ANTICANCER RESEARCH 35: 2635-2644 (2015) Epithelial-mesenchymal Transition (EMT) Markers in Human Pituitary Adenomas Indicate a Clinical Course WANG JIA1,2,3 , JINKUI ZHU1,4, TRACEY A. MARTIN2,3,6, AIHUA JIANG5, ANDREW J. SANDERS2,3,6 and WEN G. JIANG2,3,6 1Department of Neurosurgery, Beijing TianTan Hospital, Capital Medical University, Beijing, P.R. China; 2Cancer and 3Brain Institutes, Capital Medical University-Cardiff University Joint Centre for Biomedical Research, Capital Medical University, Beijing, P.R. China; 4Department of Neurosurgery, Zhaoyuan City Hospital, YanTai, Shandong, P.R. China; 5Department of Anaesthesia, YuHuangDing Hospital, YanTai, P.R. China; 6CCMRC Cardiff University-Capital Medical University Joint Centre for Biomedical Research, Cardiff University School of Medicine, Heath Park, Cardiff, U.K. Abstract. Background/Aim: Pituitary adenomas are brain progression, bone destruction and endocrine functions. These tumors with invasive properties. Epithelial-mesenchymal- markers are valuable biomarkers in assessing the clinical transition (EMT) is a cellular process linked to the course of pituitary adenomas. transformation to an aggressive cancer phenotype. In the present study, we investigated the expression of a panel of Pituitary adenoma is a common benign tumor of the central EMT markers, namely E-cadherin, N-cadherin, SLUG, SNA1 nervous system with a number of biological behaviours and TWIST in a cohort of human pituitary adenomas. similar to malignant tumors, including invasion of the Materials and Methods: Fresh-frozen human pituitary tumors surrounding structures, such as the cavernous sinus, (n=95) were collected immediately after surgery for hypothalamus and sphenoid sinus, where it is named invasive histology. Gene transcripts of the EMT markers were adenoma (1). Most invasive pituitary adenomas are quantified using quantitative-polymerase chain reaction characterized by rapid growth, large size, poor treatment (PCR) analysis. Levels of expression were analyzed against efficacy and a high recurrence rate. However, some small clinical, pathological, invasion and endocrine functions. tumors show obvious invasive behaviour and apoplexy early Results: Levels of E-cadherin and N-cadherin had a negative on during the disease. Although there exists little consensus and positive correlation with the appearance of intratumoral about what constitutes an invasive pituitary adenoma, the cystic lesions of pituitary tumors. E-cadherin and TWIST utility of biomarkers is rapidly evolving. Potential markers were associated with tumor size and staging. There was a of pituitary adenoma invasiveness that have been studied significant link between SLUG/TWIST and the destruction of include oncogenes, such as pituitary tumour transforming the sella fosa bones (p<0.030). EMT markers also showed gene (PTTG); proliferation-related factors, such as Ki-67, links with the endocrine functions of pituitary tumors. In proliferation cell nuclear antigen (PCNA) and P53 and pituitary tumors, SLUG and SNA1 had significant correlation angiogenic factors, such as vascular endothelial growth with N-cadherin. Conclusion: EMT markers are significant factor (VEGF) (2, 3). indicators of the appearance of cystic lesions, tumor The events that convert adherent epithelial cells into individual migratory cells, capable of invading the extracellular matrix, have been collectively referred to as the Correspondence to: Dr Wang Jia, Department of Neurosurgery, epithelial-mesenchymal transition (EMT). At a biomedical Beijing Tiantan Hospital, Capital Medical University, Beijing, P.R and molecular level, EMT is characterized by such changes China. E-mail: [email protected]; or Professor Wen G. Jiang, as the cadherin switch, loss of cytokeratin, increased CCMRC Cardiff University-Capital Medical University Joint Centre expression of vimentin and collagen, spindle-like morphology for Biomedical Research, Cardiff University School of Medicine, and gain of migration (4). EMT involves a sequence of Henry Wellcome Building, Heath Park, Cardiff CF14 4XN, U.K. Tel: +44 2920687065, e-mail: [email protected] changes in gene expression patterns during which epithelial cells dissipate their epithelial features and acquire Key Words: Pituitary adenoma, EMT, N-cadherin, E-cadherin, characteristics typical of mesenchymal cells. EMT has been SLUG, SNA1, TWIST. shown to play an important role during tumor progression 0250-7005/2015 $2.00+.40 2635 ANTICANCER RESEARCH 35: 2635-2644 (2015) Table I. Clinical and pathological information of patients. allowing for physical detachment of cancer cells from the primary tumour. Thus, EMT is characterized by the Group n combined loss of epithelial cell junction proteins, including Sex Male 51 E-cadherin, α-catenin, claudins, occludin and ZO-1, an Female 44 increased expression of mesenchymal markers, such as N- Age <45years 45 cadherin, vimentin and fibronectin, as well as re-organization >45years 50 of the cytoskeleton, which collectively results in the loss of Tumour size T<1cm 2 apical-basal cell polarity and the attainment of a spindle- T1-2cm 17 T2-3cm 34 shaped morphology (7, 8). T>3cm 42 Loss of expression of the cell-to-cell adhesion molecule Intratumoral haemorrhage No 77 E-cadherin is a characteristic trait of EMT in the Yes 18 development and in progression of epithelial tumors to Suprasella invasion No 59 invasive, metastatic cancers. The loss of E-cadherin is Yes 36 Invasion No 68 generally seen to coincide with a gain of expression of the Yes 27 mesenchymal cadherin, N-cadherin in many cancer types; Knosp grade 0-2 70 this “cadherin switch” is thought to be necessary for tumor 3-4 25 cells to gain invasive properties and is also a characteristic Endocrine tumor No 59 of EMT (9). PRL 5 GH 8 It is evident from recent studies that EMT-inducing signals FSH 2 are, in part, initiated by growth factors, including hepatocyte ACTH 6 growth factor (HGF), epidermal growth factor (EGF) and TSH 4 transforming growth factor-β (TGFβ). These induce LH 2 downstream activation of a number of EMT-inducing Mixture 9 transcription factors including SNAIL, SLUG, TWIST and ACTH: Adrenocorticotropic hormone; FSH: follicle stimulating zinc finger E-box binding homeobox 1 (ZEB1) (10). hormone; GH: growth hormone; LH: luteinizing hormone; PRL: The prsent study aimed to elucidate the expression prolactin; TSH: thyroid stimulating hormone. levels of a set of known EMT markers in human pituitary tumors and to determine whether these levels are related to clinical outcome. where the cells acquire mesenchymal cell properties in order Materials and Methods to gain enhanced motile and adhesive capacities allowing them to spread and metastasize (5). Mesenchymal-like cancer Clinical and pathological demographics of patients. Patients’ clinical cells are associated with an aggressive phenotype (6). The key history, diagnostic images and endocrine tests were routinely changes during EMT include loss of E-cadherin expression recorded. This study included a total of 95 patients with pituitary and increases in N-cadherin, SNAI1, SLUG (SNAI2), adenomas who underwent trans-sphenoidal or craniotomy surgical TWIST, vimentin, fibronectin and, accordingly, many of these resection between January 2012 and December 2012 at the Department of Neurosurgery of Beijing TianTan Hospital. Age, molecules have been shown to be deregulated in cancer (5). gender and hormonal functioning were also reviewed. The diagnosis Epithelial cells present a highly polarized morphology, was confirmed by postoperative pathology. Immunohistochemistry intimately linked by cell-cell junctions. Loss of these was used to determine the endocrine type. Preoperative magnetic intercellular connections provides a critical step during EMT resonance imaging (MRI) was performed to determine image Table II. Primers used in the study. Forward (5'-3') Reverse (5'-3') E-cadherin (CDH1) CAGAAAGTTTTCCACCAAAG ACTGAACCTGACCGTACAAAATGTGAGCAATTCTGCTT N-cadherin (CDH2) ATTCTCAACCCCATCT ACTGAACCTGACCGTACATTCTCCACTTGATTTCCATT SLUG (SNAI2) CTCCAAAAAGCCAAACTACA ACTGAACCTGACCGTACAGAGGATCTCTGGTTGTGGTA SNA1 TCTTTCCTCGTCAGGAAGC ACTGAACCTGACCGTACACTGCTGGAAGGTAAACTCTG TWIST AAGCTGAGCAAGATTCAGAC ACTGAACCTGACCGTACAGAGGACCTGGTAGAGGAAGT Actin (ACTB) GGACCTGACTGACTACCTCA ACTGAACCTGACCGTACAAGCTTCTCCTTAATGTCACG GAPDH CTGAGTACGTCGTGGAGTC ACTGAACCTGACCGTACACAGAGATGATGACCCTTTTG 2636 Jia et al: EMT in Pituitary Adenomas Figure 1. EMT markers and the size of pituitary tumors. *Indicates the respective levels of transcript significantly different from small (<1 cm) tumors. characteristic: tumour size, cystic lesion, intratumoural haemorrhage Tissue processing and generation of genetic materials for genetic- and invasion type. The greatest diameter of tumour obtained on the based analyses. Frozen tumour tissues were frozen sectioned at 10 μm. gadolinium (Gd)-enhanced T1WI was measured as tumour size. Small number of sections were used for histological evaluation and Intratumoural haemorrhage and cystic lesion were defined by the rest were combined and, then, homogenised in an RNA extraction preoperative MRI and confirmed intraoperatively. The invasion type solution. Total RNA was extracted based on manufacturer's was determined based on the invasion site of the tumour and instructions and quantified using a spectrophotometer. Equal amounts included cavernous sinus invasion, sphenoid sinus invasion and of total RNA were used to generate complementary DNA, cDNA, suprasellar invasion. The criterion for suprasellar invasion was
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages9 Page
-
File Size-