Supplementary Material To s1

Supplementary Material to

Genetic variations in fetal and maternal tumor necrosis factor-alpha and interleukin 10: is there an association with preterm birth or periventricular leucomalacia?

Nuk M1, Orendi K1, Rosenberger S1, Griesbacher A1, Holzapfel-Bauer M2, Resch B3, Lang U2 and Pertl B2

PCR Analysis of IL-10 (-1082), IL-10 (-819) and TNF-α (-308) polymorphisms

IL-10 and TNF- polymorphisms were determined with allele specific PCR. Primers used are listed in Table 4. The IL-10 (-819 C>T) genotype was determined using primers IL10(-819)T or IL10(-819)C together with IL10(-819)antisense, the IL-10 (-1082 G>A) genotype was determined using primers IL10(-1082)A or IL10(-1082)G together with IL10(-1082)antisense and the TNF-α (-308 G>A) genotype was determined using primers TNF-α(-308)G or TNF-

α(-308)A together with TNF-α(-308)antisense. PCR reactions were performed in a total volume of 50µl using 50 to 500ng genomic DNA as template. The PCR reaction contained

200µM of each deoxynucleoside triphosphate, one unit Taq DNA Polymerase, 2mM MgCl2 and 1xTaq Buffer supplemented with (NH4)2SO4 (all reagents Fermentas Life Sciences,

Germany). 50pmol of allele specific primer and 50pmol of reverse primer were added to the reaction mixture. Cycling conditions for the determination of IL-10 (-1082) and IL-10 (-819) polymorphisms comprised an initial denaturation step at 95°C for 4min followed by 30 cycles of 95°C for 15s, 63°C for 50s, 72°C for 40s and final extension at 72°C for 10min. Thermal cycling conditions for the amplification of the TNF-α (-308) polymorphism comprised an initial denaturation step at 95°C for 4min followed by 30 cycles of 95°C for 15s, 62.5°C for

50s, 72°C for 40s and final extension at 72°C for 10min. PCR products were electrophoretically resolved on TBE-agarose gels containing 2% agarose. Gels were stained with ethidium bromide. SNP genotypes of some samples were verified by DNA sequencing. Table 4. Primers used in this study

Primer 5´ to 3´ sequence1 Position IL10(-819)T ACCCTTGTACAGGTGATGTAAT 464434-4644152 IL10(-819)C CCCTTGTACAGGTGATGTAAC 464433-4644152 IL10(-819)antisense AGGATGTGTTCCAGGCTCCT 464201-4642202 IL10(-819)SQ forward TATCTCTGTGCCTCAGTTTG 464413-4643942 IL10(-819)SQ reverse AACTGTGCTTGGGGGAAG 464284-4643012 TNF-α(-308)G ATAGGTTTTGAGGGGCATGG 2836650-28366693 TNF-α(-308)A AATAGGTTTTGAGGGGCATGA 2836649-28366693 TNF-α(-308)antisense TCTCGGTTTCTTCTCCATCG 2836834-28368153 TNF-α(-308)SQ forward CTCCAGGGTCCTACACAC 2836684-28367013 TNF-α(-308)SQ reverse AAAGTTGGGGACACACAAG 2836797-28367793 IL10(-1082)A ACTACTAAGGCTTCTTTGGGAA 464697-4646782 IL10(-1082)G CTACTAAGGCTTCTTTGGGAG 464696-4646782 IL10(-1082)antisense CAGTGCCAACTGAGAATTTGG 464439-4644592 IL10(-1082)SQ forward GATGGGGTGGAAGAAGTTGA 464574-4645932 IL10(-1082)SQ reverse GTAGAGCAACACTCCTCGCC 464803-4647842 1 Letters in bold indicate the polymorphism at this site 2 Primer binding position in Homo sapiens chromosome 1 genomic contig, GRCh37 reference primary assembly (Accession number NT_167186.1) 3 Primer binding position in Homo sapiens chromosome 6 genomic contig, GRCh37 reference assembly (Accession number NT_167248.1)