OR51A7 (NM 001004749) Human Untagged Clone – SC300787

OR51A7 (NM 001004749) Human Untagged Clone – SC300787

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC300787 OR51A7 (NM_001004749) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: OR51A7 (NM_001004749) Human Untagged Clone Tag: Tag Free Symbol: OR51A7 Synonyms: OR11-27 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001004749, the custom clone sequence may differ by one or more nucleotides ATGTCTGTTCTCAATAACTCCGAAGTCAAGCTTTTCCTTCTGATTGGGATCCCAGGACTGGAACATGCCC ACATTTGGTTCTCCATCCCCATTTGCCTCATGTACCTGCTTGCCATCATGGGCAACTGCACCATTCTCTT TATTATAAAGACAGAGCCCTCGCTTCATGAGCCCATGTATTATTTCCTTGCCATGTTGGCTGTCTCTGAC ATGGGCCTGTCCCTCTCCTCCCTTCCTACCATGTTGAGGGTCTTCTTGTTCAATGCCATGGGAATTTCAC CTAATGCCTGCTTTGCTCAAGAATTCTTCATTCATGGATTCACTGTCATGGAATCCTCAGTACTTCTAAT TATGTCTTTGGACCGCTTTCTTGCCATTCACAATCCCTTAAGATACAGTTCTATCCTCACTAGCAACAGG GTTGCTAAAATGGGACTTATTTTAGCCATTAGGAGCATTCTCTTAGTGATTCCATTTCCCTTCACCTTAA GGAGATTAAAATATTGTCAAAAGAATCTTCTTTCTCACTCATACTGTCTTCATCAGGATACCATGAAGCT GGCCTGCTCTGACAACAAGACCAATGTCATCTATGGCTTCTTCATTGCTCTCTGTACTATGCTGGACTTG GCACTGATTGTTTTGTCTTATGTGCTGATCTTGAAGACTATACTCAGCATTGCATCTTTGGCAGAGAGGC TTAAGGCCCTAAATACCTGTGTCTCCCACATCTGTGCTGTGCTCACCTTCTATGTGCCCATCATCACCCT GGCTGCCATGCATCACTTTGCCAAGCACAAAAGCCCTCTTGTTGTGATCCTTATTGCAGATATGTTCTTG TTGGTGCCGCCCCTTATGAACCCCATTGTGTACTGTGTAAAGACTCGACAAATCTGGGAGAAGATCTTGG GGAAGTTGCTTAATGTATGTGGGAGATAA Restriction Sites: SgfI-MluI ACCN: NM_001004749 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 OR51A7 (NM_001004749) Human Untagged Clone – SC300787 OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_001004749.1, NP_001004749.1 RefSeq Size: 939 bp RefSeq ORF: 939 bp Locus ID: 119687 UniProt ID: Q8NH64 Protein Families: Transmembrane Protein Pathways: Olfactory transduction Gene Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding- exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us