DOCSLIB.ORG

Epithelial-Mesenchymal Transition (EMT) Markers in Human Pituitary Adenomas Indicate a Clinical Course

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Epithelial-Mesenchymal Transition (EMT) Markers in Human Pituitary Adenomas Indicate a Clinical Course ANTICANCER RESEARCH 35: 2635-2644 (2015) Epithelial-mesenchymal Transition (EMT) Markers in Human Pituitary Adenomas Indicate a Clinical Course WANG JIA1,2,3 , JINKUI ZHU1,4, TRACEY A. MARTIN2,3,6, AIHUA JIANG5, ANDREW J. SANDERS2,3,6 and WEN G. JIANG2,3,6 1Department of Neurosurgery, Beijing TianTan Hospital, Capital Medical University, Beijing, P.R. China; 2Cancer and 3Brain Institutes, Capital Medical University-Cardiff University Joint Centre for Biomedical Research, Capital Medical University, Beijing, P.R. China; 4Department of Neurosurgery, Zhaoyuan City Hospital, YanTai, Shandong, P.R. China; 5Department of Anaesthesia, YuHuangDing Hospital, YanTai, P.R. China; 6CCMRC Cardiff University-Capital Medical University Joint Centre for Biomedical Research, Cardiff University School of Medicine, Heath Park, Cardiff, U.K. Abstract. Background/Aim: Pituitary adenomas are brain progression, bone destruction and endocrine functions. These tumors with invasive properties. Epithelial-mesenchymal- markers are valuable biomarkers in assessing the clinical transition (EMT) is a cellular process linked to the course of pituitary adenomas. transformation to an aggressive cancer phenotype. In the present study, we investigated the expression of a panel of Pituitary adenoma is a common benign tumor of the central EMT markers, namely E-cadherin, N-cadherin, SLUG, SNA1 nervous system with a number of biological behaviours and TWIST in a cohort of human pituitary adenomas. similar to malignant tumors, including invasion of the Materials and Methods: Fresh-frozen human pituitary tumors surrounding structures, such as the cavernous sinus, (n=95) were collected immediately after surgery for hypothalamus and sphenoid sinus, where it is named invasive histology. Gene transcripts of the EMT markers were adenoma (1). Most invasive pituitary adenomas are quantified using quantitative-polymerase chain reaction characterized by rapid growth, large size, poor treatment (PCR) analysis. Levels of expression were analyzed against efficacy and a high recurrence rate. However, some small clinical, pathological, invasion and endocrine functions. tumors show obvious invasive behaviour and apoplexy early Results: Levels of E-cadherin and N-cadherin had a negative on during the disease. Although there exists little consensus and positive correlation with the appearance of intratumoral about what constitutes an invasive pituitary adenoma, the cystic lesions of pituitary tumors. E-cadherin and TWIST utility of biomarkers is rapidly evolving. Potential markers were associated with tumor size and staging. There was a of pituitary adenoma invasiveness that have been studied significant link between SLUG/TWIST and the destruction of include oncogenes, such as pituitary tumour transforming the sella fosa bones (p<0.030). EMT markers also showed gene (PTTG); proliferation-related factors, such as Ki-67, links with the endocrine functions of pituitary tumors. In proliferation cell nuclear antigen (PCNA) and P53 and pituitary tumors, SLUG and SNA1 had significant correlation angiogenic factors, such as vascular endothelial growth with N-cadherin. Conclusion: EMT markers are significant factor (VEGF) (2, 3). indicators of the appearance of cystic lesions, tumor The events that convert adherent epithelial cells into individual migratory cells, capable of invading the extracellular matrix, have been collectively referred to as the Correspondence to: Dr Wang Jia, Department of Neurosurgery, epithelial-mesenchymal transition (EMT). At a biomedical Beijing Tiantan Hospital, Capital Medical University, Beijing, P.R and molecular level, EMT is characterized by such changes China. E-mail: [email protected]; or Professor Wen G. Jiang, as the cadherin switch, loss of cytokeratin, increased CCMRC Cardiff University-Capital Medical University Joint Centre expression of vimentin and collagen, spindle-like morphology for Biomedical Research, Cardiff University School of Medicine, and gain of migration (4). EMT involves a sequence of Henry Wellcome Building, Heath Park, Cardiff CF14 4XN, U.K. Tel: +44 2920687065, e-mail: [email protected] changes in gene expression patterns during which epithelial cells dissipate their epithelial features and acquire Key Words: Pituitary adenoma, EMT, N-cadherin, E-cadherin, characteristics typical of mesenchymal cells. EMT has been SLUG, SNA1, TWIST. shown to play an important role during tumor progression 0250-7005/2015 $2.00+.40 2635 ANTICANCER RESEARCH 35: 2635-2644 (2015) Table I. Clinical and pathological information of patients. allowing for physical detachment of cancer cells from the primary tumour. Thus, EMT is characterized by the Group n combined loss of epithelial cell junction proteins, including Sex Male 51 E-cadherin, α-catenin, claudins, occludin and ZO-1, an Female 44 increased expression of mesenchymal markers, such as N- Age <45years 45 cadherin, vimentin and fibronectin, as well as re-organization >45years 50 of the cytoskeleton, which collectively results in the loss of Tumour size T<1cm 2 apical-basal cell polarity and the attainment of a spindle- T1-2cm 17 T2-3cm 34 shaped morphology (7, 8). T>3cm 42 Loss of expression of the cell-to-cell adhesion molecule Intratumoral haemorrhage No 77 E-cadherin is a characteristic trait of EMT in the Yes 18 development and in progression of epithelial tumors to Suprasella invasion No 59 invasive, metastatic cancers. The loss of E-cadherin is Yes 36 Invasion No 68 generally seen to coincide with a gain of expression of the Yes 27 mesenchymal cadherin, N-cadherin in many cancer types; Knosp grade 0-2 70 this “cadherin switch” is thought to be necessary for tumor 3-4 25 cells to gain invasive properties and is also a characteristic Endocrine tumor No 59 of EMT (9). PRL 5 GH 8 It is evident from recent studies that EMT-inducing signals FSH 2 are, in part, initiated by growth factors, including hepatocyte ACTH 6 growth factor (HGF), epidermal growth factor (EGF) and TSH 4 transforming growth factor-β (TGFβ). These induce LH 2 downstream activation of a number of EMT-inducing Mixture 9 transcription factors including SNAIL, SLUG, TWIST and ACTH: Adrenocorticotropic hormone; FSH: follicle stimulating zinc finger E-box binding homeobox 1 (ZEB1) (10). hormone; GH: growth hormone; LH: luteinizing hormone; PRL: The prsent study aimed to elucidate the expression prolactin; TSH: thyroid stimulating hormone. levels of a set of known EMT markers in human pituitary tumors and to determine whether these levels are related to clinical outcome. where the cells acquire mesenchymal cell properties in order Materials and Methods to gain enhanced motile and adhesive capacities allowing them to spread and metastasize (5). Mesenchymal-like cancer Clinical and pathological demographics of patients. Patients’ clinical cells are associated with an aggressive phenotype (6). The key history, diagnostic images and endocrine tests were routinely changes during EMT include loss of E-cadherin expression recorded. This study included a total of 95 patients with pituitary and increases in N-cadherin, SNAI1, SLUG (SNAI2), adenomas who underwent trans-sphenoidal or craniotomy surgical TWIST, vimentin, fibronectin and, accordingly, many of these resection between January 2012 and December 2012 at the Department of Neurosurgery of Beijing TianTan Hospital. Age, molecules have been shown to be deregulated in cancer (5). gender and hormonal functioning were also reviewed. The diagnosis Epithelial cells present a highly polarized morphology, was confirmed by postoperative pathology. Immunohistochemistry intimately linked by cell-cell junctions. Loss of these was used to determine the endocrine type. Preoperative magnetic intercellular connections provides a critical step during EMT resonance imaging (MRI) was performed to determine image Table II. Primers used in the study. Forward (5'-3') Reverse (5'-3') E-cadherin (CDH1) CAGAAAGTTTTCCACCAAAG ACTGAACCTGACCGTACAAAATGTGAGCAATTCTGCTT N-cadherin (CDH2) ATTCTCAACCCCATCT ACTGAACCTGACCGTACATTCTCCACTTGATTTCCATT SLUG (SNAI2) CTCCAAAAAGCCAAACTACA ACTGAACCTGACCGTACAGAGGATCTCTGGTTGTGGTA SNA1 TCTTTCCTCGTCAGGAAGC ACTGAACCTGACCGTACACTGCTGGAAGGTAAACTCTG TWIST AAGCTGAGCAAGATTCAGAC ACTGAACCTGACCGTACAGAGGACCTGGTAGAGGAAGT Actin (ACTB) GGACCTGACTGACTACCTCA ACTGAACCTGACCGTACAAGCTTCTCCTTAATGTCACG GAPDH CTGAGTACGTCGTGGAGTC ACTGAACCTGACCGTACACAGAGATGATGACCCTTTTG 2636 Jia et al: EMT in Pituitary Adenomas Figure 1. EMT markers and the size of pituitary tumors. *Indicates the respective levels of transcript significantly different from small (<1 cm) tumors. characteristic: tumour size, cystic lesion, intratumoural haemorrhage Tissue processing and generation of genetic materials for genetic- and invasion type. The greatest diameter of tumour obtained on the based analyses. Frozen tumour tissues were frozen sectioned at 10 μm. gadolinium (Gd)-enhanced T1WI was measured as tumour size. Small number of sections were used for histological evaluation and Intratumoural haemorrhage and cystic lesion were defined by the rest were combined and, then, homogenised in an RNA extraction preoperative MRI and confirmed intraoperatively. The invasion type solution. Total RNA was extracted based on manufacturer's was determined based on the invasion site of the tumour and instructions and quantified using a spectrophotometer. Equal amounts included cavernous sinus invasion, sphenoid sinus invasion and of total RNA were used to generate complementary DNA, cDNA, suprasellar invasion. The criterion for suprasellar invasion was
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Comprehensive Molecular Characterization of Gastric Adenocarcinoma
    Comprehensive molecular characterization of gastric adenocarcinoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Bass, A. J., V. Thorsson, I. Shmulevich, S. M. Reynolds, M. Miller, B. Bernard, T. Hinoue, et al. 2014. “Comprehensive molecular characterization of gastric adenocarcinoma.” Nature 513 (7517): 202-209. doi:10.1038/nature13480. http://dx.doi.org/10.1038/ nature13480. Published Version doi:10.1038/nature13480 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:12987344 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2014 September 22. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2014 September 11; 513(7517): 202–209. doi:10.1038/nature13480. Comprehensive molecular characterization of gastric adenocarcinoma A full list of authors and affiliations appears at the end of the article. Abstract Gastric cancer is a leading cause of cancer deaths, but analysis of its molecular and clinical characteristics has been complicated by histological and aetiological heterogeneity. Here we describe a comprehensive molecular evaluation of 295 primary gastric adenocarcinomas as part of The Cancer
    [Show full text]
  • HER2 Positive and HER2 Negative Classical Type Invasive Lobular Carcinomas: Comparison of Clinicopathologic Features
    Article HER2 Positive and HER2 Negative Classical Type Invasive Lobular Carcinomas: Comparison of Clinicopathologic Features Lin He 1, Ellen Araj 1 and Yan Peng 1,2,* 1 Department of Pathology, University of Texas Southwestern Medical Center, 6201 Harry Hines Blvd, Dallas, TX 75235, USA; [email protected] (L.H.); [email protected] (E.A.) 2 Harold C. Simmons Cancer Center, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75235, USA * Correspondence: [email protected] Abstract: Human epidermal growth factor receptor 2 (HER2) positive (+) classical type invasive lobular carcinoma (cILC) of the breast is extremely rare and its clinicopathologic features have not been well characterized. We compared features of HER2(+) and HER2 negative (−) cILCs. A total of 29 cases were identified from the clinical database at our institution from 2011-2019; 9 were HER2(+) cILC tumors and 20 were HER2(−) cILC tumors. The results reveal that HER2(+) cILC group had significantly increased Ki-67 expression and reduced estrogen receptor (ER) expression compared to HER2(−) cILC group (both p < 0.05). In addition, HER2(+) cILCs tended to be diagnosed at a younger age and more common in the left breast, and appeared to have a higher frequency of nodal or distant metastases. These clinicopathologic features suggest HER2(+) cILC tumors may have more aggressive behavior than their HER2(−) counterpart although both groups of tumors showed similar morphologic features. Future directions of the study: (1) To conduct a multi-institutional study with a larger case series of HER2(+) cILC to further characterize its clinicopathologic features; (2) to compare molecular profiles by next generation sequencing (NGS) assay between HER2(+) cILC and HER2(−) cILC cases to better understand tumor biology of this rare subset of HER2(+) breast cancer; Citation: He, L.; Araj, E.; Peng, Y.
    [Show full text]
  • MARKER PANEL Figure 1
    Epithelial to Mesenchymal Transition MARKER PANEL Figure 1. E-cadherin (A-F) and N-cadherin (G-L) expression profiles in normal human tissues shown by IHC with the Anti-CDH1 antibody AMAb90863 and the Anti-CDH2 antibody AMAb91220. Note the differential expression of two cadherins in colon (A, J), duodenum (B, K), cervix (C, L), cerebellum (D, G), heart (E, H) and testis (F, I). Inset on J shows CDH2- immunoreactivity in the peripheral ganglion neurons in rectum. A A B B Figure 2. Western blot using Anti-CDH1 antibody AMAb90863 (A) and Anti-CDH2 antibody AMAb91220 (B). Blot A: Lane 1: Marker [kDa], Lane 2: Human cell line MCF-7 (posi- tive), Lane 3: Human cell line SK-BR-3 (negative), Lane 4: Human cell line HeLa (nega- Figure 3. E-cadherin – beta-catenin protein-protein interactions tive). Blot B: Lane 1: Marker [kDa], Lane 2 Human U-251 MG (positive). shown by in situ proximity ligation assay (PLA) in the epi- thelium of normal fallopian tube (A). The Anti-CDH1 mouse Cover image: monoclonal antibody AMAb90865 and the Anti-CTNNB1 rabbit polyclonal antibody HPA029159 were used for the Multiplexed IHC-IF staining of human colorectal cancer section showing membranous PLA reaction. Tonsil was used as negative control ( ). E-cadherin immunoreactivity in tumor cells (AMAb90865, magenta) and laminin gamma 1 B positivity in basement membranes (AMAb91138, green). Page 2 (4) The Epithelial to Mesenchymal The antibodies targeting selected EMT On the contrary, N-cadherin (CDH2) ex- Transition Marker Panel marker proteins are: pression is high in e.g. the nervous sys- tem (G and inset on J), heart muscle (H) Epithelial and mesenchymal cells are fun- • IHC-validated in relevant normal and and testis (I), while glandular epithelium of damentally different and represent the two cancer human tissues gastrointestinal tract (J, K) and squamous main cell types in the body.
    [Show full text]
  • Human N-Cadherin / CD325 / CDH2 Protein (His & Fc Tag)
    Human N-Cadherin / CD325 / CDH2 Protein (His & Fc Tag) Catalog Number: 11039-H03H General Information SDS-PAGE: Gene Name Synonym: CD325; CDHN; CDw325; NCAD Protein Construction: A DNA sequence encoding the human CDH2 (NP_001783.2) (Met 1-Ala 724) was fused with the C-terminal polyhistidine-tagged Fc region of human IgG1 at the C-terminus. Source: Human Expression Host: HEK293 Cells QC Testing Purity: > 70 % as determined by SDS-PAGE Endotoxin: Protein Description < 1.0 EU per μg of the protein as determined by the LAL method Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in Stability: connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing ℃ Samples are stable for up to twelve months from date of receipt at -70 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 Asp 160 Predicted N terminal: (NCAD) has been shown to play an essential role in normal neuronal Molecular Mass: development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. The secreted recombinant human CDH2 is a disulfide-linked homodimeric In addition, N-Cadherin expression was upregulated in human HSC during protein. The reduced monomer comprises 813 amino acids and has a activation in culture, and function or expression blocking of N-Cadherin predicted molecular mass of 89.9 kDa. As a result of glycosylation, it promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20- migrates as an approximately 114 and 119 kDa band in SDS-PAGE under 100 kDa fragments.
    [Show full text]
  • The N-Cadherin Interactome in Primary Cardiomyocytes As Defined Using Quantitative Proximity Proteomics Yang Li1,*, Chelsea D
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs221606. doi:10.1242/jcs.221606 TOOLS AND RESOURCES The N-cadherin interactome in primary cardiomyocytes as defined using quantitative proximity proteomics Yang Li1,*, Chelsea D. Merkel1,*, Xuemei Zeng2, Jonathon A. Heier1, Pamela S. Cantrell2, Mai Sun2, Donna B. Stolz1, Simon C. Watkins1, Nathan A. Yates1,2,3 and Adam V. Kwiatkowski1,‡ ABSTRACT requires multiple adhesion, cytoskeletal and signaling proteins, The junctional complexes that couple cardiomyocytes must transmit and mutations in these proteins can cause cardiomyopathies (Ehler, the mechanical forces of contraction while maintaining adhesive 2018). However, the molecular composition of ICD junctional homeostasis. The adherens junction (AJ) connects the actomyosin complexes remains poorly defined. – networks of neighboring cardiomyocytes and is required for proper The core of the AJ is the cadherin catenin complex (Halbleib and heart function. Yet little is known about the molecular composition of the Nelson, 2006; Ratheesh and Yap, 2012). Classical cadherins are cardiomyocyte AJ or how it is organized to function under mechanical single-pass transmembrane proteins with an extracellular domain that load. Here, we define the architecture, dynamics and proteome of mediates calcium-dependent homotypic interactions. The adhesive the cardiomyocyte AJ. Mouse neonatal cardiomyocytes assemble properties of classical cadherins are driven by the recruitment of stable AJs along intercellular contacts with organizational and cytosolic catenin proteins to the cadherin tail, with p120-catenin β structural hallmarks similar to mature contacts. We combine (CTNND1) binding to the juxta-membrane domain and -catenin β quantitative mass spectrometry with proximity labeling to identify the (CTNNB1) binding to the distal part of the tail.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Flow Reagents Single Color Antibodies CD Chart
    CD CHART CD N° Alternative Name CD N° Alternative Name CD N° Alternative Name Beckman Coulter Clone Beckman Coulter Clone Beckman Coulter Clone T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells CD1a T6, R4, HTA1 Act p n n p n n S l CD99 MIC2 gene product, E2 p p p CD223 LAG-3 (Lymphocyte activation gene 3) Act n Act p n CD1b R1 Act p n n p n n S CD99R restricted CD99 p p CD224 GGT (γ-glutamyl transferase) p p p p p p CD1c R7, M241 Act S n n p n n S l CD100 SEMA4D (semaphorin 4D) p Low p p p n n CD225 Leu13, interferon induced transmembrane protein 1 (IFITM1). p p p p p CD1d R3 Act S n n Low n n S Intest CD101 V7, P126 Act n p n p n n p CD226 DNAM-1, PTA-1 Act n Act Act Act n p n CD1e R2 n n n n S CD102 ICAM-2 (intercellular adhesion molecule-2) p p n p Folli p CD227 MUC1, mucin 1, episialin, PUM, PEM, EMA, DF3, H23 Act p CD2 T11; Tp50; sheep red blood cell (SRBC) receptor; LFA-2 p S n p n n l CD103 HML-1 (human mucosal lymphocytes antigen 1), integrin aE chain S n n n n n n n l CD228 Melanotransferrin (MT), p97 p p CD3 T3, CD3 complex p n n n n n n n n n l CD104 integrin b4 chain; TSP-1180 n n n n n n n p p CD229 Ly9, T-lymphocyte surface antigen p p n p n
    [Show full text]
  • CD Markers Are Routinely Used for the Immunophenotyping of Cells
    ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr.
    [Show full text]
  • CDH1 Gene Cadherin 1
    CDH1 gene cadherin 1 Normal Function The CDH1 gene provides instructions for making a protein called epithelial cadherin or E-cadherin. This protein is found within the membrane that surrounds epithelial cells, which are the cells that line the surfaces and cavities of the body, such as the inside of the eyelids and mouth. E-cadherin belongs to a family of proteins called cadherins whose function is to help neighboring cells stick to one another (cell adhesion) to form organized tissues. Another protein called p120-catenin, produced from the CTNND1 gene, helps keep E-cadherin in its proper place in the cell membrane, preventing it from being taken into the cell through a process called endocytosis and broken down prematurely. E-cadherin is one of the best-understood cadherin proteins. In addition to its role in cell adhesion, E-cadherin is involved in transmitting chemical signals within cells, controlling cell maturation and movement, and regulating the activity of certain genes. Interactions between the E-cadherin and p120-catenin proteins, in particular, are thought to be important for normal development of the head and face (craniofacial development), including the eyelids and teeth. E-cadherin also acts as a tumor suppressor protein, which means it prevents cells from growing and dividing too rapidly or in an uncontrolled way. Health Conditions Related to Genetic Changes Breast cancer Inherited mutations in the CDH1 gene increase a woman's risk of developing a form of breast cancer that begins in the milk-producing glands (lobular breast cancer). In many cases, this increased risk occurs as part of an inherited cancer disorder called hereditary diffuse gastric cancer (HDGC) (described below).
    [Show full text]
  • And MUC1 in Mammary Epithelial Cells
    Linköping University Post Print Loss of ICAM-1 signaling induces psoriasin (S100A7) and MUC1 in mammary epithelial cells Stina Petersson, E. Shubbar, M. Yhr, A. Kovacs and Charlotta Enerbäck N.B.: When citing this work, cite the original article. The original publication is available at www.springerlink.com: Stina Petersson, E. Shubbar, M. Yhr, A. Kovacs and Charlotta Enerbäck, Loss of ICAM-1 signaling induces psoriasin (S100A7) and MUC1 in mammary epithelial cells, 2011, Breast Cancer Research and Treatment, (125), 1, 13-25. http://dx.doi.org/10.1007/s10549-010-0820-4 Copyright: Springer Science Business Media http://www.springerlink.com/ Postprint available at: Linköping University Electronic Press http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-63954 1 Loss of ICAM-1 signaling induces psoriasin (S100A7) and MUC1 in mammary epithelial cells Petersson S1, Shubbar E1, Yhr M1, Kovacs A2 and Enerbäck C3 Departments of 1Clinical Genetics and 2Pathology, Sahlgrenska University Hospital, SE-413 45 Gothenburg, Sweden; 3Department of Clinical and Experimental Medicine, Division of Cell Biology and Dermatology, Linköping University, SE-581 85 Linköping, Sweden E-mail: [email protected] E-mail: maria.yhr@ clingen.gu.se E-mail: [email protected] E-mail: [email protected] Correspondence: Stina Petersson, Department of Clinical Genetics, Sahlgrenska University Hospital, SE-413 45 Gothenburg, Sweden E-mail: [email protected] 2 Abstract Psoriasin (S100A7), a member of the S100 gene family, is highly expressed in high-grade comedo ductal carcinoma in situ (DCIS), with a higher risk of local recurrence. Psoriasin is therefore a potential biomarker for DCIS with a poor prognosis.
    [Show full text]
  • Cell Adhesion Molecules in Normal Skin and Melanoma
    biomolecules Review Cell Adhesion Molecules in Normal Skin and Melanoma Cian D’Arcy and Christina Kiel * Systems Biology Ireland & UCD Charles Institute of Dermatology, School of Medicine, University College Dublin, D04 V1W8 Dublin, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +353-1-716-6344 Abstract: Cell adhesion molecules (CAMs) of the cadherin, integrin, immunoglobulin, and selectin protein families are indispensable for the formation and maintenance of multicellular tissues, espe- cially epithelia. In the epidermis, they are involved in cell–cell contacts and in cellular interactions with the extracellular matrix (ECM), thereby contributing to the structural integrity and barrier for- mation of the skin. Bulk and single cell RNA sequencing data show that >170 CAMs are expressed in the healthy human skin, with high expression levels in melanocytes, keratinocytes, endothelial, and smooth muscle cells. Alterations in expression levels of CAMs are involved in melanoma propagation, interaction with the microenvironment, and metastasis. Recent mechanistic analyses together with protein and gene expression data provide a better picture of the role of CAMs in the context of skin physiology and melanoma. Here, we review progress in the field and discuss molecular mechanisms in light of gene expression profiles, including recent single cell RNA expression information. We highlight key adhesion molecules in melanoma, which can guide the identification of pathways and Citation: D’Arcy, C.; Kiel, C. Cell strategies for novel anti-melanoma therapies. Adhesion Molecules in Normal Skin and Melanoma. Biomolecules 2021, 11, Keywords: cadherins; GTEx consortium; Human Protein Atlas; integrins; melanocytes; single cell 1213. https://doi.org/10.3390/ RNA sequencing; selectins; tumour microenvironment biom11081213 Academic Editor: Sang-Han Lee 1.
    [Show full text]