Supplementary Material

Supplementary Material

Supplementary Material ASSESSMENT OF FULL-SCALE TERTIARY WASTEWATER TREATMENT BY AOPs: REMOVAL OR PERSISTENCE OF ANTIBIOTICS AND ANTIBIOTIC RESISTANCE GENES? Jorge RODRÍGUEZ-CHUECA1,2, Saulo VARELA DELLA GIUSTINA3, Jaqueline ROCHA4, Telma FERNANDES4, Cristina PABLOS1, Ángel ENCINAS5, Damià BARCELÓ3,6, Sara RODRÍGUEZ-MOZAZ3, Célia M. MANAIA4, Javier MARUGÁN1* (1) Department of Chemical and Environmental Technology (ESCET), Universidad Rey Juan Carlos, C/ Tulipán s/n, 28933 Móstoles, Madrid, Spain (2) Department of Chemical and Environmental Engineering, Escuela Técnica Superior de Ingenieros Industriales, Universidad Politécnica de Madrid, C/ José Gutiérrez Abascal 2, 28006, Madrid, Spain. (3) Catalan Institute for Water Research (ICRA), H2O Building, Scientific and Technological Park of the University of Girona, 17003 Girona, Spain (4) Universidade Católica Portuguesa, CBQF - Centro de Biotecnologia e Química Fina – Laboratório Associado, Escola Superior de Biotecnologia, Rua Arquiteto Lobão Vital, 172, 4200-374 Porto, Portugal (5) Department of Innovation & Technology, FCC Aqualia, S.A., C/ Montesinos 28, 06002, Badajoz, Spain. (6) Environmental Chemistry Department, IDAEA–CSIC, Jordi Girona 18-26, E- 08034 Barcelona, Spain *Author to whom correspondence should be addressed: Tel: +34 916 64 7466 [email protected] 1 Table S1. Experimental design matrix. 3 Treatment UV-C [PMS] mM [H2O2] mM [Fe(II)] mM Flow rate (m /h) ON 28 UV-C ON 114 ON 0.2 28 H2O2/UV-C ON 0.5 75 ON 0.5 114 ON 0.2 28 PMS/UV-C ON 0.5 75 ON 0.5 114 ON 0.2 0.2 28 PMS/Fe(II)/UV-C ON 0.5 0.5 75 ON 0.5 0.5 114 2 Table S2. Antibiotics analysed, classified by their chemical group. Chemical Chemical group Compounds Compounds group Ofloxacin Azithromycin Ciprofloxacin Clarithromycin Enrofloxacin Roxithromycin Macrolides Danofloxacin Tylosin Fluoroquinolones Norfloxacin Tilmicosin Orbifloxacin Spiramycin Marbofloxacin Nitroimidazole Metronidazole Cinoxacin antibiotics Metronidazole-OH Flumequine Clindamycin Lincosamides Oxolinic acid Lincomycin Quinolones Dihydrofolate Nalidixic acid reductase Trimethoprim Pipemidic acid inhibitors Amoxicillin Sulfamethoxazole Ampicillin Sulfadiazine Penicillins Penicillin G Sulfisomidin Penicillin V Sulfathiazole Oxacillin Sulfadimethoxine Cefalexin Sulfapyridine Cefazolin Sulfamerazine Cephalosporins Cefotaxime Sulfonamides Sulfamethizole Cefuroxime Sulfamethoxypiridazine Ceftiofur Sulfisoxazole Cefapirin Sulfanitran Tetracycline Sulfabenzamide Chlortetracyline N-acetylsulfadiazine Tetracyclines Doxycycline N-acetylsulfamethazine Oxytetracycline N-acetylsulfamerazine 3 Table S3 - Conditions used in qPCR assays Target qPCR Limit of quantification Primers Primers sequence Conditions Primers reference gene Standard (no. of copies) E.coli 95 °C for 10 min (1 cycle); 95 °C 16S rRNA 1114F CGGCAACGAGCGCAACCC ATCC for 15s, 55 °C for 20 s and 72 °C for 330 Denman et al. 2006 gene 25922 1275R CCATTGTAGCACGTGTGTAGCC 10 s (35 cycles) Other: 1a Clone blaTEM-F TTCCTGTTTTTGCTCACCCAG 95ºC 10 min (1 cycle), 95ºC 15 s – bla bla 54 Bibbal et al., 2007 TEM TEM 60ºC 1 min (40 cycles) Other: 2a (pNORM) blaTEM-R CTCAAGGATCTTACCGCTGTTG E. coli OXA1B14_fw CACTTACAGGAAACTTGGGGTCG 95ºC 10 min (1 cycle), 95ºC 15 s - Ahammad et al., blaOXA-A 64 A2FC14 blaOXA1_rv AGTGTGTTTAGAATGGTGATC 60ºC 1 min (40 cycles) Other: 2d 2014 clone sul1 sul1-FW CGCACCGGAAACATCGCTGCAC 95ºC 5 min (1 cycle), 95ºC 15 s - sul1 135 Marti et al., 2014 (pNORM) sul1-RV TGAAGTTCCGCCGCAAGGCTCG 60ºC 30 s (35 cycles) Other: 3b Clone sul2-FW TCCGGTGGAGGCCGGTATCTGG 95ºC 5 min (1 cycle), 95ºC 15 s - sul2 47 Pei et al., 2006 sul2 sul2-RV CGGGAATGCCATCTGCCTTGAG 60ºC 1 min (40 cycles) Other: 1a clone qnrS qnrSrtF11 GACGTGCTAACTTGCGTGAT 95ºC 5 min (1 cycle), 95ºC 15 s - qnrS 10 Martí et al., 2013 (pNORM) qnrSrtR11 TGGCATTGTTGGAAACTTG 60ºC 1 min (40 cycles) Other: 2d clone intI1 95ºC 10 min (1 cycle), 95ºC 15 s - intI1 intI1-LC1 GCCTTGATGTTACCCGAGAG 54 Barraud et al., 2010 (pNORM) 60ºC 1 min (40 cycles) Other: 2a 1) KAPA SYBR® FAST ABI Prism® qPCR Master Mix; 2) SYBR® Select Master Mix; 3) Fast SYBRTM Green Master Mix; a) 200 nM of primer; b) 300nM; c) 400 nM of primer; d) 600 nM of primer. 4 References Ahammad, Z.S., Sreekrishnan, T.R., Hands, C.L., Knapp, C.W., Graham, D.W., 2014. Increased waterborne blaNDM-1 resistance gene abundances associated with seasonal human pilgrimages to the Upper Ganges River. Environ. Sci. Technol. 48, 3014–3020. Barraud, O., Baclet, M.C., Denis, F., Ploy, M.C., 2010. Quantitative multiplex real- time PCR for detecting class 1, 2 and 3 integrons. J. Antimicrob. Chemother. 65, 1642–1645. Bibbal, D., Dupouy, V., Ferré, J.P., Toutain, P.L., Fayet, O., Prère, M.F., Bousquet- Mélou, A., 2007. Impact of three ampicillin dosage regimens on selection of ampicillin resistance in Enterobacteriaceae and excretion of blaTEM genes in swine feces. Appl. Environ. Microbiol. 73, 4785–4790. Denman, S.E., McSweeney, C.S., 2006. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 58, 572–82. Marti, E., Variatza, E., Balcazar, J.L., 2014. Bacteriophages as a reservoir of extended-spectrum beta-lactamase and fluoroquinolone resistance genes in the environment. Clin. Microbiol. Infect. 20, O456–O459. Marti, E., Balcázar, J.L., 2013. Real-time PCR assays for quantification of qnr genes in environmental water samples and chicken feces. Appl. Environ. Microbiol. 79, 1743–1745. Pei, R., Kim, S.C., Carlson, K.H., Pruden, A., 2006. Effect of river landscape on the sediment concentrations of antibiotics and corresponding antibiotic resistance genes (ARG). Water Res. 40, 2427–2435. 5 .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    5 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us