CASE STUDY 179 been developed. An example is GenBank­ or others with similar sequences have sequences. Scroll below the table to (http://www.ncbi.nlm.nih.gov/genbank/), been discovered. Enter this sequence see the aligned sequences from this which is the National Institutes of Health into the “Enter Query Sequence” text search, and then answer the following database of all publicly available sequence box at the top of the page. Near the questions: data. This global resource, with access to bottom of the page, under the “Pro- a. What were the top three matches databases in Europe and Japan, currently gram Selection” category, choose to your query sequence? contains more than 220 billion base pairs “blastn”; then click on the “BLAST” of sequence data! button at the bottom of the page to b. For each alignment, BLAST also Earlier (in the Exploring Genomics run the search. It may take several min- indicates the percent identity and exercises for Chapter 7), you were intro- utes for results to be available because the number of gaps in the match duced to the National Center for Biotech- BLAST is using powerful algorithms between the query and subject nology Information (NCBI) Genes and to scroll through billions of bases of sequences. What was the percent Disease site. Now we will use an NCBI sequence data! A new page will appear identity for the top three matches? application called BLAST, Basic Local with the results of your search. What percentage of each aligned Alignment Search Tool. BLAST is an 4. On the search results page, below the sequence showed gaps indicating invaluable program for searching through Graphic Summary you will see a cat- sequence differences? GenBank and other databases to find egory called Descriptions and a table DNA- and protein-sequence similarities c. Click on the links for the first showing significant matches to the between cloned substances. It has many matched sequence (far-right col- sequence you searched with (called additional functions that we will explore umn). These will take you to a the query sequence). BLAST deter- in other exercises. wealth of information, including the mines significant matches based on size of the sequence; the species it Exercise I – Introduction to BLAST statistical measures that consider the was derived from; a PubMed-linked length of the query sequence, the num- 1. Access BLAST from the NCBI Web chronology of research publica- ber of matches with sequences in the site at http://blast.ncbi.nlm.nih.gov/ tions pertaining to this sequence; database, and other factors. Significant Blast.cgi. the complete sequence; and if the alignments, regions of significant similar- sequence encodes a polypeptide, 2. Click on “nucleotide blast.” This ity in the query and subject sequences, the predicted amino acid sequence feature allows you to search DNA typically have E values less than 1.0. coded by the gene. Skim through databases to look for a similarity 5. The top part of the table lists matches the information presented for this between a sequence you enter and to transcripts (mRNA sequences), gene. What is the gene’s function? other sequences in the database. Do and the lower part lists matches to a nucleotide search with the following 7. A BLAST search can also be done genomic DNA sequences, in order of sequence: by entering the accession number for a highest to lowest number of matches. sequence, which is a unique identify- CCAGAGTCCAGCTGCTGCTCATA 6. Alignments are indicated by hori- ing number assigned to a sequence CTACTGATACTGCTGGG zontal lines. BLAST adjusts for gaps before it can be put into a database. 3. Imagine that this sequence is a short in the sequences, that is, for areas For example, search with the accession part of a gene you cloned in your labo- that may not align precisely because number NM_007305. What did you ratory. You want to know if this gene of missing bases in otherwise similar find? CASE STUDY Credit where credit is due n the early 1950s, it became clear to many researchers that DNA 1. What vital clues were provided by Franklin’s work to Watson was the cellular molecule that carries genetic information. How- and Crick about the molecular structure of DNA? Iever, an understanding of the genetic properties of DNA could 2. Was it ethical for Wilkins to show Franklin’s unpublished photo only be achieved through a detailed knowledge of its structure. to Watson and Crick without her consent? Would it have been To this end, several laboratories began a highly competitive race more ethical for Watson and Crick to have offered ­Franklin to discover the three-dimensional structure of DNA, which ended ­co-authorship on this paper? when Watson and Crick published their now classic paper in 1953. 3. Given that these studies were conducted in the 1950s, Their model was based, in part, on an X-ray diffraction photograph how might gender have played a role in the fact that of DNA taken by Rosalind Franklin (Figure 9.10). Two ethical issues ­Rosalind ­Franklin did not receive due credit for her X-ray surround this photo. First, the photo was given to Watson and Crick diffraction work? by ­Franklin’s co-worker, Maurice Wilkins, without her knowledge or consent. Second, in their paper, Watson and Crick did not credit See the Understanding Science: How Science Really Works Web Franklin’s contribution. The fallout from these lapses lasted for site: “Credit and debt”(http://undsci.berkeley.edu/article/0_0_0/ decades and raises some basic questions about ethics in science. dna_13). M09_KLUG8414_10_SE_C09.indd 179 16/11/18 5:13 pm 180 9 DNA STRUCTURE AND ANALYSIS INSIGHTS AND SOLUTIONS This chapter recounts some of the initial experimental analyses Solution: First, transformed cells pass the trait on to their that launched the era of molecular genetics. Quite fittingly, then, progeny cells, thus supporting the conclusion that DNA is our “Insights and Solutions” section shifts its emphasis from prob- responsible for heredity, not for the direct production of lem solving to experimental rationale and analytical thinking. polysaccharide coats. Second, subsequent transformation studies over the next five years showed that other traits, such 1. Based strictly on the transformation analysis of Avery, as antibiotic resistance, could be transformed. Therefore, MacLeod, and McCarty, what objection might be made to the the transforming factor has a broad general effect, not one conclusion that DNA is the genetic material? What other con- specific to polysaccharide synthesis. clusion might be considered? 3. If RNA were the universal genetic material, how would this Solution: Based solely on their results, we could conclude have affected the Avery experiment and the Hershey–Chase that DNA is essential for transformation. However, DNA experiment? might have been a substance that caused capsular formation by converting nonencapsulated cells directly to cells with a Solution: In the Avery experiment, ribonuclease (RNase), capsule. That is, DNA may simply have played a catalytic role rather than deoxyribonuclease (DNase), would have elimi- in capsular synthesis, leading to cells that display smooth, nated transformation. Had this occurred, Avery and his col- type III colonies. leagues would have concluded that RNA was the transforming factor. Hershey and Chase would have obtained identical 2. What observations argue against this objection? results, since 32P would also label RNA but not protein. Mastering Genetics Visit for Problems and Discussion Questions instructor-assigned tutorials and problems. 1. HOW DO WE KNOW? In this chapter, we have focused on DNA, 7. Does the design of the Hershey–Chase experiment distinguish the molecule that stores genetic information in all living things. between DNA and RNA as the molecule serving as the genetic In particular, we discussed its structure and delved into how we material? Why or why not? analyze this molecule. Based on your knowledge of these topics, 8. What observations are consistent with the conclusion that answer several fundamental questions: DNA serves as the genetic material in eukaryotes? List and (a) How were we able to determine that DNA, and not some discuss them. other molecule, serves as the genetic material in bacteria, 9. What are the exceptions to the general rule that DNA is the bacteriophages, and eukaryotes? genetic material in all organisms? What evidence supports these (b) How do we know that the structure of DNA is in the form of exceptions? a right-handed double-helical molecule? 10. Draw the chemical structure of the three components of a nucleo- (c) How do we know that in DNA G pairs with C and that A tide, and then link them together. What atoms are removed from pairs with T as complementary strands are formed? the structures when the linkages are formed? 11. How are the carbon and nitrogen atoms of the sugars, purines, and pyrimidines numbered? 2. CONCEPTS QUESTION Review the Chapter Concepts list on 12. Adenine may also be named 6-amino purine. How would you p. 161. Most center on DNA and RNA and their role of serving name the other four nitrogenous bases, using this alternative as the genetic material. Write a short essay that contrasts these system? (O is oxy, and CH3 is methyl.) molecules, including a comparison of advantages conferred by 13. Draw the chemical structure of a dinucleotide composed of A and their structure that each of them has over the other in serving G. Opposite this structure, draw the dinucleotide composed of in this role. T and C in an antiparallel (or upside-down) fashion. Form the 3. Discuss the reasons why proteins were generally favored over possible hydrogen bonds. DNA as the genetic material before 1940. What was the role of 14. Describe the various characteristics of the Watson–Crick double the tetranucleotide hypothesis in this controversy? helix model for DNA.