Induction of p57KIP2 expression by p73␤ Eva´ Ba´ lint*†, Andrew C. Phillips*, Serguei Kozlov‡, Colin L. Stewart‡, and Karen H. Vousden*§ *Regulation of Cell Growth Laboratory, ‡Cancer and Developmental Biology Laboratory, National Cancer Institute, Frederick, MD 21702-1201 Edited by George F. Vande Woude, Van Andel Research Institute, Grand Rapids, MI, and approved January 24, 2002 (received for review September 18, 2001) The p53-related protein p73 has many functions similar to that of expressing p53 and several isoforms of p73 and identified the p53 including the ability to induce cell-cycle arrest and apoptosis. cyclin-dependent kinase inhibitor p57KIP2 (27, 28) as a transcrip- Both p53 and p73 function as transcription factors, and p73 tional target of p73␤ but not p53. activates expression of many genes that also are regulated by p53. Despite their similarities, it is evident that p53 and p73 are not Materials and Methods interchangeable functionally, with p73 playing a role in normal Plasmids. Plasmids expressing N-terminal hemagglutinin (HA)- growth and development that is not shared by p53. In this paper tagged human p73␣, ␤,or␥ (29) and dominant negative p73 we describe the ability of p73␤ but not p53 to activate expression (DDp73␣; ref. 14), murine p57KIP2 (28), and human p57KIP2 (30) of the cyclin-dependent kinase inhibitor p57KIP and KvLQT1, two have been described. genes that are coregulated in an imprinted region of the genome. Our results suggest that p73 may regulate expression of genes Cell Lines and Transfections. U2OS, Saos-2, H1299, and Saos-2 through mechanisms that are not shared by p53, potentially cells inducibly expressing p53, p73␣, p73␤, p73␥, and E2F1 under explaining the different contributions of p53 and p73 to normal the control of a tetracycline-inducible promoter have been development. described (31, 32). Saos-E2F1-DDp73 cells were generated by transfection of the Saos-E2F1 cell line with 10 ␮gof he p53 tumor suppressor belongs to a gene family including pCDNA3DDp73␣ and 2 ␮g of pBabePuro (33) for stable Tp63 and p73, which encodes protein products with both selection of transfected cells. Cells were selected by growing in structural and functional similarities (1). Although p53 is ex- medium containing 5 ␮g͞ml puromycin for 3 weeks, and inde- pressed in most tissues and plays a clear role in tumor suppres- pendent clonal lines were analyzed for expression of DDp73 and BIOCHEMISTRY sion, expression of p63 and p73 seems limited to certain tissues, retention of inducible expression of E2F1 by Western blotting. and their contribution to tumor development is much less well Retinal pigment epithelial cells stably expressing E1A were established. Neither p63 nor p73 are mutated commonly in established after infection with an E1A-expressing retrovirus. human cancers, and mice lacking these genes are not obviously Wild-type, androgenetic (AG), and parthenogenetic (PG) tumor prone (2–4). However, there is some evidence that mouse embryo fibroblasts (MEFs) were derived as described inhibition of p73 activity can contribute to cancer development (34). All cell lines were maintained in DMEM supplemented through deletion or methylation of the gene or interaction of the with 10% FCS and grown at 37°C in an atmosphere of 10% CO2 p73 protein with dominant negative forms of mutant p53 (5–10). in air. To induce protein expression, the inducible cell lines were Indeed, several tumor-associated stress signals such as DNA treated with doxycycline at 2.0 ␮g͞ml for the indicated times. damage and oncogene activation that induce p53 have been MEFs were transfected with FuGene reagent (Roche, Indianap- shown also to activate p73 (11–16). Furthermore, unlike p53, olis) using 10 ␮g of DNA and 20 ␮l of FuGene reagent per 10-cm numerous splice variants of p73 have been detected, including dish. The other cells were transfected by using the calcium- some isoforms that lack the N-terminal transcriptional activation phosphate coprecipitation method. domain of the protein, and thus may function to interfere with the activity of the full-length proteins (17, 18). Expression of RNA Analysis. Total RNA was prepared with TRIzol reagent these forms in some cancers may contribute to tumor develop- (GIBCO͞BRL). Ribonuclease protection assay was performed ment (19). by using 10 ␮g of total RNA with an RPA kit (PharMingen) and p73 has been shown to function as a sequence-specific tran- human cell cycle-2 probes labeled with [32P]UTP according to scription factor, activating expression of genes containing p53- manufacturer protocol. Dried gels were scanned with a Storm binding sites in their promoters (20, 21). Numerous p53- PhosphorImager. For Northern blot analysis, 10 ␮g of total RNA inducible genes have been described, and most of them are per lane was separated by electrophoresis and transferred to thought to play a role in mediating the downstream effects of p53 GeneScreen Plus membrane (NEN Life Sciences). Murine expression. Because p73 can induce many of the genes that are p57KIP2 or glyceraldehyde-3-phosphate dehydrogenase activated by p53, some of the downstream responses to p73 (GAPDH, CLONTECH) cDNA labeled with [32P]dCTP by expression such as cell-cycle arrest and apoptosis are thought to using the Megaprime DNA labeling system (Amersham Phar- reflect this similarity in function with p53. However, despite the macia) for hybridization. similarities between p53 and p73 activity, it has become evident For reverse transcription (RT)–PCR detection of gene ex- that they are not equivalent functionally (22, 23). In comparison pression, 4 ␮g of total RNA was reverse-transcribed by using with p53 null mice, which generally are developmentally normal but highly tumor-susceptible, p73 null mice show several devel- opmental defects including hydrocephalus, hippocampal dysgen- This paper was submitted directly (Track II) to the PNAS office. esis, and inflammatory and neuronal defects (2). Although this Abbreviations: HA, hemagglutinin; AG, androgenetic; PG, parthenogenetic; MEF, mouse difference may reflect a distinct expression pattern of p53 and embryo fibroblast; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT, reverse transcription. p73 during development, it is possible also that the p73 proteins †Present address: Department of Genetics and Molecular Biology, University of Szeged, exhibit functions that are not shared by p53. Several studies have Szeged 6726, Hungary. shown a quantitative difference in the ability of various p73 §To whom reprint requests should be addressed at: National Cancer Institute, Building 560, isoforms to induce expression of genes originally identified as Room 22-96, West 7th Street, Frederick, MD 21702-1201. E-mail: [email protected]. p53-responsive (24–26). However, there have been few reports The publication costs of this article were defrayed in part by page charge payment. This of activities exhibited by p73 but not shared by p53. We article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. compared the induction of gene expression in a cell line inducibly §1734 solely to indicate this fact. www.pnas.org͞cgi͞doi͞10.1073͞pnas.062491899 PNAS ͉ March 19, 2002 ͉ vol. 99 ͉ no. 6 ͉ 3529–3534 Downloaded by guest on September 23, 2021 SuperScriptII (GIBCO). p57KIP2 cDNA was amplified with primers to exon1 (CGAACCCGACGCAGAAGAG) and exon4 (AAACAAAACCGAACGCTGCTC). GAPDH cDNA was amplified by using a human control amplimer set (CLON- TECH). The PCRs were: 25 cycles of 94°C denaturation for 45 sec, 58°C annealing for 45 sec, and 72°C extension for 1.15 min. KVLQT1 cDNA was amplified by using primers to exons 5 (CCTCATCTTCTCCTCGTACTTTGTG) and 10 (GCAGT- GTTGGGCTCTTCCTTACAG). LIT1 cDNA was amplified by using primers Lit105 and Lit205 described previously (35). The PCRs were: 30 cycles of 94°C denaturation for 45 sec, 52°C annealing for 45 sec, and 72°C extension for 1.15 min. The PCR products were cloned and sequenced on both strands to verify their identity. For mRNA half-life analysis, cells were treated with doxycy- cline where appropriate for 20 h, and then 5 ␮g͞ml actinomycin D was added to inhibit further transcription. Cells were har- KIP2 vested over a time course, and p57 mRNA levels were Fig. 1. Saos-2 cell lines with doxycycline-inducible expression of various p73 assessed as above. splice forms. Western blot analysis showing inducible expression of HA- tagged p73␤, p73␣,orp73␥ in Saos-2 cells without (Ϫ) and after (ϩ) treatment Protein Analysis. Western blot analysis was performed as de- with 2 ␮g͞ml doxycycline (Dox) for 40 h. p73␤ protein was detected by using scribed (36). Human HA-tagged p73␣, p73␤, and p73␥ isoforms the rabbit polyclonal antibody specific for p73␤ (37); p73␣ and p73␥ were were detected by using F-7 anti-HA antibody (Santa Cruz detected by using an anti-HA antibody. Induction of endogenous MDM2 and CIP1 Biotechnology) or rabbit polyclonal anti-p73␤ described previ- p21 is shown also. Actin expression was examined as a loading control. ously (31). DDp73 was detected with rabbit polyclonal anti-p73␣ described previously (37). Human p53, MDM2, E2F1, green activation of p57KIP2 by p73␤ was limited to the Saos-2 cell fluorescent protein, and ␤-actin were detected by using DO-1, system, we examined the effect of transfection of p73 into Ab-1 (Calbiochem), anti-E2F1 KH95 (PharMingen), anti-green primary MEFs. Strong induction of mouse p57KIP2 was seen after fluorescent protein (CLONTECH), and C4 (Chemicon) mono- ␤ CIP1 transfection of human p73 , although a similar induction was not clonal antibodies, respectively. Human p21 was detected with ␥ EA10 (Calbiochem) or 6B6 (PharMingen) monoclonal antibod- seen in response to p73 despite clear expression of both ies, and human p57KIP2 was detected by using C-20 polyclonal proteins (Fig. 2b). antibodies (Santa Cruz Biotechnology). p73␤ Induces p57KIP2 Protein Expression. To establish that p73␤ Results expression induced p57KIP2 protein and to determine whether p73␤ Induces Expression of p57KIP2 mRNA.