TABLE SXXXX: Oligonucleotides Used in This Work

TABLE SXXXX: Oligonucleotides Used in This Work

<p>Additional file 12: Oligonucleotides used in this work name Sequence (5’→3’) Application TTAATGATACAAATTAGAGTGAATTTTTAGCCCGGAAAGTTGTCTCGTGG P1_sulA CGTGAGAGGAGTGTAGGCTGGAGCTGCTTC P1 primer for the construction of UA6189 strain ATGTACACTTCAGGCTATGCACATCGTTCTTCGTCGTTCTCATCCGCAGC P2_sulA AAGTAAAATTATGGGAATTAGCCATGGTCC P2 primer for the construction of UA6189 strain</p><p>ATGAAAGCGTTAACGGCCAGGCAACAAGAGGTGTTTGATCTCATCCGTGA P1_lexA TCACATCAGCGTGTAGGCTGGAGCTGCTTC P2 primer for the construction of UA6189 strain</p><p>TTACAGCCAGTCGCCGTTGCGAATAACCCCAACCGCCAGCCCTTCAATGG P2_lexA TGAAGCTCTGATGGGAATTAGCCATGGTCC P2 primer for the construction of UA6189 strain Upper primer for cloning the V.parahaemolyticus lexA gen in NdelexAVpa CATATGAAGCCGTTAACGCCACGCCa pET15b overexpression vector Lower primer for cloning the V.parahaemolyticus lexA gen in XholexAVpa CTCGAGTTACATCCAATCGGTATTGa pET15b overexpression vector Upper primer for cloning the E. coli lexA gen in pET15b NdelexAEco CATATGAAAGCGTTAACGGCCAGGCa overexpression vector Lower primer for cloning the E. coli lexA gen in pET15b XholexAEco CTCGAGTTACAGCCAGTCGCCGTTGCa overexpression vector AAAAAGCATGATAACTGGGCCAGTATTGATAAATTACAACACCTGTATAA - wtintVpaF ATAAACAGACTTATAATATTATGAAAAGTCAATTTCTGCTAAGTGTAAAA Synthetic oligo to obtain the Pint1 EMSA probe ATTTTACACTTAGCAGAAATTGACTTTTCATAATATTATAAGTCTGTTTA - wtpintVpaR TTTATACAGGTGTTGTAATTTATCAATACTGGCCCAGTTATCATGCTTTT Synthetic oligo to obtain the Pint1 EMSA probe </p><p>AGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGT wtpint1-pMURF ACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTC Synthetic oligo to obtain the Pint1- EMSA probe </p><p>AGACCCACGGCGTAACGCGCTTGCTGCTTGGATGCCCGAGGCATAGACTG wtpint1-pMURR TACAAAAAAACAGTCATAACAAGCCATGAAAACCGCCACTGCGCCGTTAC Synthetic oligo to obtain the Pint1- EMSA probe</p><p>AACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGT wtpint1+pMURF ACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGT Synthetic oligo to obtain Pint1+ EMSA probe</p><p>AACCCACGGCGTAACGCGCTTGCTGCTTGGATGCCCGAGGCATAGACTGT wtpint1+pMURR ACCCCAAAAAAACAGTCATAACAAGCCATGAAAACCGCCACTGCGCCGT Synthetic oligo to obtain Pint1+ EMSA probe Upper primer of V. parahaemolyticus dxs gene for quantitative real dxs_upVpa AGTGCTTTCCGGTAGTCTTTA time RT-PCR assays Lower primer of V. parahaemolyticus dxs gene for quantitative real dxs_dwVpa AACCTTTGCCTTTCTTAGTCA time RT-PCR assays Upper primer of E. coli dxs gene for quantitative real time RT-PCR dxs_upEco GACGAACTGCGCCGCTATT assays Lower primer of E. coli dxs gene for quantitative real time RT-PCR dxs_dwEco CCGGCACTGATGGAGGTTGAT assays Upper primer of pMUR050 int gene for quantitative real time RT- EcoInt_up AAACCGAGGATGCGAACCACTT PCR assays Lower primer of pMUR050 int gene for quantitative real time RT- EcoInt_dw TTACCAACCGAACAGGCTTATG PCR assays Upper primer of V. parahaemolyticus int gene for quantitative real VpaInt_up CTGAATGCTATTTCGTTTTTAT time RT-PCR assays Lower primer of V. parahaemolyticus int gene for quantitative real VpaInt_dw CACCTTTCCCTTGCCAGACT time RT-PCR assays Upper primer of E. coli recA gene for quantitative real time RT-PCR RecAEco_up CCTTGCGGCACGTATGATGA assays Lower primer of E. coli recA gene for quantitative real time RT-PCR RecAEco_dw CACCACGTTTTCGCCCTCTTT assays Upper primer of V. parahaemolyticus recA gene for quantitative RecAVpa_up AAGTAGCATTTCACGCAGTTTG real time RT-PCR assays Lower primer of V. parahaemolyticus recA gene for quantitative RecAVpa_dw AGAAGGCGATGAAGTTGTAGGT real time RT-PCR assays a NdeI or XhoI endonuclease restriction sites included in the oligonucleotide sequences are shown in italics.</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us