infection and/or inflammation is associated with activation increased rates of survival, which rise sharply from 1% at of contractile pathways leading to both term and preterm 23 weeks to 99% at 32 weeks. However, this is associated with labor. Furthermore, infection/inflammation and subsequent a reciprocal increase in the risk of complications (Lawn et al., increases in proinflammatory cytokines were found to be 2013). Although advances have been made in the prediction one of the most potent causes of perinatal brain injury and prevention of preterm birth in women identified at high (Dommergues et al., 2000; Thornton et al., 2012). In normal risk based on past history, the overall rate has not decreased. birth weight infants at term, chorioamnionitis and intrauter- ine exposure to maternal infection are associated with peri- This research was supported in part by the Genesis Research Trust [Grant P14758] and the National Institute for Health Research Biomedical Research ventricular leukomalacia and cerebral palsy (Grether and Centre based at Imperial College Healthcare NHS Trust [Grant P45272] and Nelson, 1997; Wu and Colford, 2000). In the case of established Imperial College London. V.T. has worked as a consultant to GlaxoSmithKline. P.R.B. has worked as a consultant to Boehringer Ingelheim, GlaxoSmithKline, chorioamnionitis, it is possible that an effective tocolytic drug Merck Serono, ObsEva SA, and Tokyo Tanabe Pharmaceuticals, drug based solely on the inhibition of uterine contractions could companies with an interest in the pharmacological effects of oxytocin and oxytocin antagonists. P.R.B. holds shares of ObsEva SA. O.P., A.C., and J.-P.G. result in prolonged exposure of the fetus to an adverse are salaried employees of ObsEva SA. environment. Therefore, an optimal tocolytic should also have dx.doi.org/10.1124/mol.116.106013. s This article has supplemental material available at molpharm. anti-inflammatory activity. Although the precise mechanisms aspetjournals.org. responsible for initiating labor in humans remain ambiguous, ABBREVIATIONS: AVP, arginine vasopressin; CCL, C-C motif chemokine ligand; COX, cyclooxygenase; DMEM, Dulbecco’s modified Eagle’s medium; DMSO, dimethylsulfoxide; ERK, extracellular signal–regulated kinase; GPCR, G protein–coupled receptor; 1H NMR, proton nuclear magnetic resonance spectroscopy; IL, interleukin; MAPK, mitogen-activated protein kinase; NF-kB, nuclear factor-kB; OT, oxytocin; OTR, oxytocin receptor; PG, prostaglandin; p-cPLA2, phosphorylated cytosolic phospholipase A2; TLC, thin layer chromatography. 403 404 Kim et al. TABLE 1 Primer sequences for real-time polymerase chain reaction Target Gene Forward Primer Sequence (59 to 39) Reverse Primer Sequence (59 to 39) L19 GCGGAAGGGTACAGCCAAT GCAGCCGGCGCAAA GAPDH TGATGACATCAAGAAGGTGGTGAAG TCCTTGGAGGCCATGTAGGCCAT CCL2 TCTGTGCCTGCTGCTCATAG AGATCTCCTTGGCCACAATG CCL5 CCATATTCCTCGGACACCAC TGTACTCCCGAACCCATTTC COX-2 TGTGCAACACTTGAGTGGCT ACTTTCTGTACTGCGGGTGG IL-6 CCTTCCAAAGATGGCTGAAA AGCTCTGGCTTGTTCCTCAC IL-8 GCCTTCCTGATTTCTGCAGC CGCAGTGTGGTCCACTCTCA SOD2 TTGGCCAAGGGAGATGTTAC AGTCACGTTTGATGGCTTCC GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SOD, superoxide dismutase it is well established that the oxytocin (OT)/oxytocin receptor In this study, we investigated whether the OTR antagonist (OTR) system plays a central role in the biochemistry of nolasiban can inhibit OT-driven activation of the inflamma- term/preterm labor. Functional OTR is expressed both in the tory response in human gestational tissues, and we compared myometrium and fetal membranes (amnion and chorion). OT and contrasted the effects of nolasiban with the currently Downloaded from is widely used for induction/augmentation of both preterm and licensed OTR antagonist atosiban. term labor, and OT binding to its receptor leads to OTR coupling with both Gaq/11 and Gai/o G proteins (Phaneuf et al., 1993). Gaq/11 signaling in the myometrium activates phospho- Materials and Methods lipase C to drive increases in intracellular Ca21 via inositol Cell Culture. Placentas with fetal membranes and myometrial molpharm.aspetjournals.org triphosphate, ultimately leading to contractions. Previous biopsies were collected from term (38–40 weeks of pregnancy), studies showed that OTR signaling through Gai/o reduces nonlaboring women with singleton pregnancies undergoing scheduled cAMP by inhibition of adenylate cyclase activity (Blanks and low-risk elective caesarean section. This study excluded individuals Thornton, 2003; Busnelli et al., 2012). We recently demon- who had preexisting medical conditions, preeclampsia, and/or multi- strated a novel mechanism for OT driving proinflammatory ple pregnancies or had received uterotonics prior to their caesarean effects in human gestational tissues (Kim et al., 2015). In the sections. Samples were collected after participants gave informed consent and the study was approved by the local research ethics amnion, this was found to be via Gai signaling, which leads to activation of mitogen-activated protein kinases (MAPKs) and committees of Queen Charlotte’s and Chelsea Hospital (placenta, nuclear factor-kB(NF-kB), and a subsequent increase in the RREC 2002-6283; and myometrium, RREC 1997-5089). The amnion layer from the placenta was pulled apart from the expression of NF-kB–regulated genes including prostaglandin at ASPET Journals on September 26, 2021 chorion to use for culture. Primary amnion epithelial cells were (PG) synthetic enzymes and inflammatory chemokines/cytokines. established from fetal membranes, as previously described (Bennett OTR antagonists are used in clinical practice for the et al., 1987). For myometrial smooth muscle cell isolation, the biopsies treatment of preterm labor through inhibition of myometrial were dissected into fine pieces and digested in filter-sterilized contractility, but their effect on the proinflammatory effects of collagenase mix [1 mg/ml collagenase 1A, 1 mg/ml collagenase X, OT has been largely ignored. We recently showed that these and 2 mg/ml bovine serum albumin in 1:1 ratio of Dulbecco’s modified OT-driven proinflammatory effects in the amnion are not Eagle’s medium (DMEM)/Ham’s F-12 Nutrient Mixture and serum- inhibited by atosiban. Conversely, atosiban alone results in free DMEM; Sigma-Aldrich, St. Louis, MO] for 45 minutes
Load more

Recommended publications
  • E001466.Full.Pdf
    Editorial BMJ Glob Health: first published as 10.1136/bmjgh-2019-001466 on 11 April 2019. Downloaded from WHO recommendations on uterotonics for postpartum haemorrhage prevention: what works, and which one? Joshua P Vogel, 1,2 Myfanwy Williams,3 Ioannis Gallos,4 Fernando Althabe,1 Olufemi T Oladapo1 To cite: Vogel JP, THE GLOBAL BURDEN OF POSTPARTUM trials of tranexamic acid for PPH treatment Williams M, Gallos I, et al. HAEMORRHAGE and a heat-stable formulation of carbetocin WHO recommendations on 6–12 uterotonics for postpartum Obstetric haemorrhage, especially post- for PPH prevention. The increasing haemorrhage prevention: partum haemorrhage (PPH), was responsible number of PPH prevention and management what works, and which for more than a quarter of the estimated 303 options makes it challenging for providers one?BMJ Glob Health 000 maternal deaths that occurred globally in and health system stakeholders to choose 2019;4:e001466. doi:10.1136/ 2015.1 PPH—commonly defined as a blood where and how to invest limited resources in bmjgh-2019-001466 loss of 500 mL or more within 24 hours after order to optimise health outcomes. birth—affects about 6% of all women giving Multiple uterotonics have been eval- Handling editor Seye Abimbola birth.1 Uterine atony is the most common uated for PPH prevention over the past Received 4 February 2019 cause of PPH, but it can also be caused by four decades, including oxytocin receptor Revised 10 March 2019 genital tract trauma, retained placental tissue agonists (oxytocin and carbetocin), prosta- Accepted 16 March 2019 or maternal bleeding disorders. The majority glandin analogues (misoprostol, sulprostone, of women who experience PPH have no iden- carboprost), ergot alkaloids (such as ergo- tifiable risk factor, meaning that PPH preven- metrine/methylergometrine) and combina- tion programmes rely on universal use of PPH tions of these (oxytocin plus ergometrine, © Author(s) (or their prophylaxis for all women in the immediate or oxytocin plus misoprostol).
    [Show full text]
  • Oxytocin Carbetocin
    CARBETOCIN To prevent life-threatening pregnanCy CompliCations Postpartum haemorrhage (PPH) is commonly defined as a blood loss of at least 500 ml within 24 hours after birth, and affects about 5% of all women giving birth around the world. Globally, nearly one quarter of all maternal deaths are associated with PPH, and in most low-income countries it is the main cause of maternal mortality. The use of good quality prophylactic uterotonics can avoid the majority of PPH-associated complications during the third stage of labor (the time between the birth of the baby and complete expulsion of the placenta). In settings where oxytocin is unavailable or its quality cannot be guaranteed, the use of other injectable uterotonics (carbetocin, or if appropriate ergometrine/methylergometrine, or oxytocin and ergometrine fixed-dose combination) or oral misoprostol is recommended for the prevention of PPH. The use of carbetocin (100 μg, IM/IV) is recommended for the prevention of PPH for all births in contexts where its cost is comparable to other effective uterotonics. Carbetocin is only recommended for the prevention of postpartum hemorrhage and not recommended for other obstetric indications, such as labor induction, labor augmentation or treatment of PPH. OXYTOCIN Mode of Action CARBETOCIN Synthetic cyclic peptide form of the Long-acting synthetic analogue of naturally occurring posterior oxytocin with agonist properties. pituitary hormone. Binds to oxytocin Binds to oxytocin receptors in the receptors in the uterine myometrium, uterine smooth muscle, resulting in stimulating contraction of this rhythmic contractions, increased uterine smooth muscle by increasing frequency of existing contractions, the sodium permeability of uterine and increased uterine tone.
    [Show full text]
  • Antitumor Effects of Desmopressin in Combination with Chemotherapeutic Agents in a Mouse Model of Breast Cancer GISELLE V
    ANTICANCER RESEARCH 28 : 2607-2612 (2008) Antitumor Effects of Desmopressin in Combination with Chemotherapeutic Agents in a Mouse Model of Breast Cancer GISELLE V. RIPOLL, SANTIAGO GIRON, MARTIN J. KRZYMUSKI, GUILLERMO A. HERMO, DANIEL E. GOMEZ and DANIEL F. ALONSO Laboratory of Molecular Oncology, Department of Science and Technology, Quilmes National University, Buenos Aires, Argentina Abstract. The vasopressin peptide analog desmopressin has cytotoxicity on tumor cells, suggesting that the compound been used during surgery to prevent bleeding in patients with modulates a complex biological mechanism on the host coagulation defects. Recent experimental and clinical data which influences tumor spread. We further demonstrated that revealed that perioperative desmopressin therapy can perioperative administration of DDAVP dramatically reduced minimize the spread and survival of residual cancer cells. lymph node and lung metastasis in a model of mammary Here, we explored the antitumor effects of desmopressin in tumor manipulation and surgical excision in mice (6). More combination with chemotherapeutic agents using the F3II recently, a veterinary clinical study showed that perioperative mammary carcinoma in syngeneic Balb/c mice. Intravenous DDAVP prolonged disease-free survival in surgically treated administration of desmopressin at a dose of 2 μg/kg together bitches with locally advanced mammary cancer (7). with weekly cycles of carmustine (20 mg/kg) prevented Breast cancer is one of the most commonly diagnosed primary tumor infiltration of the skin. Combination of malignanc ies in women and mortality for the disease is related desmopressin with paclitaxel (25 mg/kg) significantly reduced to the capacity of breast tumor cells to invade and metastasize. metastatic progression to the lung.
    [Show full text]
  • Vasopressin V2 Is a Promiscuous G Protein-Coupled Receptor That Is Biased by Its Peptide Ligands
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.28.427950; this version posted January 28, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Vasopressin V2 is a promiscuous G protein-coupled receptor that is biased by its peptide ligands. Franziska M. Heydenreich1,2,3*, Bianca Plouffe2,4, Aurélien Rizk1, Dalibor Milić1,5, Joris Zhou2, Billy Breton2, Christian Le Gouill2, Asuka Inoue6, Michel Bouvier2,* and Dmitry B. Veprintsev1,7,8,* 1Laboratory of Biomolecular Research, Paul Scherrer Institute, 5232 Villigen PSI, Switzerland and Department of Biology, ETH Zürich, 8093 Zürich, Switzerland 2Department of Biochemistry and Molecular medicine, Institute for Research in Immunology and Cancer, Université de Montréal, Montréal, Québec, Canada 3Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, CA 94305, USA 4The Wellcome-Wolfson Institute for Experimental Medicine, School of Medicine, Dentistry and Biomedical Sciences, Queen's University Belfast, 97 Lisburn Road, Belfast, BT9 7BL, United Kingdom 5Department of Structural and Computational Biology, Max Perutz Labs, University of Vienna, Campus-Vienna-Biocenter 5, 1030 Vienna, Austria 6Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Miyagi 980-8578, Japan. 7Centre of Membrane Proteins and Receptors (COMPARE), University of Birmingham and University of Nottingham, Midlands, UK. 8Division of Physiology, Pharmacology & Neuroscience, School of Life Sciences, University of Nottingham, Nottingham, NG7 2UH, UK. *Correspondence should be addressed to: [email protected], [email protected], [email protected].
    [Show full text]
  • The Oxytocin Receptor Gene (OXTR) Is Associated with Autism Spectrum Disorder: a Meta-Analysis
    Molecular Psychiatry (2015) 20, 640–646 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE The oxytocin receptor gene (OXTR) is associated with autism spectrum disorder: a meta-analysis D LoParo and ID Waldman The oxytocin receptor gene (OXTR) has been studied as a risk factor for autism spectrum disorder (ASD) owing to converging evidence from multiple levels of analysis that oxytocin (OXT) has an important role in the regulation of affiliative behavior and social bonding in both nonhuman mammals and humans. Inconsistency in the effect sizes of the OXTR variants included in association studies render it unclear whether OXTR is truly associated with ASD, and, if so, which OXTR single-nucleotide polymorphisms (SNPs) are associated. Thus, a meta-analytic review of extant studies is needed to determine whether OXTR shows association with ASD, and to elucidate which specific SNPs have a significant effect on ASD. The current meta-analysis of 16 OXTR SNPs included 3941 individuals with ASD from 11 independent samples, although analyses of each individual SNP included a subset of this total. We found significant associations between ASD and the SNPs rs7632287, rs237887, rs2268491 and rs2254298. OXTR was also significantly associated with ASD in a gene-based test. The current meta-analysis is the largest and most comprehensive investigation of the association of OXTR with ASD and the findings suggest directions for future studies of the etiology of ASD. Molecular Psychiatry (2015) 20, 640–646; doi:10.1038/mp.2014.77; published online 5 August 2014 INTRODUCTION sizes.8 Nevertheless, several genes and genomic regions have Autism spectrum disorder (ASD) refers to a group of neuro- shown relatively consistent association with ASD.
    [Show full text]
  • Molecular Basis of Ligand Recognition and Activation of Human V2 Vasopressin Receptor
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.18.427077; this version posted January 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Molecular basis of ligand recognition and activation of human V2 vasopressin receptor Fulai Zhou1, 12, Chenyu Ye2, 12, Xiaomin Ma3, 12, Wanchao Yin1, Qingtong Zhou4, Xinheng He1, 5, Xiaokang Zhang6, 7, Tristan I. Croll8, Dehua Yang1, 5, 9, Peiyi Wang3, 10, H. Eric Xu1, 5, 11, Ming-Wei Wang1, 2, 4, 5, 9, 11, Yi Jiang1, 5, 1. The CAS Key Laboratory of Receptor Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203, China 2. School of Pharmacy, Fudan University, Shanghai 201203, China 3. Cryo-EM Centre, Southern University of Science and Technology, Shenzhen 515055, China 4. School of Basic Medical Sciences, Fudan University, Shanghai 200032, China 5. University of Chinese Academy of Sciences, 100049 Beijing, China 6. Interdisciplinary Center for Brain Information, The Brain Cognition and Brain Disease Institute, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences; 7. Shenzhen-Hong Kong Institute of Brain Science-Shenzhen Fundamental Research Institutions, Shenzhen, China 8. Cambridge Institute for Medical Research, Department of Haematology, University of Cambridge, Cambridge, UK 9. The National Center for Drug Screening, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, 201203 Shanghai, China 10. Department of Biology, Southern University of Science and Technology, Shenzhen 515055, China 11. School of Life Science and Technology, ShanghaiTech University, Shanghai 201210, China 12. These authors contributed equally: Fulai Zhou, Chenyu Ye, and Xiaomin Ma.
    [Show full text]
  • Influence of Demoxytocin on the Behavioural Actions of Melatonin Manoj G
    Journal of Experimental Sciences 2011, 2(8): 07-09 ISSN: 2218-1768 www.scholarjournals.org www.jexpsciences.com JES-Life Sciences Influence of Demoxytocin on the Behavioural Actions of Melatonin Manoj G. Tyagi* and M. Selva Murugan Department of Pharmacology, Christian Medical College, Vellore 632002, Tamilnadu, India Article Info Abstract Article History Oxytocin is stored and released by the posterior pituitary gland. In this study, the influence of Received : 05-05-2011 oxytocin agonist, demoxytocin pretreatment on the behavioural actions of melatonin was Revised : 27-07-2011 ascertained. Swiss albino mice (n=6) were used for this study as control and test groups. Accepted : 27-07-2011 Demoxytocin was injected in a concentration of (20 I.U/kg, i.p) and melatonin was injected (200μg/kg, i.p) 30 minutes before experimentation. The effect of pretreatment with *Corresponding Author demoxytocin was evaluated after melatonin injection on motor-coordination and locomotor Tel : +91-416-2284237 activity. The results of our study suggest that demoxytocin was not able to affect significantly Fax : +91-416-2284237 the actions on motor co-ordination but attenuated the locomotor activity after melatonin Email: treatment. [email protected] ©ScholarJournals, SSR Introduction Oxytocin has been shown to have a role in social was approved by the Institutional Review Board (IRB) and care separation and related stress. Oxytocin serves important roles of animals was taken as per guidelines of CPCSEA, in behaviour regulation and plays important role in emotional Department of Animal Welfare, Government of India. and social bonding (Landgraf, 1995). Oxytocin receptor is Drugs and Chemicals expressed in the central nervous system and is a G protein Melatonin tablets were obtained from Aristo coupled receptor.
    [Show full text]
  • Transition from Biological to Chemical Assay for Quality Assurance of Medicinal Substances (Apis) and Formulated Preparations
    WHO/BS/07.2070 ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva - 8 to 12 October 2007 Discussion paper: Transition from biological to chemical assay for quality assurance of medicinal substances (APIs) and formulated preparations A Bristow National Institute for Biological Standards and Control, Blanche Lane, South Mimms, Potters Bar, Herts EN6 3QG, UK ML Rabouhans, J Joung, DJ Wood World Health Organization, Geneva, Switzerland © World Health Organization 2007 All rights reserved. Publications of the World Health Organization can be obtained from WHO Press, World Health Organization, 20 Avenue Appia, 1211 Geneva 27, Switzerland (tel.: +41 22 791 3264; fax: +41 22 791 4857; e-mail: [email protected] ). Requests for permission to reproduce or translate WHO publications – whether for sale or for noncommercial distribution – should be addressed to WHO Press, at the above address (fax: +41 22 791 4806; e-mail: [email protected] ). The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines for which there may not yet be full agreement. The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended by the World Health Organization in preference to others of a similar nature that are not mentioned. Errors and omissions excepted, the names of proprietary products are distinguished by initial capital letters.
    [Show full text]
  • Tractocile, Atosiban
    ANNEX I SUMMARY OF PRODUCT CHARACTERISTICS 1 1. NAME OF THE MEDICINAL PRODUCT Tractocile 6.75 mg/0.9 ml solution for injection 2. QUALITATIVE AND QUANTITATIVE COMPOSITION Each vial of 0.9 ml solution contains 6.75 mg atosiban (as acetate). For a full list of excipients, see section 6.1. 3. PHARMACEUTICAL FORM Solution for injection (injection). Clear, colourless solution without particles. 4. CLINICAL PARTICULARS 4.1 Therapeutic indications Tractocile is indicated to delay imminent pre-term birth in pregnant adult women with: regular uterine contractions of at least 30 seconds duration at a rate of 4 per 30 minutes a cervical dilation of 1 to 3 cm (0-3 for nulliparas) and effacement of 50% a gestational age from 24 until 33 completed weeks a normal foetal heart rate 4.2 Posology and method of administration Posology Treatment with Tractocile should be initiated and maintained by a physician experienced in the treatment of pre-term labour. Tractocile is administered intravenously in three successive stages: an initial bolus dose (6.75 mg), performed with Tractocile 6.75 mg/0.9 ml solution for injection, immediately followed by a continuous high dose infusion (loading infusion 300 micrograms/min) of Tractocile 37.5 mg/5 ml concentrate for solution for infusion during three hours, followed by a lower dose of Tractocile 37.5 mg/5 ml concentrate for solution for infusion (subsequent infusion 100 micrograms/min) up to 45 hours. The duration of the treatment should not exceed 48 hours. The total dose given during a full course of Tractocile therapy should preferably not exceed 330.75 mg of atosiban.
    [Show full text]
  • Largescale Synthesis of Peptides
    Lars Andersson1 Lennart Blomberg1 Large-Scale Synthesis of Martin Flegel2 Ludek Lepsa2 Peptides Bo Nilsson1 Michael Verlander3 1 PolyPeptide Laboratories (Sweden) AB, Malmo, Sweden 2 PolyPeptide Laboratories SpoL, Prague, Czech Republic 3 PolyPeptide Laboratories, Inc., Torrance, CA, 90503 USA Abstract: Recent advances in the areas of formulation and delivery have rekindled the interest of the pharmaceutical community in peptides as drug candidates, which, in turn, has provided a challenge to the peptide industry to develop efficient methods for the manufacture of relatively complex peptides on scales of up to metric tons per year. This article focuses on chemical synthesis approaches for peptides, and presents an overview of the methods available and in use currently, together with a discussion of scale-up strategies. Examples of the different methods are discussed, together with solutions to some specific problems encountered during scale-up development. Finally, an overview is presented of issues common to all manufacturing methods, i.e., methods used for the large-scale purification and isolation of final bulk products and regulatory considerations to be addressed during scale-up of processes to commercial levels. © 2000 John Wiley & Sons, Inc. Biopoly 55: 227–250, 2000 Keywords: peptide synthesis; peptides as drug candidates; manufacturing; scale-up strategies INTRODUCTION and plants,5 have all combined to increase the avail- ability and lower the cost of producing peptides. For For almost half a century, since du Vigneaud first many years, however, the major obstacle to the suc- presented his pioneering synthesis of oxytocin to the cess of peptides as pharmaceuticals was their lack of world in 1953,1 the pharmaceutical community has oral bioavailability and, therefore, relatively few pep- been excited about the potential of peptides as “Na- tides reached the marketplace as approved drugs.
    [Show full text]
  • Rational Use of Uterotonic Drugs During Labour and Childbirth
    Prevention and initial management of postpartum haemorrhage Rational use of uterotonic drugs during labour and childbirth Prevention and treatment of postpartum haemorrhage December 2008 Editors This manual is made possible through sup- Prevention of postpartum hemorrhage port provided to the POPPHI project by the initiative (POPPHI) Office of Health, Infectious Diseases and Nu- trition, Bureau for Global Health, US Agency for International Development, under the POPPHI Contacts terms of Subcontract No. 4-31-U-8954, under Contract No. GHS-I-00-03-00028. POPPHI is For more information or additional copies of implemented by a collaborative effort be- this brochure, please contact: tween PATH, RTI International, and Engen- Deborah Armbruster, Project Director derHealth. PATH 1800 K St., NW, Suite 800 Washington, DC 20006 Tel: 202.822.0033 Susheela M. Engelbrecht Senior Program Officer, PATH PO Box 70241 Overport Durban 4067 Tel: 27.31.2087579, Fax: 27.31.2087549 [email protected] Copyright © 2009, Program for Appropriate Tech- www.pphprevention.org nology in Health (PATH). All rights reserved. The material in this document may be freely used for educational or noncommercial purposes, provided that the material is accompanied by an acknowl- edgement line. Table of contents Preface………………………………………………………………………………………………………………………………………………….3 Supportive care during labour and childbirth…………………………………………………………………………………….4 Rational use of uterotonic drugs during labour………………………………………………………………………………...5 Indications and precautions for augmentation
    [Show full text]
  • Hemmo Pharmaceuticals Private Limited
    Global Supplier of Quality Peptide Products Hemmo Pharmaceuticals Private Limited Corporate Presentation Privileged & Confidential Privileged & Confidential Corporate Overview Privileged & Confidential 2 Company at a glance • Commenced operations in 1966 as a Key Highlights trading house, focusing on Oxytocin amongst other products Amongst the largest Indian peptide manufacturing company • In 1979, ventured into manufacturing of Oxytocin Competent team of 154 people including 6 PhDs, 60+ chemistry graduates/post graduates and 3 engineers • Privately held family owned company Portfolio – Generic APIs, Custom Peptides for Research and Clinical Development and Peptide • Infrastructure Fragments − State of art manufacturing facility in Developed 21 generic products in-house. Navi Mumbai, 5 more in progress − R&D facilities at Thane and Spain − Corporate office at Worli First and the only independent Indian company to have a US FDA approved peptide manufacturing site Privileged & Confidential 3 Transition from a trading house to a research based manufacturing facility Commenced Commenced Investment in State of the Art Opened R& D Expanded operations manufacturing greenfield project facility at Navi Centre in manufacturing as a trading of peptides intended for Mumbai Girona,Spain capacity House regulated markets commissioned R&D center set up in Infrastructure Mumbai 1966 1979 2005 2007 2008 2010 2011 2012 2014 2015 Oxytocin Oxytocin Desmopressin Buserelin Triptorelin Goserelin Linaclotide Glatiramer amongst Gonadorelin Decapeptide Cetrorelix
    [Show full text]