DOCSLIB.ORG

Deletion and Insertion Mutations in Short Tandem Repeats in The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Deletion and Insertion Mutations in Short Tandem Repeats in The Original Paper 1608223 Eur J Hum Genet 1995;3:14-20 Ariel Darvasi Deletion and Insertion Mutations Batsheva Kerem Department of Genetics, in Short Tandem Repeats in the The Silberman Institute of Life Sciences, The Hebrew University Coding Regions of Human Genes of Jerusalem, Israel Keywords Abstract Deletions In vitro studies in bacterial, yeast and eukaryotic systems have Insertions demonstrated the existence of deletion and insertion ‘hot­ Mutations spots’ involving repetitive sequences. Slipped-strand mispair­ Short repeats ing (SSM) has been suggested to be the mechanism involved. Slipped mispairing Progress in human molecular genetics has allowed the identifi­ cation of many mutations causing diseases. Analysis of se­ quences involved in these mutations provides an opportunity to investigate the contribution of short tandem repeats to the naturally occurring mutations in coding regions of human genes. We have analyzed the sequences surrounding 625 dis­ ease-causing mutations in the coding regions of three genes: the cystic fibrosis transmembrane conductance regulator, ß globin and factor IX. Altogether, 134 (21%) insertion and deletion mutations of 4 base pairs or less were identified. In 47% of these mutations, the deletions and insertions occurred within a unit repeated tandemly 2- to 7-fold. These were classi­ fied as SSM mutations. The proportion of SSM mutations was significantly higher than expected by chance. The estimated net proportion of deletion and insertion mutations attributed to SSM was 27%. These results indicate that very short repeti­ tive sequences contribute significantly to the generation of deletion and insertion mutations in human genes, and to the evolution of diversity of their coding regions. Introduction eficial, neutral or detrimental to the organism. In order to understand the mechanisms gener­ Genetic information can be altered by base ating mutations, it is essential to investigate substitutions or by addition or deletion of the nature of the DNA sequence alterations. nucleotides. These changes can be either ben- Extensive studies in bacterial genetic systems Received: May 20, 1994 Batsheva Kerem, PhD © 1995 Revision received: November 1,1994 Department of Genetics S. Karger AG, Basel Accepted: December 23,1994 The Silberman Life Sciences Institute 1018-4813/95/ The Hebrew University of Jerusalem 0031-0014S8.00/0 Jerusalem 91904 (Israel) have demonstrated the existence of deletion tion that tract instability is associated with and insertion ‘hotspots’, involving repetitive DNA polymerases slipping during replica­ sequences [1, 2], In vitro frameshift fidelity tion. Another study has recently shown that assays using eukaryotic DNA polymerases DNA plasticity in mitochondrial DNA is a have suggested that template-primer mis­ result of the instability of a 10-bp tandemly alignment during DNA synthesis or recombi­ repeated sequence [9], nation is probably the mechanism generating Several human diseases (fragile X, myo­ short deletion and insertion mutations [3], tonic dystrophy, Huntington’s chorea, spinal According to this proposal, misaligned inter­ and bulbar muscular atrophy and spinocere­ mediates are formed as a result of slippage of bellar ataxia type 1) have been found to be DNA strands, in regions containing repeated caused by somatic expansion of highly re­ nucleotides. Therefore, the mechanism was peated tandem repetitive sequences [10-15]. termed slipped-strand mispairing (SSM) [4]. In these diseases, a dramatic increase in the The eukaryotic genome contains many re­ length of the repeated run occurs. gions in which small motifs consisting of a sin­ Recent progress in human molecular ge­ gle base or small number of bases are repeated netics has led to the identification of disease- in tandem multiple times (often over 20 re­ causing mutations in several human genes. peated units in a run). These relatively high- Analysis of the sequences involved in these copy-number simple tandem repeats com­ mutations has provided an opportunity to prise the highly polymorphic microsatellite investigate the mechanisms involved. In a sequences found in many noncoding regions study of 80 short deletion and insertion muta­ of mammalian genomes. These polymor­ tions, direct repeats of between 2 and 8 bp phisms derive from differences in the copy were found in the immediate vicinity of the number of the tandemly repeated simple mo­ majority of the analyzed mutations [16, 17], tifs, and are usually stably inherited. There­ These direct repeats either included or par­ fore, these polymorphic sites are useful for tially overlapped the deleted or inserted bases. genomic mapping and for fingerprinting stud­ A modified SSM model was proposed to ex­ ies. Analysis of several restriction fragment plain these results. The existence of direct length polymorphism (RFLP) sites flanking repeats in the vicinity of mutation sites is not polymorphic microsatellite sites has suggested surprising, since an extensive computer re­ that SSM, rather than unequal exchange be­ search of DNA sequences has shown signifi­ tween homologous chromosomes, is most cantly high levels of nontandem direct repeats probably the mechanism involved in generat­ (cryptic simplicity) in many coding or non­ ing copy number variation [5,6]. coding DNA sequences [18]. Studies in Saccharomyces cerevisiae have In this study, a more conservative analysis shown that (GT)n tracts are highly unstable, was performed in order to estimate the net with length alterations at a minimal rate of influence of SSM in short (1-4 bp) insertion 10-4 events per division [7], Most of the and deletion mutations. This was obstained changes involve additions or deletions of one by classifying a mutation as SSM only in those or two repeated units. In addition, Strand et cases where the mutation could be simply al. [8] have shown that the instability of poly explained by the SSM model as detailed in the (GT) sequences in yeast can be greatly in­ Material and Methods section. The results of creased by mutations in DNA mismatch re­ this analysis are expected to enhance our un­ pair genes. These results support the assump­ derstanding of the contribution of SSM to the 15 mutability of human genes. We have studied Table 1. Examples of deletion (underlined) and in­ three genes in which a large number of dis­ sertion (double underlined) mutations of 4 bp or less found in the CFTR, ß-globin and factor IX genes ease-causing mutations have been identified: (1) the cystic fibrosis (CF) transmembrane 1 Factor IX (1-bp SSM deletion in a run of two re­ conductance regulator (CFTR) gene, in which peats) 400 mutations have been identified [CF Ge­ 6382 CAGGTAAATTGGAAGAGTTT 6401 [22] netic Analysis Consortium, pers. commun.]; 2 ß-globin (1-bp SSM insertion in a run of three re­ (2) the ß globin gene, in which over 100 muta­ peats) tions cause ß thalassemia [19], and (3) the fac­ 73 GTTGTTGAGGCCCCTGGGCA 92 [19] tor IX gene, in which over 300 mutations cause hemophilia B [20]. 3 CFTR ( 1 -bp non-SSM deletion) 545 TACACCCAGCCATTTTTGGC 564 [23] 4 CFTR (2-bp SSM insertion in a run of two repeats) Materials and Methods 1141 TCACCACCATCTCTÇATTCT 1160 [24] Sequences flanking mutations in the coding region 5 CFTR (2-bp SSM deletion in a run of five repeats) of the CFTR, ß-globin and factor IX genes were ana­ 382 TAT GGAAT CTTTTT AT ATTT 401 lyzed. The information was obtained from previously [Clausters, pers. commun.] published reports [19, 20; CF Genetic Analysis Con­ sortium, pers. commun.]. The analyzed mutations 6 CFTR (4-bp SSM deletion in a run of two repeats) were located within published normal coding se­ 4003 4022 quences as reported in GenBank. [our unpubl. result] Classification of Mutations The numbers at the beginning and end of the Mutations that were neither insertions nor dele­ sequences represent the position of the first and last tions, and mutations in which the insertion or deletion nucleotide, respectively, in the row, as reported in was larger than 4 bp were classified as ‘other’ muta­ GenBank. tions. Classification as an SSM mutation was restricted to mutations of up to 4 bp since most length variation was found in repeat units of 1-4 bp [21]. Insertion or deletion mutations of 4 bp or less were classified as deriving from SSM if they met the following condi­ Table 2. Insertion and deletion mutations in the tions: (1) deletion of n (1-4) bp was considered SSM, if CFTR, factor IX and ß-globin genes and only if the adjacent n bases, from either side, were identical to the deleted bases; (2) insertion of n (1-4) Gene All Insertions SSMa bp was considered SSM if and only if the insertion was mutations and deletions adjacent to a tandem repeat of at least 2 repeats with the same sequence as the inserted bases, and (3) when CFTR 243 66 35 (0.53) the deletion or insertion was itself a repetitive unit (e.g. Factor IX 329 44 11 (0.39) TT, ACAC), only the repeat unit was compared with ß-globin 53 24 11 (0.46) the adjacent bases to classify the nature of the muta­ tion according to (1) and (2) (e.g. deletion of AA in a Total 625 134 63 (0.47) run of AAA would be considered SSM). All other mutations were classified as non-SSM. At a The value in parentheses is the proportion of inser­ each SSM mutation, the length of the repetitive run tion and deletion mutations classified as SSM. in the normal sequence was counted. For example: (1) deletion of the underlined nucleotides in the nor­ mal sequence ACACACAC was counted as a 2-bp deletion SSM mutation in a run of four repeats and (2)
Load more

Recommended publications
  • Identification and Characterization of a Novel 43-Bp Deletion Mutation of The
    Liu et al. BMC Medical Genetics (2018) 19:61 https://doi.org/10.1186/s12881-018-0567-z CASE REPORT Open Access Identification and characterization of a novel 43-bp deletion mutation of the ATP7B gene in a Chinese patient with Wilson’s disease: a case report Gang Liu†, Dingyuan Ma†, Jian Cheng, Jingjing Zhang, Chunyu Luo, Yun Sun, Ping Hu, Yuguo Wang, Tao Jiang* and Zhengfeng Xu* Abstract Background: Wilson’s disease (WD) is an autosomal recessive disorder characterized by copper accumulation. ATP7B gene mutations lead to ATP7B protein dysfunction, which in turn causes Wilson’s disease. Case presentation: We describe a male case of Wilson’s disease diagnosed at 10 years after routine biochemical test that showed low serum ceruloplasmin levels and Kayser–Fleischer rings in both corneas. Analysis of the ATP7B gene revealed compound heterozygous mutations in the proband, including the reported c.3517G > A mutation and a novel c.532_574del mutation. The c.532_574del mutation covered a 43-bp region in exon 2, and resulted in a frameshift mutation (p.Leu178PhefsX10). By base sequence analysis, two microhomologies (TCTCA) were observed on both deletion breakpoints in the ATP7B gene. Meanwhile, the presence of some sequence motifs associated with DNA breakage near the deletion region promoted DNA strand break. Conclusions: By comparison, a replication-based mechanism named fork stalling and template switching/ microhomology-mediated break-induced replication (FoSTeS/MMBIR) was used to explain the formation of this novel deletion mutation. Keywords: Wilson’s disease, ATP7B, Novel mutation, FoSTeS/MMBIR Background ATP7B protein dysfunction, which in turn causes accumu- Wilson’s disease (WD, OMIM #277900), an autosomal lation of copper in the liver, brain, kidneys and corneas, recessive disorder characterized by abnormal copper ac- with a wide range of clinical symptoms, including hepatic cumulation and related toxicities, is caused by mutations disorders, neuronal degeneration of the brain, and Kayser- in the ATP7B gene (OMIM *606882) [1].
    [Show full text]
  • Nf1 Gene Deletion
    NF1 GENE DELETION NF1 GENE DELETION This resource is for families who have a deletion of the NF1 gene causing neurofi bromatosis type 1 (NF1). This is also referred to as NF1 microdeletion. WHAT ARE CHROMOSOMES, DELETION GENES AND MUTATIONS? Chromosomes are the packages of our genetic information. Within each cell of the body are 46 chromosomes arranged in 23 pairs. One chromosome in each pair is inherited from the Source: U.S. National Library of Medicine mother and the other from the father. The pairs are numbered WHAT IS AN NF1 MICRODELETION? by size. The number 1 chromosome When the entire NF1 gene is missing, it is referred pair is the largest and the number 22 is to as NF1 gene deletion or NF1 microdeletion. the smallest. The last pair of chromosomes Approximately 5% of individuals with a diagnosis (sex chromosomes) help to determine whether of NF1 have a deletion that includes the entire NF1 an individual is a male or a female. Genes are gene. Other than the NF1 gene, there are usually small areas along the chromosomes, and are other nearby genes that are also missing. the body’s blueprints or instructions. We have approximately 20,000 genes that control how we WHAT DOES IT MEAN TO HAVE AN NF1 grow and develop and what we look like. Each MICRODELETION? gene can be thought of as a sentence made up of In addition to the NF1 gene, individuals with NF1 four letters (A, T, C and G). Mutations (also called microdeletion typically have other genes in the pathogenic variants), are changes in a gene’s region of chromosome 17 deleted.
    [Show full text]
  • DNA Insertion Mutations Can Be Predicted by a Periodic Probability
    Research article DNA insertion mutations can be predicted by a periodic probability function Tatsuaki Tsuruyama1 1Department of Pathology, Graduate School of Medicine, Kyoto University, Yoshida Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan Running title: Probability prediction of mutation Correspondence to: Tatsuaki Tsuruyama Kyoto University, Yoshida-Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan Tel.: +81-75-751-3488; Fax: +81-75-761-9591 E-mail: [email protected] 1 Abstract It is generally difficult to predict the positions of mutations in genomic DNA at the nucleotide level. Retroviral DNA insertion is one mode of mutation, resulting in host infections that are difficult to treat. This mutation process involves the integration of retroviral DNA into the host-infected cellular genomic DNA following the interaction between host DNA and a pre-integration complex consisting of retroviral DNA and integrase. Here, we report that retroviral insertion sites around a hotspot within the Zfp521 and N-myc genes can be predicted by a periodic function that is deduced using the diffraction lattice model. In conclusion, the mutagenesis process is described by a biophysical model for DNA–DNA interactions. Keywords: Insertion, mutagenesis, palindromic sequence, retroviral DNA 2 Text Introduction Extensive research has examined retroviral insertions to further our understanding of DNA mutations. Retrovirus-related diseases, including leukemia/lymphoma and AIDS, develop after retroviral genome insertion into the genomic DNA of the infected host cell. Retroviral DNA insertion is one of the modes of insertional mutation. After reverse-transcription of the retroviral genomic RNA into DNA, the retroviral DNA forms a pre-insertion complex (PIC) with the integrase enzyme, which catalyzes the insertion reaction.
    [Show full text]
  • Status of the P53, P16, RB1, and HER-2 Genes and Chromosomes 3
    367 ORIGINAL ARTICLE J Clin Pathol: first published as 10.1136/jcp.2004.021154 on 24 March 2005. Downloaded from Status of the p53, p16, RB1, and HER-2 genes and chromosomes 3, 7, 9, and 17 in advanced bladder cancer: correlation with adjacent mucosa and pathological parameters M Gallucci, F Guadagni, R Marzano, C Leonardo, R Merola, S Sentinelli, E M Ruggeri, R Cantiani, I Sperduti, F de la Iglesia Lopez, A M Cianciulli ............................................................................................................................... J Clin Pathol 2005;58:367–371. doi: 10.1136/jcp.2004.021154 Aims: To evaluate a panel of well known genetic alterations for frequency of changes in bladder cancer that could be considered genomic instability determinants or adjunctive prognostic predictors. Methods: Fluorescence in situ hybridisation analysis was performed to evaluate chromosomes 3, 7, 9, and 17 and the 9p21 (p16), 17p13.1 (p53), 13q14 (RB1), and 17q11.2 (HER-2) chromosomal loci in 48 See end of article for muscle invasive bladder cancer specimens and the adjacent normal mucosa. authors’ affiliations Results: There were significant differences between the frequency of chromosome 7 monosomy/polysomy ....................... and 17 monosomy in the two groups (tumours and adjacent mucosa) (p = 0.004, p = 0.037, and Correspondence to: p = 0.015, respectively). There were no differences in the frequency of gene deletions between tumours Dr A M Cianciulli, Clinical and the adjacent mucosa. 17q11.2 amplification was found in 14.5% of tumours examined, but not in the Pathology, Regina Elena non-malignant epithelium. Chromosome 3, 7, and 17 monosomy and the RB1 heterozygous deletion were Cancer Institute, IFO, Via Elio Chianesi, 53, 00144 significantly associated with stage T3–4 (p = 0.03, p = 0.04, p = 0.04, and p = 0.03, respectively).
    [Show full text]
  • DNA Sequence Insertion and Evolutionary Variation in Gene Regulation (Mobile Elements/Long Terminal Repeats/Alu Sequences/Factor-Binding Sites) Roy J
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 9374-9377, September 1996 Colloquium Paper This paper was presented at a colloquium entitled "Biology of Developmental Transcription Control, " organized by Eric H. Davidson, Roy J. Britten, and Gary Felsenfeld, held October 26-28, 1995, at the National Academy of Sciences in Irvine, CA. DNA sequence insertion and evolutionary variation in gene regulation (mobile elements/long terminal repeats/Alu sequences/factor-binding sites) RoY J. BRITrEN Division of Biology, California Institute of Technology, 101 Dahlia Avenue, Corona del Mar, CA 92625 ABSTRACT Current evidence on the long-term evolution- 3 and 4). Sequence change, obscuring the original structure, ary effect of insertion of sequence elements into gene regions has occurred in the long history, and the underlying rate of is reviewed, restricted to cases where a sequence derived from base substitution that is responsible is known (5). a past insertion participates in the regulation of expression of The requirements for a convincing example are: (i) that a useful gene. Ten such examples in eukaryotes demonstrate there be a trace of a known class of elements present in gene that segments of repetitive DNA or mobile elements have been region; (ii) that there is evidence that it has been there long inserted in the past in gene regions, have been preserved, enough to not just be a transient mutation; (iii) that some sometimes modified by selection, and now affect control of sequence residue of the mobile element or repeat participates transcription ofthe adjacent gene. Included are only examples in regulation of expression of the gene; (iv) that the gene have in which transcription control was modified by the insert.
    [Show full text]
  • Insertion Element (IS1 Insertion Sequence/Chloramphenicol Resistance Transposon Tn9/Integrative Recombination) L
    Proc. Nati. Acad. Sci. USA Vol. 75, No. 3, pp. 1490-1494, March 1978 Genetics Chromosomal integration of phage X by means of a DNA insertion element (IS1 insertion sequence/chloramphenicol resistance transposon Tn9/integrative recombination) L. A. MACHATTIE AND J. A. SHAPIRO Department of Microbiology, University of Chicago, Chicago, Illinois 60637 Communicated by Albert Dorfman, January 10, 1978 ABSTRACT Phage Xcamll2, which contains the chlor- carries a deletion of the gal-attB-bio region of the Escherichia amphenicol resistance transposon Tn9 and has a deletion of attP coil chromosome. MGBO is a gal+bio+ transductant of and the int gene, will lysogenize Escherichia coli K-12. Pro- phage integration occurs at different chromosomal sites, in- MADO. MS6 is a galE indicator for detection of XgalE + T- cluding lacYand maiB, but not at attB. All Xcamll2 prophages transducing particles and S1653 is a gal deletion strain for de- are excised from the chromosome after induction but with tection of Xgal + particles (3). Strain 200PS is a thi lacY strain various efficiencies for different locations. Heteroduplex from the Pasteur collection. Strain QL carries a complete lac analysis of XplacZ transducing phages isolated from a lacY:: deletion, strain X9003 carries the nonpolar M15 lacZ deletion, Xcamll2 prophage reveals an insertion sequence 1 (IS1) element and either will serve as indicator for XplacZ phage in a blue at theloint of viral and chromosomal DNA. Two lines of evi- dencekdicate that Xcamll2 encodes an excision activity that plaque assay (8). recognizes the ISI element: (i) prophage derepression increases Media. Our basic minimal medium and complete TYE the frequency of excision from IacYto yield lac+ revertants, and medium have been described (9).
    [Show full text]
  • Gene Therapy Glossary of Terms
    GENE THERAPY GLOSSARY OF TERMS A • Phase 3: A phase of research to describe clinical trials • Allele: one of two or more alternative forms of a gene that that gather more information about a drug’s safety and arise by mutation and are found at the same place on a effectiveness by studying different populations and chromosome. different dosages and by using the drug in combination • Adeno-Associated Virus: A single stranded DNA virus that has with other drugs. These studies typically involve more not been found to cause disease in humans. This type of virus participants.7 is the most frequently used in gene therapy.1 • Phase 4: A phase of research to describe clinical trials • Adenovirus: A member of a family of viruses that can cause occurring after FDA has approved a drug for marketing. infections in the respiratory tract, eye, and gastrointestinal They include post market requirement and commitment tract. studies that are required of or agreed to by the study • Adeno-Associated Virus Vector: Adeno viruses used as sponsor. These trials gather additional information about a vehicles for genes, whose core genetic material has been drug’s safety, efficacy, or optimal use.8 removed and replaced by the FVIII- or FIX-gene • Codon: a sequence of three nucleotides in DNA or RNA • Amino Acids: building block of a protein that gives instructions to add a specific amino acid to an • Antibody: a protein produced by immune cells called B-cells elongating protein in response to a foreign molecule; acts by binding to the • CRISPR: a family of DNA sequences that can be cleaved by molecule and often making it inactive or targeting it for specific enzymes, and therefore serve as a guide to cut out destruction and insert genes.
    [Show full text]
  • Koolen-De Vries Syndrome: Clinical Report of an Adult and Literature Review
    Case Report Cytogenet Genome Res 2016;150:40–45 Accepted: July 25, 2016 DOI: 10.1159/000452724 by M. Schmid Published online: November 17, 2016 Koolen-de Vries Syndrome: Clinical Report of an Adult and Literature Review Claudia Ciaccio Chiara Dordoni Marco Ritelli Marina Colombi Division of Biology and Genetics, Department of Molecular and Translational Medicine, School of Medicine, University of Brescia, Brescia , Italy Key Words Koolen-de Vries syndrome (KdS, also known as 17q21.31 · Deletion · Joint hypermobility · KANSL1 17q21.31 microdeletion syndrome, OMIM #610443) is a rare genetic disorder (prevalence 1/16,000) characterized by typical facial dysmorphisms, cardiac and renal defects, Abstract developmental delay, and intellectual disability of vari- Koolen-de Vries syndrome (KdS) is a rare genetic condition able level [Tan et al., 2009]. The disorder was initially de- characterized by typical facial dysmorphisms, cardiac and re- scribed as a form of mental retardation caused by a 440– nal defects, skeletal anomalies, developmental delay, and in- 680-kb deletion in the 17q21.31 region, typically encom- tellectual disability of variable level. It is caused by a 440– passing 5 genes: CRHR1 (OMIM 122561), MAPT 680-kb deletion in the 17q21.31 region, encompassing (OMIM 157140), IMP5 (OMIM 608284), STH (OMIM CRHR1 , MAPT , IMP5 , STH , and KANSL1 , or by an intragenic 607067), and KANSL1 (OMIM 612452)* [Koolen et al., KANSL1 mutation. The majority of the patients reported are 2006]. Recently,* it has been shown* that haploinsufficien- pediatric or young adults, and long-term studies able to de- cy* of KANSL1 by itself, due to single* nucleotide variants fine the prognosis of the disease are lacking.
    [Show full text]
  • Trisomy 5P Inverted Duplication & Deletion of 5Pftnwdraft3
    Trisomy 5p: Inverted duplication and deletion of 5p rarechromo.org Inverted duplication with deletion of 5p Inverted duplication with deletion of 5p, known as inv dup del 5p, is a very rare genetic condition in which there is an extra copy of part of the genetic material (DNA) that makes up the body’s 46 chromosomes, and a missing copy of another part. Like most other chromosome disorders, this usually affects development, and sometimes health and behaviour as well. It is likely that both the extra and missing parts of chromosome 5p have an effect, but a lot depends on their position and size. The precise effects of gaining material from a chromosome vary depending on how large the duplication is, how many genes it contains and what those genes do. The same applies to deletions. The effects may not be limited to the genes within the duplicated or deleted piece of chromosome because these genes may interact with other genes on the same chromosome or other chromosomes. Chromosomes usually come in pairs, and we inherit one chromosome from each parent. Of the 46 chromosomes, two are a pair of sex chromosomes: two Xs for a girl and an X and a Y for a boy. The remaining 44 chromosomes are grouped into 22 pairs and are numbered 1 to 22, approximately from largest to smallest. Each chromosome has a short (p) arm (from petit, the French for small) and a long (q) arm. The diagram below shows the short arm. Chromosome 5 Short (p) arm Bands Base pairs 0Mb 5Mb 10Mb 15Mb 20Mb 25Mb 30Mb 35Mb 40Mb 45Mb 48.4Mb Long (q) arm 2 People have 2 copies of chromosome 5 in most of their body cells.
    [Show full text]
  • Early Fetal Presentation of Koolen-De Vries: Case Report with Literature Review
    European Journal of Medical Genetics xxx (2017) 1e5 Contents lists available at ScienceDirect European Journal of Medical Genetics journal homepage: http://www.elsevier.com/locate/ejmg Early fetal presentation of Koolen-de Vries: Case report with literature review abstract Keywords: Koolen-de Vries syndrome (MIM#610443) is a rare microdeletion syndrome involving the 17q21.31 Koolen-de Vries syndrome region, which was first described by Koolen in 2006. Clinical and behavioral characteristics have been 17q21.31 deletion extensively reported from more than 100 postnatal cases including infants, children and young adults. Prenatal array-CGH The syndrome is highly clinically heterogeneous, but the main features associate characteristic cranio- Neuropathology facial dysmorphism, heart defects, limb, skeletal, genito-urinary anomalies, along with intellectual Cytogenetics Mega corpus callosum disability with early childhood epilepsy and behavioral disturbances. Central nervous system malfor- mations usually consist in hydrocephalus and thin corpus callosum. We report herein an early fetal case with an apparently isolated abnormal corpus callosum diagnosed by ultrasonography, for which a medical termination of the pregnancy was achieved at 22 weeks of gestation. Postmortem examination displayed facial dysmorphism consisting of hypertelorism, short philtrum and flat and broad nose, cleft palate and left duplex ureter. Neuropathological examination revealed a mega corpus callosum that has never been reported so far in this syndrome. Array-CGH performed
    [Show full text]
  • The Deletion Stocks of Common Wheat
    The Deletion Stocks of Common Wheat T. R. Endo and B. S. Gill Chromosomal breaks occurred in the progeny of a common wheat (Tritlcum aes- tlvum L. em Thell; 2n = 6x = 42, genome formula AABBDD) cultivar Chinese Spring with a monosomic addition of an alien chromosome from Aegllops cyllndrlca Host (2n = 4x = 28, CCDD) or A. trlunclalls L. (2n = 4x = 28, UUCC) or a chromosomal segment from A. spettoldes Tausch (2n = 2x = 14, SS). We identified 436 deletions by C-banding. The deletion chromosomes were transmitted stably to the offspring. We selected deletion homozygotes in the progeny of the deletion heterozygotes and established homozygous lines for about 80% of the deletions. We failed to establish homozygous lines for most of the deletions In the short arm of chromo- some 2A and for all deletions in the short arm of chromosome 4B, because plants homozygous for these deletions were sterile. We could not obtain any homozygotes for larger deletions In the long arms of chromosomes 4A, 5A, 5B, and 5D. The deletion stocks showed variations in morphological, physiological, and biochemi- cal traits, depending on the size of their chromosomal deficiency, and are powerful tools for physical mapping of wheat chromosomes. The aneuploid stocks developed in a com- and a chromosome fragment from A. spel- mon wheat cultivar Chinese Spring are a toides were found recently to induce chro- powerful tool for genetic and breeding mosome mutations in Chinese Spring in studies of wheat (Sears 1954, 1966; Sears the same manner as the A. cylindrica chro- and Sears 1978). These stocks are im- mosome (Endo, unpublished data).
    [Show full text]
  • A Rare and Unusual Case of Trisomy 10P with Terminal 14Q Deletion: a Multidisciplinary Approach
    Open Access Case Report DOI: 10.7759/cureus.15459 A Rare and Unusual Case of Trisomy 10p with Terminal 14q Deletion: A Multidisciplinary Approach Chanan Goyal 1, 2 , Vivek Goyal 3 , Waqar M. Naqvi 1 1. Community Physiotherapy, Datta Meghe Institute of Medical Sciences, Wardha, IND 2. Paediatric Physiotherapy, Government Physiotherapy College, Raipur, IND 3. Anaesthesiology, Shri Balaji Institute of Medical Science, Raipur, IND Corresponding author: Chanan Goyal, [email protected] Abstract Trisomy 10p is a rare entity to be diagnosed and so is terminal 14q deletion. The total number of trisomy 10p cases reported to date is estimated to be in double digits. The number of terminal 14q deletion cases that have been reported in the literature is even lesser than that of trisomy 10p. Simultaneous occurrence of these genetic aberrations is, therefore, extremely rare. Herein, we document a case of a 14-month-old female diagnosed with trisomy 10p and terminal 14q deletion, who presented with an inability to sit without support and had difficulty in holding her neck. She had no means of independent indoor mobility, which was further limiting her development by exploration. Clinical features included hypotonia, developmental delay, extraneous movements of the head and tongue, intellectual impairment, and facial dysmorphism. She could maintain tripod sitting for less than a minute. Physiotherapy intervention was based on principles of neurodevelopmental treatment and sensory integration. After nine months of physiotherapy intervention, her total gross motor function measure (GMFM) score improved from 11% to 40%. The functional gains were maintained with a home exercise program, after almost one year of discontinuation of institution-based physiotherapy.
    [Show full text]