<p> Supplementary Material to</p><p>Genetic variations in fetal and maternal tumor necrosis factor-alpha and interleukin 10: is there an association with preterm birth or periventricular leucomalacia?</p><p>Nuk M1, Orendi K1, Rosenberger S1, Griesbacher A1, Holzapfel-Bauer M2, Resch B3, Lang U2 and Pertl B2</p><p>PCR Analysis of IL-10 (-1082), IL-10 (-819) and TNF-α (-308) polymorphisms</p><p>IL-10 and TNF- polymorphisms were determined with allele specific PCR. Primers used are listed in Table 4. The IL-10 (-819 C>T) genotype was determined using primers IL10(-819)T or IL10(-819)C together with IL10(-819)antisense, the IL-10 (-1082 G>A) genotype was determined using primers IL10(-1082)A or IL10(-1082)G together with IL10(-1082)antisense and the TNF-α (-308 G>A) genotype was determined using primers TNF-α(-308)G or TNF-</p><p>α(-308)A together with TNF-α(-308)antisense. PCR reactions were performed in a total volume of 50µl using 50 to 500ng genomic DNA as template. The PCR reaction contained</p><p>200µM of each deoxynucleoside triphosphate, one unit Taq DNA Polymerase, 2mM MgCl2 and 1xTaq Buffer supplemented with (NH4)2SO4 (all reagents Fermentas Life Sciences,</p><p>Germany). 50pmol of allele specific primer and 50pmol of reverse primer were added to the reaction mixture. Cycling conditions for the determination of IL-10 (-1082) and IL-10 (-819) polymorphisms comprised an initial denaturation step at 95°C for 4min followed by 30 cycles of 95°C for 15s, 63°C for 50s, 72°C for 40s and final extension at 72°C for 10min. Thermal cycling conditions for the amplification of the TNF-α (-308) polymorphism comprised an initial denaturation step at 95°C for 4min followed by 30 cycles of 95°C for 15s, 62.5°C for</p><p>50s, 72°C for 40s and final extension at 72°C for 10min. PCR products were electrophoretically resolved on TBE-agarose gels containing 2% agarose. Gels were stained with ethidium bromide. SNP genotypes of some samples were verified by DNA sequencing. Table 4. Primers used in this study</p><p>Primer 5´ to 3´ sequence1 Position IL10(-819)T ACCCTTGTACAGGTGATGTAAT 464434-4644152 IL10(-819)C CCCTTGTACAGGTGATGTAAC 464433-4644152 IL10(-819)antisense AGGATGTGTTCCAGGCTCCT 464201-4642202 IL10(-819)SQ forward TATCTCTGTGCCTCAGTTTG 464413-4643942 IL10(-819)SQ reverse AACTGTGCTTGGGGGAAG 464284-4643012 TNF-α(-308)G ATAGGTTTTGAGGGGCATGG 2836650-28366693 TNF-α(-308)A AATAGGTTTTGAGGGGCATGA 2836649-28366693 TNF-α(-308)antisense TCTCGGTTTCTTCTCCATCG 2836834-28368153 TNF-α(-308)SQ forward CTCCAGGGTCCTACACAC 2836684-28367013 TNF-α(-308)SQ reverse AAAGTTGGGGACACACAAG 2836797-28367793 IL10(-1082)A ACTACTAAGGCTTCTTTGGGAA 464697-4646782 IL10(-1082)G CTACTAAGGCTTCTTTGGGAG 464696-4646782 IL10(-1082)antisense CAGTGCCAACTGAGAATTTGG 464439-4644592 IL10(-1082)SQ forward GATGGGGTGGAAGAAGTTGA 464574-4645932 IL10(-1082)SQ reverse GTAGAGCAACACTCCTCGCC 464803-4647842 1 Letters in bold indicate the polymorphism at this site 2 Primer binding position in Homo sapiens chromosome 1 genomic contig, GRCh37 reference primary assembly (Accession number NT_167186.1) 3 Primer binding position in Homo sapiens chromosome 6 genomic contig, GRCh37 reference assembly (Accession number NT_167248.1)</p>