Table 1 PCR Primers and Conditions

Table 1 PCR Primers and Conditions

<p>Electronic supplementary material</p><p>Table 1 PCR primers and conditions</p><p>Gene Sense Antisense Number of cycles Size of product (bp) Annealing temperature</p><p>(°C) Rat Insulin I CTACAATCATAGACCATC CAGTTGGTAGAGGGAGCAGAT 35 353 56 AGCA Rat Insulin 2 AGCCCTAAGTGACCAGCT GTGCCAAGGTCTGAAGGTCA 35 297 58</p><p>ACA Rat Pdx1 TGCTAATCCCCCTGCGTG CTCCTCCGGTTCTGCTGCGTATGC 40 348 59</p><p>CCTGTA Human PDX1 CAAGGACCCATGCGCGTT GAACTCCTTCTCCAGCTCTAGCA 40 453 62</p><p>CCAGCGA GCTG Rat Pksc1 TCAGGGAATGGGGGTCG CCAAATCGGCTGTTCACCATCAA 35 401 60</p><p>(PC1/3) TCAAG G Rat Slc2a2 (Glut2) TGGGTTCCTTCCAGTTCG AGGCGTCTGGTGTCGTATG 35 183 55</p><p>Rat Gck GTGGTGCTTTTGAGACCC TTCGATGAAGGTGATTTCGCA 35 107 55</p><p>GTT Rat Abcc8 (SUR1) TCACGCCTGTCTATCATC GCTTCATCCATGATGAAGATGC 35 265 58</p><p>CTACAG Rat Kcnj8 and 11 TACCACGTCATCGACTCC TGCGGTCCTCATCAAGCTGGC 35 268 58</p><p>(KIR6.1 and 6.2) AACAG Rat glucagon GACCGTTTACATCGTGGC GGTTCCTCTTGGTGTTCATCA 35 248 58</p><p>TG Rat somatostatin ACCCCAGACTCCGTCAGT CTCCAGCCTCATCTCGTCCT 35 173 58</p><p>TT Rat pancreatic AACAGAGGGCTCAATAC GAGACAGAAGGGAGGCTACA 35 302 56 polypeptide GAA</p><p>Rat amylase CAAAATGGTTCTCCCAAG CAAACACAAGGGCTCTGTCA 35 231 52 GA Rat albumin GCCCTACCCACAAAGCCT AGCCCCTTCATATCACAGAGCA 35 251 58</p><p>CAG Rat Pax4 GGGCACTACAGGAAGAC TTGGAAAACCAGACCCTCAC 40 274 60</p><p>CAG Rat Pax6 ATGCAGAACAGTCACAG TCGCTAGCCAGGTTGCGAAG 40 398 60</p><p>CGG Rat Nkx6-1 ACTTGGCAGGACCAGAG GGGCTTGTTGTAATCGTCGT 40 209 60</p><p>AGA Rat Neurod1 GAGGAGGAAGAGGAGGA GACGAGGTCTGGGCTTTTG 40 297 65</p><p>GGA Rat Mafa AGGCCTTCCGGGGCCAG TGGAGCTGGCACTTCTCGCT 40 408 60</p><p>AG Fig. 1 a Histomorphology of hepatocyte graft. Tissue sections (haematoxylin and eosin stained) of a SCID-beige mouse kidney with rat hepatocytes graft 60 days after transplantation. K, kidney parenchyma; continuous arrow, graft; dashed arrow, blood vessel within the graft. b Detection of insulin within the graft. Insulin was detected with an anti-insulin antibody (brown). The nuclei are stained with haematoxylin. G, graft; K, kidney parenchyma. Original magnifications: 100× (a), 400× (b); enlarged magnification of insulin-positive cells within graft (1000×) </p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    4 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us