Supplemental Tables Supplemental Table I. Clinical Characteristic of Participants in this Study Characteristics Patients with CAD Healthy control P (n = 48) (n = 47) Age (mean ± SD) 60.35 ± 8.45 60.17 ± 7.64 0.534 Gender (male) 25 (52.08%) 24 (51.06%) 0.662 Hypertension 31 (64.58%) 16 (34.04%) 0.011 Diabetes 23 (47.92%) 7 (14.89%) 0.005 Smoking 26 (54.17%) 12 (25.53%) 0.035 Drinking 13 (27.08%) 6 (12.77%) 0.002 Hyperlipidemia 35 (72.82%) 16 (34.04%) 0.024 Systolic BP (mm Hg) 140.50 ± 16.58 130.60 ± 14.26 0.033 Diastolic BP (mm Hg) 77.42 ± 9.25 71.23 ± 6.39 0.046 FPG (mmol) 6.58 ± 1.32 5.45 ± 1.83 0.026 Triglycerides (mmol) 2.16 ± 0.66 1.52 ± 0.47 0.008 Total cholesterol (mmol) 4.54 ± 1.44 4.35 ± 1.35 0.705 HDL cholesterol (mmol) 1.26 ± 0.63 1.38 ± 0.48 0.004 LDL cholesterol (mmol) 3.23 ± 0.54 2.84 ± 0.86 0.018 SD indicates standard deviation; HDL, high-density lipoprotein cholesterol; and LDL, low-density lipoprotein cholesterol. Supplemental Table II. Primer Sequence Used in this Study Gene Forward Reverse MicroRNA-665 5′-GGTCTACAAAGGGAAGC-3′ 5′-TTTGGCACTAGCACATT-3′. U6 5′-CTCGCTTCGGCAGCACA-3′ 5′-AACGCTTCACGAATTTGCGT-3′ TGFBR1 5’- TCTGCATTGCACTTATGCTGA -3’ 5’- AAAGGGCGATCTAGTGATGGA -3’ GAPDH 5′-CACCCACTCCTCCACCTTTG-3′, 5′-CCACCACCCTGTTGCTGTAG-3′ Supplemental Tables Supplemental Table III. Functional Enrichment of Target Genes of miR-665 Category ID Term P value Genes BP GO:0043193 Positive regulation of gene-specific 0.000171 HIF1A, IKZF2, ETS1, RORB, NR2F2, PROX1, SRF, PPARGC1A transcription BP GO:0051272 Positive regulation of cell motion 0.000371 HIF1A, ERBB4, ETS1, PDPN, TGFBR1, PDGFRB, KIT, KDR BP GO:0032583 Regulation of gene-specific transcription 0.00266 HIF1A, IKZF2, ETS1, RORB, NR2F2, PROX1, SRF, PPARGC1A BP GO:0010628 Positive regulation of gene expression 0.00355 IKZF2, TGFBR1, TEAD1, RORB, KIT, NFYA, PRDM16, SRF, PPARGC1A, PROX1, STAT3, HIF1A, ETS1, POU2F1, NR2F2, CLOCK BP GO:0045893 Positive regulation of transcription, 0.0054 IKZF2, TEAD1, RORB, NFYA, PRDM16, SRF, PPARGC1A, PROX1, STAT3, DNA-dependent HIF1A, ETS1, POU2F1, NR2F2, CLOCK BP GO:0051254 Positive regulation of RNA metabolic process 0.00584 IKZF2, TEAD1, RORB, NFYA, PRDM16, SRF, PPARGC1A, PROX1, STAT3, HIF1A, ETS1, POU2F1, NR2F2, CLOCK BP GO:0045941 Positive regulation of transcription 0.00828 IKZF2, TGFBR1, TEAD1, RORB, NFYA, PRDM16, SRF, PPARGC1A, PROX1, STAT3, HIF1A, ETS1, POU2F1, NR2F2, CLOCK BP GO:0018108 Peptidyl-tyrosine phosphorylation 0.00891 ERBB4, PDGFRB, ABI2, KIT, ABL2 BP GO:0007507 Heart development 0.0095 ACVR2B, ACTC1, ERBB4, TGFBR1, TEAD1, SMYD1, NFATC4, PROX1, SRF BP GO:0018212 Peptidyl-tyrosine modification 0.0105 ERBB4, PDGFRB, ABI2, KIT, ABL2 BP GO:0010604 Positive regulation of macromolecule 0.0106 IKZF2, BTRC, TGFBR1, TEAD1, RORB, KIT, NFYA, PRDM16, SRF, metabolic process PPARGC1A, PROX1, STAT3, PSMF1, HIF1A, PSMD11, ETS1, POU2F1, NR2F2, CLOCK BP GO:0006468 Protein amino acid phosphorylation 0.0146 ERBB4, TAOK1, TGFBR1, PKN2, ABI2, KIT, KDR, ACVR2B, EPHA7, CAMK4, PAK3, PDGFRB, GRK5, ERC1, ABL2, AKT3 BP GO:0030335 Positive regulation of cell migration 0.0149 HIF1A, ERBB4, PDPN, PDGFRB, KIT, KDR BP GO:0001945 Lymph vessel development 0.0178 PDPN, NR2F2, PROX1 BP GO:0045935 Positive regulation of nucleobase, nucleoside, 0.0215 IKZF2, TGFBR1, TEAD1, RORB, NFYA, PRDM16, SRF, PPARGC1A, nucleotide, and nucleic acid metabolic PROX1, STAT3, HIF1A, ETS1, POU2F1, NR2F2, CLOCK process BP GO:0040017 Positive regulation of locomotion 0.0228 HIF1A, ERBB4, PDPN, PDGFRB, KIT, KDR BP GO:0051270 Regulation of cell motion 0.0228 HIF1A, ERBB4, ETS1, PDPN, TGFBR1, PDGFRB, KIT, KDR BP GO:0051173 Positive regulation of nitrogen compound 0.0287 IKZF2, TGFBR1, TEAD1, RORB, NFYA, PRDM16, SRF, PPARGC1A, metabolic process PROX1, STAT3, HIF1A, ETS1, POU2F1, NR2F2, CLOCK BP GO:0010557 Positive regulation of macromolecule 0.033 IKZF2, TGFBR1, TEAD1, RORB, NFYA, PRDM16, SRF, PPARGC1A, biosynthetic process PROX1, STAT3, HIF1A, ETS1, POU2F1, NR2F2, CLOCK BP GO:0060541 Respiratory system development 0.0348 ACVR2B, PDPN, TGFBR1, POU2F1, PROX1, KDR Supplemental Tables BP GO:0006796 Phosphate metabolic process 0.0424 ERBB4, TAOK1, TGFBR1, PKN2, ABI2, KIT, KDR, MTMR3, DUSP4, ACVR2B, EPHA7, CAMK4, PAK3, PDGFRB, GRK5, ERC1, ABL2, AKT3, PPP2R2A BP GO:0006793 Phosphorus metabolic process 0.0424 ERBB4, TAOK1, TGFBR1, PKN2, ABI2, KIT, KDR, MTMR3, DUSP4, ACVR2B, EPHA7, CAMK4, PAK3, PDGFRB, GRK5, ERC1, ABL2, AKT3, PPP2R2A BP GO:0042493 Response to drug 0.0426 ACTC1, YWHAZ, GNAO1, ERBB4, SNX27, SRR, GRK5, STAT3 BP GO:0007015 Actin filament organization 0.0466 ACTC1, DIAPH1, ABI2, PROX1, ABL2 BP GO:0031328 Positive regulation of cellular biosynthetic 0.0496 IKZF2, TGFBR1, TEAD1, RORB, NFYA, PRDM16, SRF, PPARGC1A, process PROX1, STAT3, HIF1A, ETS1, POU2F1, NR2F2, CLOCK CC GO:0044456 Synapse part 0.00106 RAB3B, EPHA7, YWHAZ, ERBB4, ITGA8, GRIK3, SYT2, LIN7C, SIAH1, ERC1, SV2C CC GO:0045202 Synapse 0.00505 RAB3B, EPHA7, YWHAZ, ERBB4, ITGA8, GRIK3, SYT2, LIN7C, SIAH1, ERC1, SV2C, RIMS4 CC GO:0044459 Plasma membrane part 0.0165 RAB3B, ERBB4, OSMR, AP1G1, DIAPH1, GRIK3, SYT2, CACNB2, ABI2, KIT, KCNJ2, RIMS4, PRR3, SLC23A2, SV2C, STX3, PDPN, CACNG8, TGFBR1, KCNB1, NTNG1, LIN7C, AJAP1, FZD5, M6PR, KDR, ACVR2B, EPHA7, SLC16A6, ITGA8, PDGFRB, LAMC2, DST, PARVA, GBP1 KEGG hsa04510 Focal adhesion 0.0252 PAK3, DIAPH1, ITGA8, PDGFRB, LAMC2, COL5A3, AKT3, PARVA, KDR KEGG hsa04010 MAPK signaling pathway 0.0415 DUSP4, TAOK1, CACNG8, TGFBR1, PDGFRB, CACNB2, NFATC4, STMN1, SRF, AKT3 MF GO:0004714 Transmembrane receptor protein tyrosine 0.0405 EPHA7, ERBB4, PDGFRB, KIT, KDR kinase activity MF GO:0004672 Protein kinase activity 0.0494 ERBB4, TAOK1, TGFBR1, PKN2, KIT, KDR, ACVR2B, EPHA7, CAMK4, PAK3, PDGFRB, GRK5, ABL2, AKT3 .