Am. J. Hum. Genet. 47:562-567, 1990 Hereditary Fructose Intolerance Caused by a Nonsense Mutation of the Aldolase B Gene Susumu Kajihara,*,t Tsunehiro Mukait Yuji AraiT Misao Owadat Teruo Kitagawa4 and Katsuji Hori* *Department of Biochemistry, Saga Medical School, Saga, Japan; tNational Cardiovascular Center Research Institute, Osaka; and tDepartment of Pediatrics, Nihon University, Tokyo Summary The nucleotide sequence of a patient's aldolase B gene was determined and showed a substitution of a sin- gle nucleotide (C-OA) at position 720 in the coding region, which resulted in the 240th amino acid, a cys- teine, being changed to a stop codon (TGC-"TGA). By an allele-specific oligonucleotide probe and poly- merase chain reaction, the patient was shown to be homozygous for the mutation. To examine whether this mutation causes functional defect of the enzyme, the activity of the aldolase B from the patient, ex- pressed in Escherichia coli by using expression plasmid, was measured. No activity was observed, and the predicted product was recovered from E. coli expression plasmid, indicating that this nonsense mutation was the cause of aldolase B deficiency. Introduction al. 1987). Another type of aldolase deficiency, heredi- Aldolase is a glycolytic enzyme involved in the conver- tary fructose intolerance (HFI), was discovered 30 years sion of fructose-bisphosphate into glyceraldehyde-3- ago as idiosyncrasy toward fructose (Chambers and phosphate and dihydroxyacetone-1-phosphate. There Pratt 1956). The mutation affects aldolase B ofthe liver, are three isozymic forms for the enzyme: aldolase A, intestine, and kidney and is transmitted as an autosomal aldolase B, and aldolase C (Horecker et al. 1972). The recessive disorder. It is characterized by nausea, vomit- structural genes for these isozymes have been cloned ing, and hypoglycemia following fructose ingestion in man (Sakakibara et al. 1985a, 1985b; Tolan and Pen- which rapidly evolves to cirrhosis (Gitzelmann et al. hoet 1986; Maire et al. 1987; Mukai et al. 1987; Rott- 1983). mann et al. 1987), as well as in the rat and the chicken Here we describe a molecular analysis of HFI in Ja- Burgess and Penhoet 1985; Joh et al. 1986; Kukita et pan. We found that a C-oA transversion occurred at al. These amino acid position 240 in exon 7. By using expres- 1988). isozymes are well regulated develop- sion plasmid in Escherichia coli, we proved that this mentally and tissue specifically at the transcriptional mutation affected the of the level. These findings now permit us to study the molec- directly function enzyme. ular basis of hereditary diseases caused by aldolase Cross et al. (1988, 1990) also described the analysis deficiency. of HFI at the nucleotide level. However, the mutation In inherited deficiency of aldolase in man there is sites differed from that given in our results. Ours is a red cell aldolase deficiency, which is associated with nonsense mutation, and theirs were missense mutations hereditary hemolytic anemia (Miwa et al. 1981) and at different positions. later identified as aldolase A deficiency by us (Kishi et Subjects, Material, and Methods Received August 29, 1989; final revision received April 23, 1990. Address for correspondence and reprints: Tsunehiro Mukai, Depart- Subjects ment of Bioscience, National Cardiovascular Center Research Insti- The patient, a 4-mo-old Japanese girl, had vomit- tute, 5-7-1 Fujishiro-dai, Suita, Osaka 565, Japan. © 1990 by The American Society of Human Genetics. All rights reserved. ing, appetite loss, and abdominal fullness from the time 0002-9297/90/4703-0020$02.00 of her birth. Tyrosinemia was suspected on the basis 562 Hereditary Fructose Intolerance 563 of hypertyrosinemia, hypermethioninemia, and hepatic tient (Nakamura et al. 1978) was digested to comple- dysfunction. She died at the age of 4 mo, and her tion with EcoRI and was size fractionated on an agarose fructose-i-phosphate aldolase (aldolase B) activity in gel. On the basis of the restriction map of the.human the liver was 9% of the normal level. Her disease was aldolase B gene (Mukai et al. 1987), aldolase B determined to be HFI. She was the second child, and gene-enriched fractions of 6 kb and 9 kb were recov- her younger sister was also affected by this disease. Her ered, ligated to XgtWES arms, packaged, and trans- parents are consanguineous and have no signs or symp- fected Escherichia coli strain LE392. Two types ofclones toms of HFI (Nakamura et al. 1978). containing exons 1 or 7-9 and located on different 6- kb EcoRI fragments were isolated by using a probe Material derived from the human aldolase B cDNA clone Restriction enzymes and other enzymes were from pHABL120-3 (Sakakibara et al. 1985a). These clones Takara Shuzo and Nippon Gene. Radioisotope-labeled were subcloned into pUC13 plasmid and were sequenced compounds were from New England Nuclear. Reagents with internal primers by the modified method ofdideoxy for measuring aldolase activity were from Boehringer chain termination (Hattori and Sakaki 1986). How- Mannheim. A kit for the oligonucleotide-directed in ever, cloning of the 9-kb fragment which includes exons vitro mutagenesis was from Amersham. Reagents for 2-6 was not successful. Thus, except for exon 3, exons the synthesis ofthe oligonucleotides were from Applied 2-6 were sequenced directly from genomic DNA after Biosystem. specific amplification of those exons by PCR (Gyllen- stein and Erlich 1988) using Sequenase version 2. Exon Synthesis of Oligonucleotides 3 was amplified by PCR, and the double-stranded DNA The oligonucleotides (17-21 mers) for primers ofpoly- was subcloned into pUC13 and was sequenced by the merase chain reaction (PCR), sequencing, allele-specific modified method of dideoxy chain termination (Hat- oligonucleotide (ASO) hybridization, and site-directed tori and Sakaki 1986). mutagenesis were synthesized on a model 380A 3 Column DNA Synthesizer (Applied Biosystem) by using DNA Amplification and Dot Blotting the methoxy phosphoramide method. The synthesized The PCR of exon 7 genomic DNA including the mu- oligonucleotides were used directly, without purifica- tation site was performed for 30 cycles by using a ther- tion, because these short oligonucleotides were of high mocycler (Techne BiGene PHC-1) according to a method purity. The primers for PCR and sequencing, which described elsewhere (Saiki et al. 1988). A sample (4 are located 30-225 bp upstream or downstream ofeach il) of each amplified DNA in 100 il was denatured exon are as follows: exon 1, 5'GGTAGAAAG- by 0.4 M NaOH and was blotted onto GeneScreen Plus GGGAGGGC3'; exon 2, 5'GAGCCACCCATGGTT- nylon membranes according to a method described else- CTGTG3' and 5'GTTGTTATATGATGAGACTG3'; where (Mullis et al. 1986). The filters were then hy- exon 3, 5'TGGCTTGCTCCTTATGCTGC3' and bridized in a solution of 5 x SSPE (1 x SSPE = 0.18 M 5'GACAAAGCAGAAGTGAGGTG3'; exon 4, 5'ACT- NaCl, 10 mM sodium phosphate [pH 7.7], 1 mM AATTCAACTCCTTGATCT3' and 5'CCTTCATTT- EDTA), 2 x Denhardt's solution, 0.5% SDS, and 100 CTAGCTTACAC3'; exon 5, 5'CCATGGATCAGGTAC- gg herring sperm DNA/ml, with the following ASO AAAGG3' and 5'GGTCCATTTGTAGTTATAGT3'; probes either N 240 or M 240 labeled at the 5'end: exon 6, 5'CTAGGTTCTGAGGCAGCTAG3' and N 240 (normal probe), 5'TATACTTCTTGGTGCAG3'; 5'TTATATGTTAAGTAACAGCTG3'; exon 7, 5'AAT- and M 240 (mutant probe), 5'TATACTTCTTGGTTC- GTGCCAAGGTCAAGTGG3' and 5'AAAGCTTGT- AG3' After hybridization for 4 h at 43°C, filters were GGCTCTCCAAA3'; exon 8, 5'TAAGAGGTGGCA- washed twice in 3 x SSC (1 x SSC = 0.15 M NaCl, GCATC3'; exon 9, 5'CCAGTCTCCTCTCTCAT3', 0.015 M sodium citrate, pH 7.0) at room temperature 5'GAGGGCTGAAAGGGAGC3', and 5'GTGAAA- for 15 min and then in 6 x SSC at 450C for 5 min. CCCGATAGCAG3'. The underlined sequences were The filters were autoradiographed for 6 h at -700C used as sequencing primers, but all the sequences (un- by using an intensifying screen. derlined or not) of exons 2-7 were also used as PCR primers. Construction of a Mutant Aldolase B Expression Plasmid and Its Expression in Escherichia coli Cloning and Sequencing of a Mutant Aldolase B Gene pHAB141, the original E. coli expression plasmid of DNA obtained from the liver tissue of the HFI pa- aldolase B. had been constructed previously (Sakakibara 564 Kajihara et al. Wild type HFI uvrA6 recAl phr-1) carrying plasmid pHAB141, GATC GATC pHAB240, pHAB141R, or vector alone was grown and treated according to methods described elsewhere (San- 242 Lys A car et al. 1979). 241 Thr Results Nucleotide Sequence of a Mutant Aldolase B Gene 240 Cys Human aldolase B gene has been cloned and se- *Cy quenced (Mukai et al. 1987). It consists of nine exons 239 Ala interrupted by eight introns and spans 15 kb, as de- G scribed previously. To know the nucleotide sequence of the patient's aldolase B gene, we have cloned the Figure I Comparison of the nucleotide sequence of the pa- genomic DNA from the patient's lambda DNA library tient's and normal aldolase B. The nucleotide sequence was deter- mined from a cloned lambda genomic DNA as described in Material and have sequenced the coding exons of the aldolase and Methods. The amino acid sequence shown was deduced from B gene. When this sequence was compared with the the nucleotide sequence. Wild Type, Part of the nucleotide sequence normal counterpart, only a single base change (C--A) from the normal aldolase B gene which was cloned previously (Mukai was found at position 720 of the ATG start codon in et al. 1987). HFI, Corresponding sequence of the patient's aldolase exon 7. This change caused the 240th amino acid, cys- B cloned DNA. The substituted nucleotides are circled. The arrow- head indicates the substituted adenine. teine (TGC), to be the stop codon (TGA) (fig.