ISSN 1392-3196 Zemdirbyste-Agriculture Vol. 103, No. 2 (2016) 199 ISSN 1392-3196 / e-ISSN 2335-8947 Zemdirbyste-Agriculture, vol. 103, No. 2 (2016), p. 199‒206 DOI 10.13080/z-a.2016.103.026 Molecular characterization of Pseudomonas syringae pvs. from different host plants by repetitive sequence-based PCR and multiplex-PCR Renata ILIČIĆ1, Jelica BALAŽ1, Vera STOJŠIN1, Ferenc BAGI1, Radmila PIVIĆ2, Aleksandra STANOJKOVIĆ-SEBIĆ2, Dragana JOŠIĆ2 1Faculty of Agriculture, University of Novi Sad Trg Dositeja Obradovića 8, 21000 Novi Sad, Serbia E-mail: [email protected] 2Institute of Soil Science Teodora Drajzera 7, 11000 Belgrade, Serbia Abstract Pseudomonas syringae pvs., isolated from different cultivars of sweet cherry grown in several locations in Serbia, were characterized and compared with strains collected earlier from sour and sweet cherry and oil pumpkin growing in this region, as well as with reference strains P. syringae pv. morsprunorum race 1 CFBP2119, P. s. pv. lachrymans 765R and P. s. pv. syringae H-1. By employing LOPAT and GATTa tests, isolates were identified as P. syringae pv. syringae and P. s. pv. morsprunorum race 1. Simultaneous detection of syringomycin synthesis (syrB) and syringomycin secretion (syrD) genes in multiplex-polymerase chain reaction (m-PCR) was used for P. syringae pv. syringae confirmation. All isolates detected asP. syringae pv. morsprunorum race 1 after biochemical characterization were positive for cfl gene amplification. Using a repetitive sequence-based PCR (rep-PCR) both syringae and morsprunorum race 1 pathovars were clustered separately, with 42% similarity. No significant differences between isolates in each pathovar were noted, although they were collected from different sweet cherry cultivars and varying localities. The most similar to the P. syringae pv. syringae isolates was strain T6 with 19% similarity, followed by strain Tk21 from oil pumpkin – 25%. The isolates of both pathovars were detected on the same location (Selenca, Serbia) and the same cultivar (‘Merchant’), albeit in two different years. Key words: oil pumpkin, sour cherry, sweet cherry, cfl, syrB, syrD. Introduction Pseudomonas syringae (van Hall) 1902 is determined oil pumpkin (Cucurbita pepo L.) as a new polyphagous and widely spread species of phytopathogenic host. Oil pumpkin is a special form of ordinary pumpkin bacteria globally as well as in Serbia. Pathovars of and has recently become an increasingly important P. syringae are very important causal agents of bacterial source of high-quality oil rich seeds. Diseases common diseases in numerous woody and herbaceous plants. Based to pumpkin varieties are presently poorly investigated on the pathogenic characteristics and host range bacteria, in Serbia. However, empirical evidence indicates that P. syringae is divided into more than 60 pathovars, and increased production has been accompanied by more on the basis of DNA homology, nine genomospecies frequent appearance of leaf spots at the beginning of can be distinguished (Gardan et al., 1999). In Serbia, the growing season, caused by P. syringae pv. syringae. P. syringae pv. syringae was determined as a pathogen Based on the classical bacteriological test LOPAT for apricot, sweet and sour cherry, pear, apple, plum, (production of levan, hypersensitivity to tobacco leaves, peach, raspberry and many other herbaceous plants. The and presence of oxidase, potato soft rot and arginine pathovar P. syringae pv. morsprunorum Wormald (1931) dihydrolase) bacteria P. syringae belong to fluorescent is also present on stone fruits (Gavrilović et al., 2012; Pseudomonas Group Ia (Lelliott et al., 1966). GATTa Ivanović et al., 2009; 2012). Based on bacteriophage tests (gelatin liquefaction, aesculin hydrolysis, tyrosinase typing, two races of P. s. pv. morsprunorum have activity and utilization of tartrate) clearly differentiate been described, namely race 1 which is pathogenic to P. syringae pv. syringae (G+A+T−Ta−), P. syringae pv. cherry, plum and apricot, and race 2 that infects cherry morsprunorum race 1 (G−A−T+Ta+) and P. syringae pv. only (Bultreys, Kaluzna, 2010). Host range of bacteria morsprunorum race 2 (G+A−T−Ta−) (Latorre, Jones, P. syringae pv. syringae in Serbia continues to expand on 1979). The fact that P. syringae produce several well- new plant species and recently Balaž et al. (2014) have characterized phytotoxic compounds specific to the Molecular characterization of Pseudomonas syringae pvs. from different host plants by repetitive 200 sequence-based PCR and multiplex-PCR pathovar was explored as a viable method for their only representative isolates were used (Table). We also identification. The genes for syringomycin synthesis included strains P. syringae intermediate forms V-85 (syrB) and syringomycin secretion (syrD) are specific (fruit) (Sabac) from sour cherry and one from sweet cherry to the P. syringae pv. syringae, whereas coronatine V-109 (canker) (Subotica). In addition, French collection production gene (cfl) is specific to the P. syringae pv. of plant pathogenic bacteria CFBP2119 (P. syringae pv. morsprunorum race 1 (Kaluzna et al., 2012). Because morsprunorum) and 765R (P. syringae pv. lachrymans) multiplex-polymerase chain reaction (m-PCR) allows were used as reference strains. The strains P. syringae pv. the amplification of more than one target region in one syringae H-1 from sour cherry and T6 (were also used for PCR reaction mixture and can reduce the time and comparison. LOPAT (levan production, oxidase response, labour input compared with single PCR, this method has potato tuber rot, presence of arginine dihydrolase, previously been employed for detection of a number of hypersensitive reaction in tobacco leaves) tests according pathogens, including Clavibacter michiganensis subsp. to Lelliott et al. (1966) and GATTa (gelatin liquefaction, michiganensis, P. syringae pv. tomato, P. savastanoi pv. aesculin hydrolysis, tyrosinase activity and utilization savastanoi and Xanthomonas axonopodis pv. vesicatoria of tartrate) according to Latorre and Jones (1979) were (Özdemir, 2009). In our study, m-PCR was utilized to performed. facilitate detection of genes for syringomycin synthesis Bacterial strains were grown on King B medium, and secretion (syrB and syrD) and to characterize isolates at 26°C for 24 h. The cells were boiled for 10 min, cooled of P. syringae pvs. from sweet cherry. P. syringae pv. on ice, and centrifuged at 13000 rpm for 3 min, after syringae are polyphagous bacteria. Moreover, due to the which the supernatant with total DNA extracted was kept spreading on the new host, it is important to determine at −20°C. genetic heterogeneity between P. syringae pv. syringae Two sets of primers were simultaneously used strains originating from different and the same hosts. in m-PCR: B1 (CTTTCCGTGGTCTTGATGAGG) and The genetic heterogeneity of P. syringae pv. syringae B2 (TCGATTTTGCCGTGATGAGTC) specific to syrB strains was examined by many authors (Vicente, Roberts, gene, and SyD1 (CAGCGGCGTTGCGTCCATTGC) and 2007; Abbasi et al., 2011; Dariush et al., 2012). Various SyD2 (TGCCGCCGACGATGTAGACCAGC), specific molecular techniques have been used to characterize to syrD gene. Those primer sets were previously used in P. syringae pv. syringae strains, with the findings a separate polymerase chain reaction (PCR) during P. s. revealing high genetic heterogeneity between P. syringae pv. syringae testing (Natalini et al., 2006; Gašić et al., pv. syringae strains originating from different and the 2012; Ivanović et al., 2012). PCR amplification was same hosts (Natalini et al., 2006; Gilbert et al., 2009; carried out in a 30 µl reaction volume using GreenTaq Kaluzna et al., 2010; Ivanović et al., 2012). Repetitive Dream Master Mix (Thermo Scientific, Lithuania) with element sequence-based PCR (rep-PCR) is based on 1.2 µl of template DNA and 50 pmol of each primer three main sets of repetitive DNA elements: the repetitive (B1/B2 and SyD1/SyD2) (Metabion, International AG, extragenic palindromic (REP) elements (REP-PCR), the Germany). The program was comprised of 5 min of initial enterobacterial repetitive intergenic consensus (ERIC) denaturation at 94°C, followed by 35 cycles of 1.25 min sequences (ERIC-PCR) and BOX elements (BOX-PCR), at 94°C, 1.25 min at 61°C, 2 min at 72°C and a 7 min of and this method is successful in typing a variety of final extension at 72°C. bacteria, as well as P. syringae (Vicente, Roberts, 2007; Gene cfl (coronatine production) is specific to the Marques et al., 2008; Kaluzna et al., 2010). P. s. pv. morsprunorum race 1 and produces an amplicon of The aim of this study was to characterize and 650 bp using primer set Primer1/2 (Metabion International compare P. syringae pvs. strains originating from sweet AG, Germany). Amplification conditions adopted in this cherry, sour cherry and oil pumpkin using rep-PCR. In work followed the recommendations of Gašić et al. (2012). order to facilitate detection of genes for syringomycin PCR amplification was carried out in a 30 µl reaction synthesis and secretion (syrB and syrD), respectively, the volume using GreenTaq Dream Master Mix (Thermo combination of two sets of primers in the same reaction Scientific, Lithuania) with 1.2 µl of template DNA and 50 was used in m-PCR. pmol of primer1/primer2. The program was comprised of 2 min initial denaturation at 93°C, followed by 37 cycles Material and methods of 2 min at 93°C, 1 min at 67°C, and 2 min at 72°C, with a The 155 isolates of Pseudomonas syringae 10 min of final extension at 72°C. employed in this study were obtained from diseased rep-PCR analysis was performed using two primer branches (cankers) and leaves (bacterial spots) of sweet sets for REP (REP IR-I/REP 2-I) and ERIC (ERIC1R/ cherry from several localities in Vojvodina during 2012, ERIC2) and two primers for BOX-PCR (BOX A1R and 2013 and 2014. In addition, eight isolates from oil pumpkin (GTG)5), as recommended by Marques et al. (2008) and were collected near Bački Petrovac (experimental fields, Gilbert et al. (2009). Amplification was conducted in Institute of Field and Vegetable Crops) during the 25 µl of reaction mixture containing GreenTaq Dream 2008–2013 period and were subsequently identified asP.