Apro newCeedings species of of the le Ahfminingawaiian Cearposinantomologi Cal soCiety (2021) 53:11–19 11 First Confirmed Record of Leaf Mining in the Fruitworm Moths (Carposinidae): A New Species Feeding on an Endemic Hawaiian Clermontia (Campanulaceae) Camiel Doorenweerd, Kyhl A. Austin, and Daniel Rubinoff Entomology Section, Department of Plant and Environmental Protection Sciences, University of Hawaii, 310 Gilmore Hall, 3050 Maile Way, Honolulu, Hawaii, 96822-2231, USA. Corresponding author: [email protected] Abstract. We discovered an unknown insect mining the leaves of Clermontia fauriei (Campanulaceae) in the Alakai Swamp, Kauai. Although the leaf mines superficially resembled those of the Hawaiian endemic genusPhilodoria (Gracil- lariidae), or possibly Euperissus (Cosmopterigidae), rearing revealed an unde- scribed species of Carposina (Carposinidae). We describe it here as Carposina hahaiella sp. n., and include detailed information on the morphology, leaf mines, cytochrome c oxidase I sequences, and a parasitoid of the new species. Carposina hahaiella represents the first confirmed record of leaf mining in the fruitworm moth family, adding to a remarkable variety of larval habits in Carposinidae. Key words: taxonomy, plant-insect, Kauai, diversification, endangered Introduction mon name implies, but some larvae feed on terminal buds, some are stem borers, “I regret most deeply that I have others are gall formers, and still others not been given the opportunity feed externally on foliage. Larval hosts to study this genus with the care include at least 15 different plant families which it deserves.” in Hawaii alone (Zimmerman 1978). —Elwood C. Zimmerman on Whether or not leaf mining, where Carposina, 1978. larva feed internally in a leaf, occurs in Carposinidae has been a point of conten- The family Carposinidae, commonly tion. There are two historical records known as fruitworm moths, comprises of leafmining carposinids, both from nearly 300 described species found in all Hawaii. One was misidentified asHetero - major biogeographical regions, but the crossa (=Carposina) crinifera (Walsing- family is most diverse in the Indo-Pacific ham) by Swezey (1913) and subsequently region (van Nieukerken et al. 2011, Dug- lost (Zimmerman 1978). The larvae were dale et al. 1999, Zimmerman 1978). The reported to mine the leaves of Cyanea 41 described and 11 undescribed Hawai- humboldtiana (Gaudich.) Lammers, ian species are all assigned to the genus Givnish & Sytsma (Campanulaceae) on Carposina, and most are endemic to one Mt. Olympus, Oahu. Swezey (1954) stated or a few islands (Medeiros et al. 2016, that his original identification was “based Zimmerman 1978). The group is especially on an error in determination.” Zimmer- remarkable for its diversity of larval habits; man (1978) referred to this leafmining many feed in berries or fruits as their com- species as “Carposina new species 3.” A 12 DoorenweerD et Al. second undescribed species was reared Dissection, DNA extraction, and se- from leaf mines on Clermontia kakeana quencing. We used a non-destructive DNA and C. arborescens from Haelaau, Maui extraction method on one larva and both (Swezey 1954). We were unable to locate emerged adults, to maximize the retention these specimens which Zimmerman of morphological characters. The ethanol- (1978) referred to as “Carposina new preserved larva was prepared for lysis by species 6.” Several papers (e.g., Meyrick using a sharpened #2 pin to make small 1922, Davis 1969, Connor and Taverner perforations near the head and segment 1997, Ponomarenko 1999) suggest that A10, and a cut along middle segments. We Carposinidae are known to be leaf miners, removed the abdomens of the adults by presumably referring to Swezey (1913) gently tilting them upwards. We then used or Swezey (1954). However, these two a Qiagen DNeasy blood and tissue spin- records are unverified and incomplete, column kit (Qiagen, Inc., Valencia, CA) even though it has been repeated multiple to extract DNA following manufacturer’s times in the literature. Despite the close protocols. The abdomens and larval pelt proximity of Mt. Olympus to the Univer- were removed from the lysis buffer after sity of Hawaii at Manoa campus, the leaf incubation using a minutien and mounted miner reported by Swezey (1913) has never on a microscopic glass slide, using standard again been seen, possibly a victim of the procedures for small Lepidoptera (Robin- severe impacts of invasive species on Ha- son 1976). Phenosafranin-O was used to waii’s native insect fauna (Medeiros et al. stain the male genitalia and pelt, and Eosin 2017). The same may be true for the Maui Y and chlorazol-black to stain the female species. We here describe a new species genitalia before slide-mounting in euparal. of Carposina from the Alakai Swamp on Photographs of the slides were taken using Kauai that was incidentally discovered a Zeiss Discovery v8 microscope mounted and represents the first confirmed record with a Sony alpha a6300 camera. Mor- of the leaf mining habit in Carposinidae. phological terminology for adult genitalia follows Klots (1956) except for “ostium,” Material and methods which we use instead of “ostium bursae.” Sampling. We collected Clermontia To establish a genetic reference we fauriei leaves with mines during fieldwork amplified a section of the cytochrome c along the Alakai Swamp Trail, Kauai, in July oxidase I gene with forward primer LCO 2020. We placed tenanted leaf mines in a 5’ GCTCAACAAATCATAAAGATATT- 32-oz rearing container and monitored them GG 3’ and reverse primer Pat2 5’ TC- daily. Larvae that exited the mine were re- CATTACATATAATCTGCCATATTAG luctant to pupate, often wandering for days. 3’ (Simon 1994). We used Q5 hot-start Some were moved to a smaller container high fidelity 2x DNA polymerase (New with several potential pupation substrates, England BioLabs, Ipswich, MA) with including tissue, moss, and soil. Three larvae the manufacturer’s recommended PCR were preserved in 95% ethanol in a –20° program and reagent mix. PCR products freezer; emerged adults were pinned and were visualized on a 1% agarose gel, spread. Vacated leaf mines were pressed and followed by purification with QIAquick dried. We used an Epson V600 Photo flatbed spin columns (Qiagen, Inc., Valencia, scanner to create transmitted light scans of CA) according to the manufacturer’s the dried leaf mines. All voucher material is protocol. For each sample, sense and deposited in the University of Hawaii Insect anti-sense strands of the PCR products Museum (UHIM). were sequenced via the Sanger method A new species of leAfmining Carposina 13 in two parts, outsourced to Eurofins larvae we collected, only two produced (KY, USA). The first part (COI-5P) was adult moths. sequenced with LCO and HCO 5’ TA- AACTTCAGGGTGACCAAAAAATCA Carposina hahaiella sp. nov. 3’ (Simon 1994). The second part (COI-3P) Holotype. Figs. 1–3. Female. Pinned, was sequenced with Jerry 5’ CAACATT- labelled: “United States: Hawaii: Kau- TATTTTGATTTTTTGG 3’ (Simon ai: Alakaʻi x Pihea trail. N 22.1494 E 1994) combined with Pat2. Sample data –159.6153. 21.vii.2020. Leaf mines on Cl- and COI sequences are available on the ermontia fauriei. e.l. 14.viii.2020. Leg. D., Barcoding of Life Datasystems (BOLD; R. Rubinoff and C. Doorenweerd. DNA Dataset DOI https://dx.doi.org/10.5883/ sample UHIM.DNA00096, genitalia slide DS-CAROHA) and in NCBI GenBank KAA #0390.” Deposited in the University under accessions MW698684–6. of Hawaii Insect Museum (UHIM). To better understand the identity and Paratype. One female, pinned, same potential novelty of the species we had data as holotype, except em: 13.viii.2020. reared, we aligned the COI-3P section of DNA sample UHIM.DNA00022. Depos- our specimens to published sequences of ited in UHIM. Hawaiian Carposina from Medeiros et Differential diagnosis. Carposina al. (2016), creating a 724 base pair align- hahaiella is among the smallest described ment. We used IQ-Tree v2.0.3 (Minh et species of Carposina in Hawaii. Only C. al. 2020) to infer a maximum likelihood pusilla (Walsingham), described from tree, with model selection through the Oahu, and C. pygmaeella (Walsingham), integrated ModelFinder, which used the described from Hawaii island, have a Bayesian information criterion to deter- shorter forewing length. Both of these mine TPM2+F+I+G4 as the best fit. We species are known only from males but performed 50 independent runs to find can be distinguished from C. hahaiella the optimal tree and support values for externally by the following: the forewing the branches were estimated with 5,000 of C. pusilla is yellowish white and the ultra-fast bootstrap replicates. While this forewing of C. pygmaeella is dark brown, approach is not appropriate for establish- whereas the forewing of C. hahaiella is ing phylogenetic relationships among chalky gray-blue. The small size of C. species (Rubinoff and Holland 2005), in hahaiella (female FWL 4.1–4.3 mm) combination with the morphology and and its chalky gray-blue forewing ground ecology it can provide insight into species color separate it from all other known identity (e.g., Rubinoff and Powell 2004). Carposina in Hawaii. Carposina hahai- ella may be superficially confused with Results C. gemmata (Walsingham) based on the Larvae typically exited the mine to wing patterning, color, and iridescence, pupate and wandered in the rearing con- but the latter has a horizontally oriented tainers. Although most larvae dug into the medial spot, which is vertically oriented provided soil, and disregarded the offered in C. hahaiella, and the former is signifi- paper tissue, moss, and detritus, we did not cantly larger with a wingspan of 22 mm. find any pupae after several weeks, so we The leaf-mining life history on Cler- assume the larvae died. We suspect they montia also separates C. hahaiella from may have sought specific environmental all other described Carposina in Hawaii conditions that we did not provide in the with known larval habits.