Supplemental Figure 1. Dissociation (Melting) Curves for All the Genes Were Checked

Supplemental Figure 1. Dissociation (Melting) Curves for All the Genes Were Checked

Supplemental figure 1. Dissociation (melting) curves for all the genes were checked for the presence of primer dimers or spurious and not specific products. qPCR was performed on 4-fold serial dilutions of pool of zebrafish cDNA (WT and mibhi904; 3dpf) using 100 nM of each Primer, and SybrGreen® PCR Master Mix. Reactions were amplified by 45 cycles of PCR using ABI Prism® 7700 Sequence Detection System (Applied Biosystems). The melting curve analysis was performed by denaturation at 95°C for 15 sec, followed by a standard increasing ramp rate of the instrument from 60°C to 95°C. The X-axis is temperature and the Y-axis is Derivative or Fluorescence. Colored lines indicate template-specific reactions. Black lines indicate no-template controls (NTC). β-act: beta-actin; BDNF: brain derived neurotrophic factor; PYYa: peptide YYa; GAD1: glutamate decarboxylase 1; Gabra1: gamma-aminobutyric acid A receptor, alpha 1. Supplemental figure 2. Gene expression profile in microarray. A. Scattergram analysis (±13,151 array probes selected after elimination of controls and blank); B. Hierarchical clustering analysis of the data set ≤(P 0.05, T -test; GeneSpring GX 7.3.1). Each horizontal strip represents expression of a single gene. The up-regulation is shown in red and the down-regulation in green. Supplemental figure 3. Pictorial representation of significantly up-regulated (A) and down-regulated (B) genes categorized based on known biological functions (Gene Ontology database). Pie charts show % of genes belonging to different biological process: development, transport, immune response/response to a stimulus and cellular process (shown in pink colour). The genes involved in cellular process, has been sub- grouped in other functional categories (pies charts on right side). Supplemental figure 4. Expression pattern of glycine receptor alphaZ4 subunit (GLRA4b) in WT and mibhi904 zebrafish (3 dpf). A. Detection of gene expression in 2% ethidium bromide agarose gel electrophoresis. B. Levels of mRNA, measured by quantitative PCR and normalized to β-act. Error bars indicate ±SEM. Student’s t test; p<0.05. C. Whole-mount in situ hybridization, lateral view. DC, diencephalon; hy, hypothalamus; HB, hindbrain; Tel, telencephalon; TeO, optic tectum. Supplemental table 1 Primer’s sequences, GeneBank accession number and amplicon size for the investigated genes in conventional RT-PCR; primers indicated by asterisks were also used in preparing the probes for In Situ Hybridization DNA (template preparation using PCR amplification). Supplemental table 2. qPCR efficiencies for all genes, slope of the curves, intercept and the correlation coefficient were estimated using the equation E=10[-1/slope] (qCalculator software) using the CT values obtained by the standards serial dilutions assayed in triplicate (4 fold serial dilution). CT: cycle threshold; β-act: beta-actin; BDNF: brain derived neurotrophic factor; PYYa: peptide YYa; Gabra1: gamma-aminobutyric acid A receptor, alpha 1; GAD1: glutamate decarboxylase 1; Calb2: calbindin 2; Pvalb5: parvalbumin isoform 2a; GLRA4b: glycine receptor alphaZ4 subunit. Supplemental table 3. List of up-regulated genes grouped upon their general biological process. *These data were extracted after statistical analysis of microarrays for detection of differentially expressed genes and then from gene ontology analysis for clustering genes by function. GenBank ID, fold changes and P-values are listed. List of down-regulated genes grouped upon their general biological process. *These data were extracted after statistical analysis of microarrays for detection of differentially expressed genes and then from gene ontology analysis for clustering genes by function. GenBank ID, fold changes and P-values are listed. Supplemental video 1. Spontaneous Stage III seizure behaviour recorded in a mind bomb mutant bathing in normal embryo media. Supplemental Table 1 Primers used for amplification, cloning and sequencing Gene name Gene symbol GeneBank Primer sequences Size (bp) beta actin β-act AF057040 F, 5' GGACTCTGGTGATGGTGTGA 3' 569 R, 5' CACCGATCCAGACGGAGTAT 3' F, 5' GCTACAGCTTCACCACCACA 3' 596 R, 5' GGTTGGTCGTTCGTTTGAAT 3' ' ' 18S ribosomal 18S AF021880 F, 5 CGAAAGCATTTGCCAAGAAT 3 467 R, 5' AACGCCACTTGTCCCTCTAA 3' F, 5' TGACTCAACACGGGAAACCT 3' 450 R, 5' TGTACAAAGGGCAGGGACTT 3' elongation factor 1 alpha subunit EF1α NM_131263 F, 5' GCGTGGTATCACCATTGACA 3' 443 R, 5' TCTTCCATCCCTTGAACCAG 3' F, 5' CTGATTGTTGCTGGTGGTGT 3' 548 R, 5' TGGTGCATCTCAACAGACTTG 3' β beta-2-microglobulin 2M BC062841 F, 5' TATGTCGGACACCAAGCAGA 3' 449 R, 5' TCCACACCAAGAACAGGAACT 3' F, 5' CTGGCAGTTTCACCTCACAA 3' 625 R, 5' GAACAGCCAACAAGTGCAGA 3' brain-derived neurotrophic factor bdnf NM_131595 F, 5' TCCTGCTGAATGGTCTCCTT 3' * 577 R, 5' GCTGTCACCCACTGGCTAAT 3' * F, 5' AGGAGTTGCTTGAGGTGGAA 3' 473 R, 5' CCGGCATTGCGAGTTATAGT 3' peptide YYa pyy NM_131016 F, 5' GTCATGCTGAAACCTTGGAC 3' 263 R, 5' CTTGATCTCTGTTTGTGCTCTG 3' BC162428 F, 5' TGTGTCTCGGGACATTTGTG 3' * 329 R, 5' CGGCGACTGGTTCTCATATAGT 3' * calbindin 2 calb2 BC059467 F, 5' TGCTGAAGAAAGCCAACAGA 3' * 483 R, 5' ATGCACACATCGAGAATCCA 3' * F, 5' AGCCTGTCCAGCTCAAAGAA 3' 585 R, 5' CAGTGTTGGCAAATCAGAACA 3' gamma-aminobutyric acid (GABA) gabra1 BC124697 F, 5' TGAGCAGAAGGACAACACCA 3' 502 A receptor, alpha 1 R, 5' TCGAGTCCAAACGTACACCA 3' F, 5' GAAGACTTCCCAATGGATGC 3' * 452 R, 5' TAACAGACGGCAATGAACCA 3' * glutamate decarboxylase 1 gad1 BC047851 F, 5' CAGCACCTTTGTGAGGTGAA 3' * 557 R, 5' CCAGCATCCTGAGGACATTT 3' * F, 5' AGGCCCTTAACTCTGTGCAA 3' 594 R, 5' GACGACCAACCAACAGAACA 3' glial fibrillary acidic protein gfap AF506734 F, 5' GGTCCATGAGGAGGAGATGA 3' 507 R, 5' TCCAGCAGCTTCCTGTAGGT 3' F, 5' AAGCAGGAGGCCAATGACTA 3' 400 R, 5' TTCGCACAACTATGCTCCTC 3' glycine receptor alphaZ4 subunit glra4b AJ308517 F, 5' GCCATTGACATCTGGATGG 3' 472 R, 5' CGTTGAATACGAGGAAGCTG 3' F, 5' CAGTTGGCCTCACAGAATCA 3' * 407 R, 5 TGTTGCACCGCTTCATAGAC 3' * parvalbumin isoform 2a pvalb5 AF467915 F, 5' AAGAACAGCCTCTGCATCGT 3' * 423 R, 5' CCTCGTTCTCATTTCAGCAAG 3' * F, 5' GGAATCCTGAAGCAAGACGA 3' 548 R, 5' AGAAGCCCTTCACTTGGAGA 3' chemokine ligand 12 cxcl AY577011 F, 5' CAGTGCGGATCTCTTCTTCA 3' 422 R, 5' TTAAGTGCTGGGTCAGCAAG 3' F, 5' ACCTGAAGAACGCCATCAAC 3' 479 R, 5' TCGTAGAACCGTCAATGCTG 3' early growth response 1 egr1 NM_131248 F, 5' TCCTCTTCCACGTCTTCCAT 3' 466 R, 5' TTGGCCGGTTAGGATACTTG 3' F, 5' CCAGATCAGAAACCCATCCA 3' 441 R, 5' CCGCATGTGGATCTTAGTGT 3' proteasome 26S subunit, psmd13 AY398402 F, 5' CCGAATACAGCCATCACCTT 3' 586 non-ATPase, 13 R, 5' GCCGAGTGAAAGTCATCTCC 3' F, 5' TTAGGTCTGGCTGGTCTGCT 3' 495 R, 5' TGCCATGTTCTTCACGTCTC 3' * primers used in preparing the probes (template preparation using PCR amplification) Supplemental Table 2 Up-Regulated genes Biological Process Unigene Name Genbank ID Development Homeobox protein DBX1-A NM_131158 Brain-derived neurotrophic factor NM_131595 Zinc finger protein 703 AY026937 Tissue inhibitor of metalloproteinase 2b BQ131818 Fibronectin 1b BI707688 Connective tissue growth factor BE693178 Plexin D1 BI878456 Desmin NM_130963 Selenoprotein N, 1 AY221262 Chemokine (C-X-C motif) ligand 12a BM184127 Transport Endoplasmic oxidoreductin-1-like protein BC053166 Solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 BM777179 Npc1 protein BI705721 Immune response & Similar to complement C4-2 BI672168 Response to a stimulus Complement factor B NM_131338 Complement component 6 BI884211 Similar to complement C3-S AI477673 Heat shock protein, alpha-crystallin-related, 1 BI890996 Signal trasduction WD repeat domain 69 BM317335 Chordin NM_130973 Peptide YYa NM_131016 Neuropeptide FF-amide peptide precursor like AY092774 Vessel-specific 1 BM777868 Angiopoietin-like 7 BE202096 Membrane protein, palmitoylated 1 BI885282 DeltaC BG883428 Ral guanine nucleotide dissociation stimulator-like 1 BI890252 Membrane-spanning 4-domains, subfamily A, member 4 AW078034 Ras-related associated with diabetes AW116003 Si:rp71-39b20.7 BI879803 Tumor necrosis factor receptor superfamily, member 1a CA787635 Urotensin 2, alpha AY305004 Urotensin 1 BG306472 EH-domain containing 2 CD605644 Suppressor of cytokine signaling 3b CD283300 Novel protein similar to vertebrate muscle derived protein (MDP77) AI397396 zgc:112145-similar human cAMP-dependent protein kinase, regulatory subunit alpha 1 BM005429 Prepro-urotensin II-related peptide BM532745 Transcription Similar to CCAAT displacement protein (CDP) BI867269 NK3 homeobox 2 NM_178132 Neurogenin 3 NM_131815 No tail a NM_131162 Early growth response 1 NM_131248 V-jun sarcoma virus 17 oncogene homolog (avian) BE605692 Interferon regulatory factor 9 BM095893 Novel protein similar to vertebrate B-cell CLL/lymphoma 6, member B BM183969 Cellular metabolic process Tripartite motif-containing 55b BM531770 Transglutaminase 2b AF242545 V-akt murine thymoma viral oncogene homolog 2 AY056465 Cathepsin L1, a AW154342 Cathepsin B, a BG985497 Cathepsin C BM181679 si:ch211-235e18.3 BI892316 Tuberoinfundibular peptide of 39 amino acids AF486190 Argininosuccinate synthetase 1 AI957843 Cytochrome P450 CYP1C1 BG728978 Glutamic pyruvate transaminase (alanine aminotransferase) 2 BG883222 NK lysin-like protein AY184216 Other cellular process Clusterin AW077466 CASP8 and FADD-like apoptosis regulator AF448261 Novel protein similar to claudin 11 BI672093 Insulin-like growth factor binding protein 1 NM_173283 Cysteine rich protein 61 BI430409 Prickle-like 1 (Drosophila) a AY278986 Keratin-like BI846469 Down-Regulated genes Biological Process Unigene Name Genbank ID Development FEZ family zinc finger 2 NM_131636 Proteolipid

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    17 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us