Original Paper 1608223 Eur J Hum Genet 1995;3:14-20 Ariel Darvasi Deletion and Insertion Mutations Batsheva Kerem Department of Genetics, in Short Tandem Repeats in the The Silberman Institute of Life Sciences, The Hebrew University Coding Regions of Human Genes of Jerusalem, Israel Keywords Abstract Deletions In vitro studies in bacterial, yeast and eukaryotic systems have Insertions demonstrated the existence of deletion and insertion ‘hot­ Mutations spots’ involving repetitive sequences. Slipped-strand mispair­ Short repeats ing (SSM) has been suggested to be the mechanism involved. Slipped mispairing Progress in human molecular genetics has allowed the identifi­ cation of many mutations causing diseases. Analysis of se­ quences involved in these mutations provides an opportunity to investigate the contribution of short tandem repeats to the naturally occurring mutations in coding regions of human genes. We have analyzed the sequences surrounding 625 dis­ ease-causing mutations in the coding regions of three genes: the cystic fibrosis transmembrane conductance regulator, ß globin and factor IX. Altogether, 134 (21%) insertion and deletion mutations of 4 base pairs or less were identified. In 47% of these mutations, the deletions and insertions occurred within a unit repeated tandemly 2- to 7-fold. These were classi­ fied as SSM mutations. The proportion of SSM mutations was significantly higher than expected by chance. The estimated net proportion of deletion and insertion mutations attributed to SSM was 27%. These results indicate that very short repeti­ tive sequences contribute significantly to the generation of deletion and insertion mutations in human genes, and to the evolution of diversity of their coding regions. Introduction eficial, neutral or detrimental to the organism. In order to understand the mechanisms gener­ Genetic information can be altered by base ating mutations, it is essential to investigate substitutions or by addition or deletion of the nature of the DNA sequence alterations. nucleotides. These changes can be either ben- Extensive studies in bacterial genetic systems Received: May 20, 1994 Batsheva Kerem, PhD © 1995 Revision received: November 1,1994 Department of Genetics S. Karger AG, Basel Accepted: December 23,1994 The Silberman Life Sciences Institute 1018-4813/95/ The Hebrew University of Jerusalem 0031-0014S8.00/0 Jerusalem 91904 (Israel) have demonstrated the existence of deletion tion that tract instability is associated with and insertion ‘hotspots’, involving repetitive DNA polymerases slipping during replica­ sequences [1, 2], In vitro frameshift fidelity tion. Another study has recently shown that assays using eukaryotic DNA polymerases DNA plasticity in mitochondrial DNA is a have suggested that template-primer mis­ result of the instability of a 10-bp tandemly alignment during DNA synthesis or recombi­ repeated sequence [9], nation is probably the mechanism generating Several human diseases (fragile X, myo­ short deletion and insertion mutations [3], tonic dystrophy, Huntington’s chorea, spinal According to this proposal, misaligned inter­ and bulbar muscular atrophy and spinocere­ mediates are formed as a result of slippage of bellar ataxia type 1) have been found to be DNA strands, in regions containing repeated caused by somatic expansion of highly re­ nucleotides. Therefore, the mechanism was peated tandem repetitive sequences [10-15]. termed slipped-strand mispairing (SSM) [4]. In these diseases, a dramatic increase in the The eukaryotic genome contains many re­ length of the repeated run occurs. gions in which small motifs consisting of a sin­ Recent progress in human molecular ge­ gle base or small number of bases are repeated netics has led to the identification of disease- in tandem multiple times (often over 20 re­ causing mutations in several human genes. peated units in a run). These relatively high- Analysis of the sequences involved in these copy-number simple tandem repeats com­ mutations has provided an opportunity to prise the highly polymorphic microsatellite investigate the mechanisms involved. In a sequences found in many noncoding regions study of 80 short deletion and insertion muta­ of mammalian genomes. These polymor­ tions, direct repeats of between 2 and 8 bp phisms derive from differences in the copy were found in the immediate vicinity of the number of the tandemly repeated simple mo­ majority of the analyzed mutations [16, 17], tifs, and are usually stably inherited. There­ These direct repeats either included or par­ fore, these polymorphic sites are useful for tially overlapped the deleted or inserted bases. genomic mapping and for fingerprinting stud­ A modified SSM model was proposed to ex­ ies. Analysis of several restriction fragment plain these results. The existence of direct length polymorphism (RFLP) sites flanking repeats in the vicinity of mutation sites is not polymorphic microsatellite sites has suggested surprising, since an extensive computer re­ that SSM, rather than unequal exchange be­ search of DNA sequences has shown signifi­ tween homologous chromosomes, is most cantly high levels of nontandem direct repeats probably the mechanism involved in generat­ (cryptic simplicity) in many coding or non­ ing copy number variation [5,6]. coding DNA sequences [18]. Studies in Saccharomyces cerevisiae have In this study, a more conservative analysis shown that (GT)n tracts are highly unstable, was performed in order to estimate the net with length alterations at a minimal rate of influence of SSM in short (1-4 bp) insertion 10-4 events per division [7], Most of the and deletion mutations. This was obstained changes involve additions or deletions of one by classifying a mutation as SSM only in those or two repeated units. In addition, Strand et cases where the mutation could be simply al. [8] have shown that the instability of poly explained by the SSM model as detailed in the (GT) sequences in yeast can be greatly in­ Material and Methods section. The results of creased by mutations in DNA mismatch re­ this analysis are expected to enhance our un­ pair genes. These results support the assump­ derstanding of the contribution of SSM to the 15 mutability of human genes. We have studied Table 1. Examples of deletion (underlined) and in­ three genes in which a large number of dis­ sertion (double underlined) mutations of 4 bp or less found in the CFTR, ß-globin and factor IX genes ease-causing mutations have been identified: (1) the cystic fibrosis (CF) transmembrane 1 Factor IX (1-bp SSM deletion in a run of two re­ conductance regulator (CFTR) gene, in which peats) 400 mutations have been identified [CF Ge­ 6382 CAGGTAAATTGGAAGAGTTT 6401 [22] netic Analysis Consortium, pers. commun.]; 2 ß-globin (1-bp SSM insertion in a run of three re­ (2) the ß globin gene, in which over 100 muta­ peats) tions cause ß thalassemia [19], and (3) the fac­ 73 GTTGTTGAGGCCCCTGGGCA 92 [19] tor IX gene, in which over 300 mutations cause hemophilia B [20]. 3 CFTR ( 1 -bp non-SSM deletion) 545 TACACCCAGCCATTTTTGGC 564 [23] 4 CFTR (2-bp SSM insertion in a run of two repeats) Materials and Methods 1141 TCACCACCATCTCTÇATTCT 1160 [24] Sequences flanking mutations in the coding region 5 CFTR (2-bp SSM deletion in a run of five repeats) of the CFTR, ß-globin and factor IX genes were ana­ 382 TAT GGAAT CTTTTT AT ATTT 401 lyzed. The information was obtained from previously [Clausters, pers. commun.] published reports [19, 20; CF Genetic Analysis Con­ sortium, pers. commun.]. The analyzed mutations 6 CFTR (4-bp SSM deletion in a run of two repeats) were located within published normal coding se­ 4003 4022 quences as reported in GenBank. [our unpubl. result] Classification of Mutations The numbers at the beginning and end of the Mutations that were neither insertions nor dele­ sequences represent the position of the first and last tions, and mutations in which the insertion or deletion nucleotide, respectively, in the row, as reported in was larger than 4 bp were classified as ‘other’ muta­ GenBank. tions. Classification as an SSM mutation was restricted to mutations of up to 4 bp since most length variation was found in repeat units of 1-4 bp [21]. Insertion or deletion mutations of 4 bp or less were classified as deriving from SSM if they met the following condi­ Table 2. Insertion and deletion mutations in the tions: (1) deletion of n (1-4) bp was considered SSM, if CFTR, factor IX and ß-globin genes and only if the adjacent n bases, from either side, were identical to the deleted bases; (2) insertion of n (1-4) Gene All Insertions SSMa bp was considered SSM if and only if the insertion was mutations and deletions adjacent to a tandem repeat of at least 2 repeats with the same sequence as the inserted bases, and (3) when CFTR 243 66 35 (0.53) the deletion or insertion was itself a repetitive unit (e.g. Factor IX 329 44 11 (0.39) TT, ACAC), only the repeat unit was compared with ß-globin 53 24 11 (0.46) the adjacent bases to classify the nature of the muta­ tion according to (1) and (2) (e.g. deletion of AA in a Total 625 134 63 (0.47) run of AAA would be considered SSM). All other mutations were classified as non-SSM. At a The value in parentheses is the proportion of inser­ each SSM mutation, the length of the repetitive run tion and deletion mutations classified as SSM. in the normal sequence was counted. For example: (1) deletion of the underlined nucleotides in the nor­ mal sequence ACACACAC was counted as a 2-bp deletion SSM mutation in a run of four repeats and (2)