Supplemental Material and Methods

1Supplemental Materials and Methods

3Oligo used in this study:

4Cyc B-F TCACATATGCCATTAGACGACGAATC

5CycB-R TTACTCGAGCCCGGGCTTTGCTTCCTTTGTATTAAGAG

6gG-F: AATGAATTCTTTGCATCATCGTTGCTCG

7gG-R: CATGATTTTCTTGTTTTAGGGTTAG

8BSR-F: CCTAAAACAAGAAAATCATGGGAATGAAAACATTTAACATTTC

9BSR-R: TCAGTCGACTTAATTTCGGGTATATTTGAG

10AUK-F: TCCATGGGAATGCCGCAGCACTTGGTAC

11AUK-R: TCTCGAGCTTGGGGACCTTACTCCTG

12Cdk1-F: TCACATATGAGCGTGTCTGCAGC

13Cdk1-R: TTAGTCGACCCCGGGGTCAAAATCGTTGTGGGAG

14Cdk2-F: TCACATATGACTGACCCCTTGAACAG

15Cdk2-R: CTAGTCGACCCCGGGCTTTGCAAAGTACGGATGC

16NEO-F: CCTAAAACAAGAAAATCATGATTGAACAAGATGGATTGCAC

17NEO-R: TCAGTCGACTCAGAAGAACTCGTCAAGAAGG

19Construction of pc-cycB3HA-PAC

20 All PCR amplifications were performed using iProof DNA polymerase (Bio-Rad),

21a proofreading thermophilic DNA polymerase. The Giardia cyclin B gene (GiardiaDB

22ID# GL50803_3977) was amplified using the CycB-F and CycB-R primers. A ~1 kb

23amplicon was obtained, cloned into the pJet vector (Fermentas), verified by sequencing

1 1 24and the 3’ end of cyclin B without its stop codon excised using StyI and XhoI. The 3HA

25epitope was generated by oligo concatemerization and products containing 3 epitopes

26were gel purified. The tag was then introduced into the XhoI/NotI sites of pKS-

27bluescript. The XhoI/NotI 3HA fragment and NotI/KpnI fragment from plasmid pG-

28GFP were then appended to cyclin B to yield vector pc-CycB-3HA-PAC (sequence

29submitted to GenBank under accession number HQ589229).

31Construction of blasticidin and neomycin vectors

32 For the overlap PCR used to generate the blasticidin and neomycin carrying

33constructs, two separate PCR reactions were first carried out. A region from pc-cycB-

343HA-PAC containing the 3’UTR for the gene and the 5’UTR preceding the puromycin

35gene was PCR amplified using primers gG-F and gG-R. A ~0.4 kb product was obtained.

36The blasticidin resistance gene was amplified from pBOS-H2BGFP (Clontech) using

37primers BSR-F and BSR-R and the neomycin resistance gene pNlopGLRluc amplified

38using the NEO-F and NEO-R primer pair. These PCR yielded a ~0.5 kb product for the

39blasticidin and a ~0.8 kb product for the neomycin. Each of these two amplicons were

40then mixed 1:1 with the 0.4 kb amplicon obtained previously and a single round of

41amplification with iProof DNA polymerase performed in the absence of any primers.

42Primers gG-F and either BSR-R or NEO-R (depending on the resistance gene being

43amplified) were then added and the remaining 30 cycles of PCR performed. The resulting

44~1.5 kb products were gel purified, cloned into pJet, verified by restriction mapping and

45sequencing, digested with EcoRI/SalI and cloned into the EcoRI/XhoI sites of pc-cycB-

463HA-PAC, thus replacing the puromycin gene. The blasticidin and neomycin resistance

2 2 47gene are thus expressed under the control of the -giardin 5’UTR and glutamate

48dehydrogenase 3’UTR. This yields a vector carrying the 3’ part of the cyclin B gene

49fused at the C-terminus with the triple HA tag, followed by the -tubulin 3’UTR and the

50drug resistance cassette.

52Selection of cells using blasticidin

53 Several different concentrations of blasticidin (0, 25, 50, 75, 100, 150, 200 g/ml,

54final concentration) were added to Giardia WB-C6 cells. The lowest concentration of

55blasticidin (InvivoGen) required to effectively kill untransfected cells and allow for

56selection of cells transfected with pc-CycB-3HA-BSR (accession number HQ589230)

57was 75 g/ml. All subsequent selections of Giardia cells with blasticidin were performed

58using 75 g/ml final concentration.

60Construction of pcAUK-3HA-NEO

61 Aurora kinase (GiardiaDB ID# GL50803_5358) was PCR amplified using

62primers AUK-F and AUK-R, yielding a 0.95 kb product, which was cloned into pJet and

63verified by sequencing. The PshAI/XhoI fragment containing the 3’end of AUK missing

64its stop codon was cloned into the EcoRV/XhoI sites of pKS bluescript to yield pKS-

65AUK. Subsequently, the XhoI/EcoRI fragment containing the 3HA tag and the

66EcoRI/KpnI fragment containing the NEO cassette were inserted into pKS-AUK to yield

67plasmid pAUK-3HA-NEO (submitted to Genbank under accession number HQ589231).

69Construction of pcCdk1-3Myc-BSR and pcCdk2-3Myc-BSR

3 3 70 Cdk1 (GL50803_8037) and Cdk2 (GL50803_16802) were amplified using the

71Cdk1-F and Cdk1-R or the Cdk2-F and Cdk2-R primer pair, respectively. In both cases a

72~0.9 kb product was obtained and cloned into pJet and verified by sequencing. The 3Myc

73epitope tag was generated by oligo concatemerization, followed by cloning, as for the

743HA tag. The SacI/SmaI fragment of Cdk1 or Cdk2 and the SmaI/EcoRI carrying the

753Myc epitope were cloned into the EcoRI/SacI pAUK-3HA vector in a 3-way ligation, to

76yield pcCdk1-3Myc-PAC and pcCdk2-3Myc-PAC. The EcoRI/KpnI blasticidin fragment

77from pc-cycB-3HA-BSR was then cloned into its corresponding sites to replace the

78puromycin resistance gene to give plasmids pcCdk1-3Myc-BSR and pcCdk2-3Myc-BSR

79(submitted to GenBank under accession numbers HQ589232 and HQ589233,

80respectively).