<p> 1Supplemental Materials and Methods</p><p>2</p><p>3Oligo used in this study:</p><p>4Cyc B-F TCACATATGCCATTAGACGACGAATC</p><p>5CycB-R TTACTCGAGCCCGGGCTTTGCTTCCTTTGTATTAAGAG</p><p>6gG-F: AATGAATTCTTTGCATCATCGTTGCTCG</p><p>7gG-R: CATGATTTTCTTGTTTTAGGGTTAG</p><p>8BSR-F: CCTAAAACAAGAAAATCATGGGAATGAAAACATTTAACATTTC</p><p>9BSR-R: TCAGTCGACTTAATTTCGGGTATATTTGAG</p><p>10AUK-F: TCCATGGGAATGCCGCAGCACTTGGTAC</p><p>11AUK-R: TCTCGAGCTTGGGGACCTTACTCCTG</p><p>12Cdk1-F: TCACATATGAGCGTGTCTGCAGC</p><p>13Cdk1-R: TTAGTCGACCCCGGGGTCAAAATCGTTGTGGGAG</p><p>14Cdk2-F: TCACATATGACTGACCCCTTGAACAG</p><p>15Cdk2-R: CTAGTCGACCCCGGGCTTTGCAAAGTACGGATGC</p><p>16NEO-F: CCTAAAACAAGAAAATCATGATTGAACAAGATGGATTGCAC</p><p>17NEO-R: TCAGTCGACTCAGAAGAACTCGTCAAGAAGG</p><p>18</p><p>19Construction of pc-cycB3HA-PAC</p><p>20 All PCR amplifications were performed using iProof DNA polymerase (Bio-Rad),</p><p>21a proofreading thermophilic DNA polymerase. The Giardia cyclin B gene (GiardiaDB </p><p>22ID# GL50803_3977) was amplified using the CycB-F and CycB-R primers. A ~1 kb </p><p>23amplicon was obtained, cloned into the pJet vector (Fermentas), verified by sequencing </p><p>1 1 24and the 3’ end of cyclin B without its stop codon excised using StyI and XhoI. The 3HA </p><p>25epitope was generated by oligo concatemerization and products containing 3 epitopes </p><p>26were gel purified. The tag was then introduced into the XhoI/NotI sites of pKS-</p><p>27bluescript. The XhoI/NotI 3HA fragment and NotI/KpnI fragment from plasmid pG-</p><p>28GFP were then appended to cyclin B to yield vector pc-CycB-3HA-PAC (sequence </p><p>29submitted to GenBank under accession number HQ589229).</p><p>30</p><p>31Construction of blasticidin and neomycin vectors</p><p>32 For the overlap PCR used to generate the blasticidin and neomycin carrying </p><p>33constructs, two separate PCR reactions were first carried out. A region from pc-cycB-</p><p>343HA-PAC containing the 3’UTR for the gene and the 5’UTR preceding the puromycin </p><p>35gene was PCR amplified using primers gG-F and gG-R. A ~0.4 kb product was obtained. </p><p>36The blasticidin resistance gene was amplified from pBOS-H2BGFP (Clontech) using </p><p>37primers BSR-F and BSR-R and the neomycin resistance gene pNlopGLRluc amplified </p><p>38using the NEO-F and NEO-R primer pair. These PCR yielded a ~0.5 kb product for the </p><p>39blasticidin and a ~0.8 kb product for the neomycin. Each of these two amplicons were </p><p>40then mixed 1:1 with the 0.4 kb amplicon obtained previously and a single round of </p><p>41amplification with iProof DNA polymerase performed in the absence of any primers. </p><p>42Primers gG-F and either BSR-R or NEO-R (depending on the resistance gene being </p><p>43amplified) were then added and the remaining 30 cycles of PCR performed. The resulting</p><p>44~1.5 kb products were gel purified, cloned into pJet, verified by restriction mapping and </p><p>45sequencing, digested with EcoRI/SalI and cloned into the EcoRI/XhoI sites of pc-cycB-</p><p>463HA-PAC, thus replacing the puromycin gene. The blasticidin and neomycin resistance </p><p>2 2 47gene are thus expressed under the control of the -giardin 5’UTR and glutamate </p><p>48dehydrogenase 3’UTR. This yields a vector carrying the 3’ part of the cyclin B gene </p><p>49fused at the C-terminus with the triple HA tag, followed by the -tubulin 3’UTR and the </p><p>50drug resistance cassette.</p><p>51</p><p>52Selection of cells using blasticidin</p><p>53 Several different concentrations of blasticidin (0, 25, 50, 75, 100, 150, 200 g/ml,</p><p>54final concentration) were added to Giardia WB-C6 cells. The lowest concentration of </p><p>55blasticidin (InvivoGen) required to effectively kill untransfected cells and allow for </p><p>56selection of cells transfected with pc-CycB-3HA-BSR (accession number HQ589230) </p><p>57was 75 g/ml. All subsequent selections of Giardia cells with blasticidin were performed</p><p>58using 75 g/ml final concentration.</p><p>59</p><p>60Construction of pcAUK-3HA-NEO</p><p>61 Aurora kinase (GiardiaDB ID# GL50803_5358) was PCR amplified using </p><p>62primers AUK-F and AUK-R, yielding a 0.95 kb product, which was cloned into pJet and </p><p>63verified by sequencing. The PshAI/XhoI fragment containing the 3’end of AUK missing </p><p>64its stop codon was cloned into the EcoRV/XhoI sites of pKS bluescript to yield pKS-</p><p>65AUK. Subsequently, the XhoI/EcoRI fragment containing the 3HA tag and the </p><p>66EcoRI/KpnI fragment containing the NEO cassette were inserted into pKS-AUK to yield </p><p>67plasmid pAUK-3HA-NEO (submitted to Genbank under accession number HQ589231).</p><p>68</p><p>69Construction of pcCdk1-3Myc-BSR and pcCdk2-3Myc-BSR</p><p>3 3 70 Cdk1 (GL50803_8037) and Cdk2 (GL50803_16802) were amplified using the </p><p>71Cdk1-F and Cdk1-R or the Cdk2-F and Cdk2-R primer pair, respectively. In both cases a </p><p>72~0.9 kb product was obtained and cloned into pJet and verified by sequencing. The 3Myc</p><p>73epitope tag was generated by oligo concatemerization, followed by cloning, as for the </p><p>743HA tag. The SacI/SmaI fragment of Cdk1 or Cdk2 and the SmaI/EcoRI carrying the </p><p>753Myc epitope were cloned into the EcoRI/SacI pAUK-3HA vector in a 3-way ligation, to</p><p>76yield pcCdk1-3Myc-PAC and pcCdk2-3Myc-PAC. The EcoRI/KpnI blasticidin fragment</p><p>77from pc-cycB-3HA-BSR was then cloned into its corresponding sites to replace the </p><p>78puromycin resistance gene to give plasmids pcCdk1-3Myc-BSR and pcCdk2-3Myc-BSR </p><p>79(submitted to GenBank under accession numbers HQ589232 and HQ589233, </p><p>80respectively).</p><p>4 4</p>