DOCSLIB.ORG

202103031643031075.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
202103031643031075.Pdf CASE STUDY 179 been developed. An example is GenBank­ or others with similar sequences have sequences. Scroll below the table to (http://www.ncbi.nlm.nih.gov/genbank/), been discovered. Enter this sequence see the aligned sequences from this which is the National Institutes of Health into the “Enter Query Sequence” text search, and then answer the following database of all publicly available sequence box at the top of the page. Near the questions: data. This global resource, with access to bottom of the page, under the “Pro- a. What were the top three matches databases in Europe and Japan, currently gram Selection” category, choose to your query sequence? contains more than 220 billion base pairs “blastn”; then click on the “BLAST” of sequence data! button at the bottom of the page to b. For each alignment, BLAST also Earlier (in the Exploring Genomics run the search. It may take several min- indicates the percent identity and exercises for Chapter 7), you were intro- utes for results to be available because the number of gaps in the match duced to the National Center for Biotech- BLAST is using powerful algorithms between the query and subject nology Information (NCBI) Genes and to scroll through billions of bases of sequences. What was the percent Disease site. Now we will use an NCBI sequence data! A new page will appear identity for the top three matches? application called BLAST, Basic Local with the results of your search. What percentage of each aligned Alignment Search Tool. BLAST is an 4. On the search results page, below the sequence showed gaps indicating invaluable program for searching through Graphic Summary you will see a cat- sequence differences? GenBank and other databases to find egory called Descriptions and a table DNA- and protein-sequence similarities c. Click on the links for the first showing significant matches to the between cloned substances. It has many matched sequence (far-right col- sequence you searched with (called additional functions that we will explore umn). These will take you to a the query sequence). BLAST deter- in other exercises. wealth of information, including the mines significant matches based on size of the sequence; the species it Exercise I – Introduction to BLAST statistical measures that consider the was derived from; a PubMed-linked length of the query sequence, the num- 1. Access BLAST from the NCBI Web chronology of research publica- ber of matches with sequences in the site at http://blast.ncbi.nlm.nih.gov/ tions pertaining to this sequence; database, and other factors. Significant Blast.cgi. the complete sequence; and if the alignments, regions of significant similar- sequence encodes a polypeptide, 2. Click on “nucleotide blast.” This ity in the query and subject sequences, the predicted amino acid sequence feature allows you to search DNA typically have E values less than 1.0. coded by the gene. Skim through databases to look for a similarity 5. The top part of the table lists matches the information presented for this between a sequence you enter and to transcripts (mRNA sequences), gene. What is the gene’s function? other sequences in the database. Do and the lower part lists matches to a nucleotide search with the following 7. A BLAST search can also be done genomic DNA sequences, in order of sequence: by entering the accession number for a highest to lowest number of matches. sequence, which is a unique identify- CCAGAGTCCAGCTGCTGCTCATA 6. Alignments are indicated by hori- ing number assigned to a sequence CTACTGATACTGCTGGG zontal lines. BLAST adjusts for gaps before it can be put into a database. 3. Imagine that this sequence is a short in the sequences, that is, for areas For example, search with the accession part of a gene you cloned in your labo- that may not align precisely because number NM_007305. What did you ratory. You want to know if this gene of missing bases in otherwise similar find? CASE STUDY Credit where credit is due n the early 1950s, it became clear to many researchers that DNA 1. What vital clues were provided by Franklin’s work to Watson was the cellular molecule that carries genetic information. How- and Crick about the molecular structure of DNA? Iever, an understanding of the genetic properties of DNA could 2. Was it ethical for Wilkins to show Franklin’s unpublished photo only be achieved through a detailed knowledge of its structure. to Watson and Crick without her consent? Would it have been To this end, several laboratories began a highly competitive race more ethical for Watson and Crick to have offered ­Franklin to discover the three-dimensional structure of DNA, which ended ­co-authorship on this paper? when Watson and Crick published their now classic paper in 1953. 3. Given that these studies were conducted in the 1950s, Their model was based, in part, on an X-ray diffraction photograph how might gender have played a role in the fact that of DNA taken by Rosalind Franklin (Figure 9.10). Two ethical issues ­Rosalind ­Franklin did not receive due credit for her X-ray surround this photo. First, the photo was given to Watson and Crick diffraction work? by ­Franklin’s co-worker, Maurice Wilkins, without her knowledge or consent. Second, in their paper, Watson and Crick did not credit See the Understanding Science: How Science Really Works Web Franklin’s contribution. The fallout from these lapses lasted for site: “Credit and debt”(http://undsci.berkeley.edu/article/0_0_0/ decades and raises some basic questions about ethics in science. dna_13). M09_KLUG8414_10_SE_C09.indd 179 16/11/18 5:13 pm 180 9 DNA STRUCTURE AND ANALYSIS INSIGHTS AND SOLUTIONS This chapter recounts some of the initial experimental analyses Solution: First, transformed cells pass the trait on to their that launched the era of molecular genetics. Quite fittingly, then, progeny cells, thus supporting the conclusion that DNA is our “Insights and Solutions” section shifts its emphasis from prob- responsible for heredity, not for the direct production of lem solving to experimental rationale and analytical thinking. polysaccharide coats. Second, subsequent transformation studies over the next five years showed that other traits, such 1. Based strictly on the transformation analysis of Avery, as antibiotic resistance, could be transformed. Therefore, MacLeod, and McCarty, what objection might be made to the the transforming factor has a broad general effect, not one conclusion that DNA is the genetic material? What other con- specific to polysaccharide synthesis. clusion might be considered? 3. If RNA were the universal genetic material, how would this Solution: Based solely on their results, we could conclude have affected the Avery experiment and the Hershey–Chase that DNA is essential for transformation. However, DNA experiment? might have been a substance that caused capsular formation by converting nonencapsulated cells directly to cells with a Solution: In the Avery experiment, ribonuclease (RNase), capsule. That is, DNA may simply have played a catalytic role rather than deoxyribonuclease (DNase), would have elimi- in capsular synthesis, leading to cells that display smooth, nated transformation. Had this occurred, Avery and his col- type III colonies. leagues would have concluded that RNA was the transforming factor. Hershey and Chase would have obtained identical 2. What observations argue against this objection? results, since 32P would also label RNA but not protein. Mastering Genetics Visit for Problems and Discussion Questions instructor-assigned tutorials and problems. 1. HOW DO WE KNOW? In this chapter, we have focused on DNA, 7. Does the design of the Hershey–Chase experiment distinguish the molecule that stores genetic information in all living things. between DNA and RNA as the molecule serving as the genetic In particular, we discussed its structure and delved into how we material? Why or why not? analyze this molecule. Based on your knowledge of these topics, 8. What observations are consistent with the conclusion that answer several fundamental questions: DNA serves as the genetic material in eukaryotes? List and (a) How were we able to determine that DNA, and not some discuss them. other molecule, serves as the genetic material in bacteria, 9. What are the exceptions to the general rule that DNA is the bacteriophages, and eukaryotes? genetic material in all organisms? What evidence supports these (b) How do we know that the structure of DNA is in the form of exceptions? a right-handed double-helical molecule? 10. Draw the chemical structure of the three components of a nucleo- (c) How do we know that in DNA G pairs with C and that A tide, and then link them together. What atoms are removed from pairs with T as complementary strands are formed? the structures when the linkages are formed? 11. How are the carbon and nitrogen atoms of the sugars, purines, and pyrimidines numbered? 2. CONCEPTS QUESTION Review the Chapter Concepts list on 12. Adenine may also be named 6-amino purine. How would you p. 161. Most center on DNA and RNA and their role of serving name the other four nitrogenous bases, using this alternative as the genetic material. Write a short essay that contrasts these system? (O is oxy, and CH3 is methyl.) molecules, including a comparison of advantages conferred by 13. Draw the chemical structure of a dinucleotide composed of A and their structure that each of them has over the other in serving G. Opposite this structure, draw the dinucleotide composed of in this role. T and C in an antiparallel (or upside-down) fashion. Form the 3. Discuss the reasons why proteins were generally favored over possible hydrogen bonds. DNA as the genetic material before 1940. What was the role of 14. Describe the various characteristics of the Watson–Crick double the tetranucleotide hypothesis in this controversy? helix model for DNA.
Load more

Recommended publications
  • Attachment 1
    Appendix 1 Chemico-Biological Interactions 301 (2019) 2–5 Contents lists available at ScienceDirect Chemico-Biological Interactions journal homepage: www.elsevier.com/locate/chembioint An examination of the linear no-threshold hypothesis of cancer risk T assessment: Introduction to a series of reviews documenting the lack of biological plausibility of LNT R. Goldena,*, J. Busb, E. Calabresec a ToxLogic, Gaithersburg, MD, USA b Exponent, Midland, MI, USA c University of Massachusetts, Amherst, MA, USA The linear no-threshold (LNT) single-hit dose response model for evolution and the prominence of co-author Gilbert Lewis, who would be mutagenicity and carcinogenicity has dominated the field of regulatory nominated for the Nobel Prize some 42 times, this idea generated much risk assessment of carcinogenic agents since 1956 for radiation [8] and heat but little light. This hypothesis was soon found to be unable to 1977 for chemicals [11]. The fundamental biological assumptions upon account for spontaneous mutation rates, underestimating such events which the LNT model relied at its early adoption at best reflected a by a factor of greater than 1000-fold [19]. primitive understanding of key biological processes controlling muta- Despite this rather inauspicious start for the LNT model, Muller tion and development of cancer. However, breakthrough advancements would rescue it from obscurity, giving it vast public health and medical contributed by modern molecular biology over the last several decades implications, even proclaiming it a scientific principle by calling it the have provided experimental tools and evidence challenging the LNT Proportionality Rule [20]. While initially conceived as a driving force model for use in risk assessment of radiation or chemicals.
    [Show full text]
  • Moore Noller
    2002 Ada Doisy Lectures Ada Doisy Lecturers 2003 in BIOCHEMISTRY Sponsored by the Department of Biochemistry • University of Illinois at Urbana-Champaign Dr. Peter B. 1970-71 Charles Huggins* and Elwood V. Jensen A76 1972-73 Paul Berg* and Walter Gilbert* Moore 1973-74 Saul Roseman and Bruce Ames Department of Molecular carbonyl Biophysics & Biochemistry Phe 1974-75 Arthur Kornberg* and Osamu Hayaishi Yale University C75 1976-77 Luis F. Leloir* New Haven, Connecticutt 1977-78 Albert L. Lehninger and Efraim Racker 2' OH attacking 1978-79 Donald D. Brown and Herbert Boyer amino N3 Tyr 1979-80 Charles Yanofsky A76 4:00 p.m. A2486 1980-81 Leroy E. Hood Thursday, May 1, 2003 (2491) 1983-84 Joseph L. Goldstein* and Michael S. Brown* Medical Sciences Auditorium 1984-85 Joan Steitz and Phillip Sharp* Structure and Function in 1985-86 Stephen J. Benkovic and Jeremy R. Knowles the Large Ribosomal Subunit 1986-87 Tom Maniatis and Mark Ptashne 1988-89 J. Michael Bishop* and Harold E. Varmus* 1989-90 Kurt Wüthrich Dr. Harry F. 1990-91 Edmond H. Fischer* and Edwin G. Krebs* 1993-94 Bert W. O’Malley Noller 1994-95 Earl W. Davie and John W. Suttie Director, Center for Molecular Biology of RNA 1995-96 Richard J. Roberts* University of California, Santa Cruz 1996-97 Ronald M. Evans Santa Cruz, California 1998-99 Elizabeth H. Blackburn 1999-2000 Carl R. Woese and Norman R. Pace 2000-01 Willem P. C. Stemmer and Ronald W. Davis 2001-02 Janos K. Lanyi and Sir John E. Walker* 12:00 noon 2002-03 Peter B.
    [Show full text]
  • MCDB 5220 Methods and Logics April 21 2015 Marcelo Bassalo
    Cracking the Genetic Code MCDB 5220 Methods and Logics April 21 2015 Marcelo Bassalo The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) Frederick Griffith The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) • The nature of the transforming principle: DNA (1944 - 1952) Oswald Avery Alfred Hershey Martha Chase The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) • The nature of the transforming principle: DNA (1944 - 1952) • X-ray diffraction and the structure of proteins (1951) Linus Carl Pauling The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) • The nature of the transforming principle: DNA (1944 - 1952) • X-ray diffraction and the structure of proteins (1951) • The structure of DNA (1953) James Watson and Francis Crick The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) • The nature of the transforming principle: DNA (1944 - 1952) • X-ray diffraction and the structure of proteins (1951) • The structure of DNA (1953) How is DNA (4 nucleotides) the genetic material while proteins (20 amino acids) are the building blocks? ? DNA Protein ? The Coding Craze ? DNA Protein What was already known? • DNA resides inside the nucleus - DNA is not the carrier • Protein synthesis occur in the cytoplasm through ribosomes {• Only RNA is associated with ribosomes (no DNA) - rRNA is not the carrier { • Ribosomal RNA (rRNA) was a homogeneous population The “messenger RNA” hypothesis François Jacob Jacques Monod The Coding Craze ? DNA RNA Protein RNA Tie Club Table from Wikipedia The Coding Craze Who won the race Marshall Nirenberg J.
    [Show full text]
  • Cornell Alumni Magazine
    c1-c4CAMja11 6/16/11 1:25 PM Page c1 July | August 2011 $6.00 Alumni Magazine Well-Spoken Screenwriter (and former stutterer) David Seidler ’59 wins an Oscar for The King’s Speech cornellalumnimagazine.com c1-c4CAMja11 6/16/11 1:25 PM Page c2 01-01CAMja11toc 6/20/11 1:19 PM Page 1 July / August 2011 Volume 114 Number 1 In This Issue Alumni Magazine 34 Corne 2 From David Skorton Farewell, Mr. Vanneman 4 The Big Picture Card sharp 6 Correspondence DVM debate 8 Letter from Ithaca Justice league 10 From the Hill Capped and gowned 14 Sports Top teams, too 16 Authors Eyewitness 32 Wines of the Finger Lakes Ports of New York “Meleau” White 18 10 52 Classifieds & 34 Urban Cowboys Cornellians in Business 53 Alma Matters BRAD HERZOG ’90 56 Class Notes Last October, the Texas Rangers won baseball’s American League pennant—and played in their first-ever World Series. Two of the primary architects of that long-sought vic- 91 Alumni Deaths tory were Big Red alums from (of all places) the Big Apple. General manager Jon 96 Cornelliana Daniels ’99 and senior director of player personnel A. J. Preller ’99 are old friends and Little house in the big woods lifelong baseball nuts who brought fresh energy to an underperforming franchise. And while they didn’t take home the championship trophy . there’s always next season. Legacies To see the Legacies listing for under- graduates who entered the University in fall 40 Training Day 2010, go to cornellalumnimagazine.com. JIM AXELROD ’85 Currents CBS News reporter Jim Axelrod has covered everything from wars to presidential cam- paigns to White House politics.
    [Show full text]
  • Complete Sequence and Gene Organization of the Mitochondrial Genome of the Land Snail Albinuria Cornlea
    Copyright 0 1995 by the Genetics Society of America Complete Sequence and Gene Organization of the Mitochondrial Genome of the Land Snail Albinuria cornlea Evi Hatzoglou, George C. Rodakis and Rena Lecanidou Department of Biochemistry, Cell and Molecular Biology, and Genetics, University of Athens, Panepistimiopolis, Athens 157 01, Greece Manuscript receivedJanuary 31, 1995 Accepted for publication May 15, 1995 ABSTRACT The complete sequence (14,130 bp) of the mitochondrial DNA (mtDNA) of the land snail Ahinaria coerulea was determined. It contains 13 protein, two rRNA and 22 tRNA genes. Twenty-four of these genes are encoded by one and 13 genes by the other strand. The gene arrangement shares almost no similarities with that of two other molluscs for which the complete gene content and arrangement are known, the bivalve Mytilus edulis and the chiton Kathanna tunicata; the protein and rRNA gene order is similar to that of another terrestrial gastropod, Cepaeu nemoralis. Unusual features include the following: (1) the absence of lengthy noncoding regions (there are only 141 intergenic nucleotides interspersed at different gene borders, the longest intergenic sequence being 42 nucleotides), (2) the presence of several overlapping genes (mostlytRNAs), (3) the presence of tRNA-like structures and other stem and loop structures within genes. An RNA editing system acting on tRNAs must necessarily be invoked for posttranscriptional extension of the overlapping tRNAs. Due to these features, and also because of the small size of its genes (e.g.,it contains the smallest rRNA genes among the known coelomates), it is one of the most compact mitochondrial genomes known to date.
    [Show full text]
  • 15/5/40 Liberal Arts and Sciences Chemistry Irwin C. Gunsalus Papers, 1877-1993 BIOGRAPHICAL NOTE Irwin C
    15/5/40 Liberal Arts and Sciences Chemistry Irwin C. Gunsalus Papers, 1877-1993 BIOGRAPHICAL NOTE Irwin C. Gunsalus 1912 Born in South Dakota, son of Irwin Clyde and Anna Shea Gunsalus 1935 B.S. in Bacteriology, Cornell University 1937 M.S. in Bacteriology, Cornell University 1940 Ph.D. in Bacteriology, Cornell University 1940-44 Assistant Professor of Bacteriology, Cornell University 1944-46 Associate Professor of Bacteriology, Cornell University 1946-47 Professor of Bacteriology, Cornell University 1947-50 Professor of Bacteriology, Indiana University 1949 John Simon Guggenheim Fellow 1950-55 Professor of Microbiology, University of Illinois 1955-82 Professor of Biochemistry, University of Illinois 1955-66 Head of Division of Biochemistry, University of Illinois 1959 John Simon Guggenheim Fellow 1959-60 Research sabbatical, Institut Edmund de Rothchild, Paris 1962 Patent granted for lipoic acid 1965- Member of National Academy of Sciences 1968 John Simon Guggenheim Fellow 1972-76 Member Levis Faculty Center Board of Directors 1977-78 Research sabbatical, Institut Edmund de Rothchild, Paris 1973-75 President of Levis Faculty Center Board of Directors 1978-81 Chairman of National Academy of Sciences, Section of Biochemistry 1982- Professor of Biochemistry, Emeritus, University of Illinois 1984 Honorary Doctorate, Indiana University 15/5/40 2 Box Contents List Box Contents Box Number Biographical and Personal Biographical Materials, 1967-1995 1 Personal Finances, 1961-65 1-2 Publications, Studies and Reports Journals and Reports, 1955-68
    [Show full text]
  • Mechanisms of Microbial Genetics 443
    Chapter 11 | Mechanisms of Microbial Genetics 443 Chapter 11 Mechanisms of Microbial Genetics Figure 11.1 Escherichia coli (left) may not appear to have much in common with an elephant (right), but the genetic blueprints for these vastly different organisms are both encoded in DNA. (credit left: modification of work by NIAID; credit right: modification of work by Tom Lubbock) Chapter Outline 11.1 The Functions of Genetic Material 11.2 DNA Replication 11.3 RNA Transcription 11.4 Protein Synthesis (Translation) 11.5 Mutations 11.6 How Asexual Prokaryotes Achieve Genetic Diversity 11.7 Gene Regulation: Operon Theory Introduction In 1954, French scientist and future Nobel laureate Jacques Monod (1910–1976) famously said, “What is true in E. coli is true in the elephant,” suggesting that the biochemistry of life was maintained throughout evolution and is shared in all forms of known life. Since Monod’s famous statement, we have learned a great deal about the mechanisms of gene regulation, expression, and replication in living cells. All cells use DNA for information storage, share the same genetic code, and use similar mechanisms to replicate and express it. Although many aspects of genetics are universally shared, variations do exist among contemporary genetic systems. We now know that within the shared overall theme of the genetic mechanism, there are significant differences among the three domains of life: Eukarya, Archaea, and Bacteria. Additionally, viruses, cellular parasites but not themselves living cells, show dramatic variation in their genetic material and the replication and gene expression processes. Some of these differences have allowed us to engineer clinical tools such as antibiotics and antiviral drugs that specifically inhibit the reproduction of pathogens yet are harmless to their hosts.
    [Show full text]
  • S. Cerevisiae
    DOCTOR OF PHILOSOPHY Saccharomyces Cerevisiae as a biotechnological tool for ageing research studies on translation and metabolism Stephanie Cartwright 2013 Aston University Some pages of this thesis may have been removed for copyright restrictions. If you have discovered material in AURA which is unlawful e.g. breaches copyright, (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please read our Takedown Policy and contact the service immediately SACCHAROMYCES CEREVISIAE AS A BIOTECHNOLOGICAL TOOL FOR AGEING RESEARCH: STUDIES ON TRANSLATION AND METABOLISM STEPHANIE PATRICIA CARTWRIGHT Doctor of Philosophy ASTON UNIVERSITY July 2013 ©Stephanie Patricia Cartwright, 2013 Stephanie Patricia Cartwright asserts her moral right to be identified as the author of this thesis. This copy of the thesis has been supplied on condition that anyone who consults it is understood to recognise that its copyright rests with its author and that no quotation from the thesis and no information derived from it may be published without proper acknowledgment. 1 ASTON UNIVERSITY SACCHAROMYCES CEREVISIAE AS A BIOTECHNOLOGICAL TOOL FOR AGEING RESEARCH: STUDIES ON TRANSLATION AND METABOLISM Stephanie Patricia Cartwright PhD 2013 Thesis summary The yeast Saccharomyces cerevisiae is an important model organism for the study of cell biology. The similarity between yeast and human genes and the conservation of fundamental pathways means it can be used to investigate characteristics of healthy and diseased cells throughout the lifespan. Yeast is an equally important biotechnological tool that has long been the organism of choice for the production of alcoholic beverages, bread and a large variety of industrial products.
    [Show full text]
  • New Ways of Thinking About Telomeres and Telomerase
    AA98 99 D 1998-99 Ada Doisy Lecture in Biochemistry Ada Doisy Lecturers New Ways of Thinking 1970-71 Charles Huggins* and Elwood V. Jensen About Telomeres and Telomerase 1972-73 Paul Berg* and Walter Gilbert* 1973-74 Saul Roseman and Bruce Ames 1974-75 Arthur Kornberg* and Osamu Hayaishi 1976-77 Luis F. Leloir* 1977-78 Albert L. Lehninger and Efraim Racker 1978-79 Donald D. Brown and Herbert Boyer 1979-80 Charles Yanofsky 1980-81 Leroy E. Hood 1983-84 Joseph L. Goldstein* and Michael S. Brown* 1984-85 Joan Steitz and Phillip Sharp* 1985-86 Stephen J. Benkovic and Jeremy R. Knowles 1986-87 Tom Maniatis and Mark Ptashne 1988-89 J. Michael Bishop* and Harold E. Varmus* 1989-90 Kurt Wüthrich 1990-91 Edmond H. Fischer* and Edwin G. Krebs* 1993-94 Bert W. O’Malley 1994-95 Earl W. Davie and John W. Suttie 1995-96 Richard J. Roberts* 1996-97 Ronald M. Evans Dr. Elizabeth H. Blackburn 1998-99 Elizabeth H. Blackburn Professor and Chair Department of Microbiology and Immunology University of California, San Francisco *Indicates received Nobel Laureate 12:00 noon Friday, September 11, 1998 Medical Sciences Auditorium In 1970, Dr. Edward A. Doisy endowed the Ada Doisy Lectures in Biochemistry in honor of his mother. Dr. Doisy described his mother as “a kind and gentle woman who was always racing her motor in a determined and well-governed direction toward her objective.” Dr. Doisy noted that she was devout in her Baptist beliefs and that “the other god she also worshipped seven days a week was knowledge and education, and she early inculcated this adoration into her New Ways of Thinking About children.” He also noted that she was best remembered for Telomeres and Telomerase “an inflexible tenacity of purpose, of “stick-to-it-iveness,” and of wrestling with and solving problems against all obstacles.” Dr.
    [Show full text]
  • Nucleic Acid Notes
    For Internal Circulation only Nucleic acids Dr Sairindhri Tripathy Definition Any of a group of complex compounds found in all living cells and viruses, composed of purines, pyrimidines, carbohydrates, and phosphoric acid. Two forms of nucleic acids :- • DNA (deoxyribonucleic acid ) • RNA (ribonucleic acid ) Functions Functions of DNA:- • A permanent storage place for genetic information. • Controls the synthesis of RNA. • Determines the protein development in new cells. Functions of RNA :- • Messenger RNA (m RNA ) • Ribosomal ( rRNA) • Transfer (tRNA) • In post transcription modify the other RNA’s • Transfer genetic information Component of nucleic acids Nucleic acids are build up by the monomeric units -nucleotides that have a pentose sugar, nitrogen base, and phosphate Base PO4 Nucleoside Sugar + Phosphate nucleoside = Nucleotide Function of nucleotides • Build blocks or monomeric units • Structural component of several coenzymes of B- complex vitamins. e.g. FAD. Coenzyme A • Serve as intermediates in biosynthesis of carbohydrate, lipid & protins. e.g. S-adenosylmethionine • Control several metabolic reaction. Structure of Nucleotides Nitrogen-Containing Bases (Purines &pyrimidines) O NH2 H CH3 N N N O N N N H H adenine (A) thymine (T) O NH2 O H N CH3 H CH3 N N N N NH2 N O N O N H H H guanine (G) cytosine (C) uracil (U) Structure of purine (A,G) & pyrimidines (C, T, U) Sugars HOCH2 O OH HOCH2 O OH OH OH OH (no O) ribose deoxyribose Nucleosides in DNA Base Sugar Nucleoside Adenine (A) Deoxyribos Adenosine Guanine (G) Deoxyribose Guanosine Cytosine (C) Deoxyribose Cytidine Thymine (T) Deoxyribose Thymidine Nucleosides in RNA Base Sugar Nucleoside Adenine (A) ribose Adenosine Guanine (G) ribose Guanosine Cytosine (C) ribose Cytidine Uracil (U) ribose Uridine Nucleoside di and triphosphate Adenosine 5’ monophosphate Thymidine 5’ monophosphate Different form of DNA double helix • DNA exist in at least 6 different form-A to E and Z • B-form of DNA double helix described by Watson ad crick.
    [Show full text]
  • Studies of Intracellular Transport and Anticancer Drug Action by Functional Genomics in Yeast
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 402 Studies of intracellular transport and anticancer drug action by functional genomics in yeast MARIE GUSTAVSSON ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 UPPSALA ISBN 978-91-554-7360-0 2008 urn:nbn:se:uu:diva-9408 Dissertation presented at Uppsala University to be publicly examined in C10:301, BMC, Husargatan 3, Uppsala, Tuesday, December 16, 2008 at 13:00 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in Swedish. Abstract Gustavsson, M. 2008. Studies of intracellular transport and anticancer drug action by functional genomics in yeast. Acta Universitatis Upsaliensis. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 402. 56 pp. Uppsala. ISBN 978-91-554-7360-0. This thesis describes the use of functional genomics screens in yeast to study anticancer drug action and intracellular transport. The yeast Saccharomyces cerevisiae provides a particularly useful model system for global drug screens, due to the availability of knockout mutants for all yeast genes. A complete collection of yeast deletion mutants was screened for sensitivity to monensin, a drug that affects intracellular transport. A total of 63 deletion mutants were recovered, and most of them were in genes involved in transport beyond the Golgi. Surprisingly, none of the V-ATPase subunits were identified. Further analysis showed that a V-ATPase mutant interacts synthetically with many of the monensin-sensitive mutants. This suggests that monensin may act by interfering with the maintenance of an acidic pH in the late secretory pathway. The second part of the thesis concerns identification of the underlying causes for susceptibility and resistance to the anticancer drug 5-fluorouracil (5-FU).
    [Show full text]
  • Expression of Artemia LEA Proteins in Drosophila Melanogaster Cells
    Eastern Illinois University The Keep Masters Theses Student Theses & Publications 2016 Expression of Artemia LEA Proteins in Drosophila melanogaster Cells Using Multicistronic Vector Constructs Kazi Nazrul Islam Eastern Illinois University This research is a product of the graduate program in Biological Sciences at Eastern Illinois University. Find out more about the program. Recommended Citation Islam, Kazi Nazrul, "Expression of Artemia LEA Proteins in Drosophila melanogaster Cells Using Multicistronic Vector Constructs" (2016). Masters Theses. 2454. https://thekeep.eiu.edu/theses/2454 This is brought to you for free and open access by the Student Theses & Publications at The Keep. It has been accepted for inclusion in Masters Theses by an authorized administrator of The Keep. For more information, please contact [email protected]. The Graduate School� EAsTillt"llLLINOIS UN!VERSlTY­ Thesis Maintenance and Reproduction Certificate FOR: Graduate Candidates Completing Theses in Partial Fulfillment of the Degree Graduate Faculty Advisors Directing the Theses RE: Preservation, Reproduction, and Distribution of Thesis Research Preserving, reproducing, and distributing thesis research is an important part of Booth Library's responsibility to provide access to scholarship. In order to further this goal, Booth Library makes all graduate theses completed as part of a degree program at Eastern Illinois University available for personal study, research, and other not-for-profit educational purposes. Under 17 U.S.C. § 108, the library may reproduce and distribute a copy without infringing on copyright; however, professional courtesy dictates that permission be requested from the author before doing so. Your signatures affirm the following: • The graduate candidate is the author of this thesis.
    [Show full text]