European Journal of Human Genetics (2001) 9, 561 ± 571 ã 2001 Nature Publishing Group All rights reserved 1018-4813/01 $15.00 www.nature.com/ejhg ARTICLE Complete exon-intron structure of the RPGR-interacting protein (RPGRIP1) gene allows the identification of mutations underlying Leber congenital amaurosis Sylvie Gerber1, Isabelle Perrault1, Sylvain Hanein1, Fabienne Barbet1, Dominique Ducroq1, Imad Ghazi2, Dominique Martin-Coignard3, Corinne Leowski4, Tessa Homfray5, Jean-Louis Dufier2, Arnold Munnich1, Josseline Kaplan*,1 and Jean-Michel Rozet1 1Unite de Recherches sur les Handicaps GeÂneÂtiques de l'Enfant. HoÃpital Necker ± Enfants Malades, Paris, France; 2Service d'Ophtalmologie, HoÃpital Necker ± Enfants Malades, Paris, France; 3Centre Hospitalier ReÂgional du Mans, France; 4Institut National des Jeunes Aveugles, Paris, France; 5Saint George's Hospital Medical School, London, UK Leber congenital amaurosis (LCA) is a genetically heterogeneous autosomal recessive condition responsible for congenital blindness or greatly impaired vision since birth. So far, six LCA loci have been mapped but only 4 out of 6 genes have been identified. A genome-wide screen for homozygosity was conducted in seven consanguineous families unlinked to any of the six LCA loci. Evidence for homozygosity was found in two of these seven families at the 14q11 chromosomal region. Two retinal specific candidate genes were known to map to this region, namely the neural retina leucine zipper (NRL) and the retinitis pigmentosa GTPase regulator interacting protein (RPGRIP1). No mutation of the NRL gene was found in any of the two families. Thus, we determined the complete exon-intron structure of the RPGRIP1 gene. RPGRIP1 encompasses 24 coding exons, nine of which are first described here with their corresponding exon-intron boundaries. The screening of the gene in the two families consistent with linkage to chromosome 14q11 allowed the identification of a homozygous null mutation and a homozygous missense mutation, respectively. Further screening of LCA patients unlinked to any of the four already identified LCA genes (n=86) identified seven additional mutations in six of them. In total, eight distinct mutations (5 out of 8 truncating) in 8/93 patients were found. So far this gene accounts for eight out of 142 LCA cases in our series (5.6%). European Journal of Human Genetics (2001) 9, 561 ± 571. Keywords: Leber congenital amaurosis; homozygosity mapping; RPGR-interacting protein (RPGR1P1) gene; complete gene structure Introduction and responsible for congenital blindness.1 The diagnosis is Originally described by Theodore Leber in 1869, Leber usually made at birth or during the first months of life in an congenital amaurosis (LCA, MIM 204000) is an autosomal infant with total blindness or greatly impaired vision, normal recessive condition distinct from other retinal dystrophies fundus and non recordable electroretinogram (ERG,2). It is usually accepted that LCA accounts for 5% of all retinal dystrophies.3 *Correspondence: J Kaplan, Unite de Recherches sur les Handicaps LCA is a genetically heterogeneous condition, and four GeÂneÂtiques de l'Enfant. HoÃpital Necker ± Enfants Malades, 149 rue de disease genes have been hitherto identified: GUCY2D SeÁvres, 75743, Paris Cedex 15, France. Tel: +33 1 44 49 51 61; 4 5,6 7±9 10 Fax: +33 1 47 34 85 14; E-mail: [email protected] (retGC-1), RPE65, CRX and AIPL1 . Taken together Received 1 May 2001; revised 17 May 2001; accepted 22 May 2001 these four genes account for only one third of the LCA cases RPGRIP1, the fifth LCA-causing gene SGerberet al 562 of our series. Two additional loci have been reported, namely the RNAs were reverse transcribed by adding 2.5 units of LCA3 and LCA5 on chromosomes 14q24 and 6q11-q16, MuLV Reverse Transcriptase (GeneAmp RNA PCR Kit, Applied respectively.11,12 Biosystems, Foster City, USA) for 1.5 h at 428C. In an effort to identify novel LCA loci, we have undertaken Reverse transcribed mRNAs (1 ml) were subsequently a genome-wide search for homozygosity in seven consangui- submitted to successive PCR amplifications using specific neous and multiplex families with no mutation in known forward primers designed from exons-4, -3, -2, -1 and 1 of the LCA genes, and unlinked to LCA3 or LCA5. We found C14000056 clone and a unique reverse primer located in evidence of homozygosity at the D14S283 and D14S275 loci exon 10 of the RPGRIP1 gene (Figure 2). Reactions were on chromosome 14q11 in two out of seven families. carried out in a buffer (20 ml) containing 20 mM Tris-HCl Interestingly, the gene encoding the `retinitis pigmentosa (pH 8.4), 50 mM KCl, 1.5 mM MgCl, 200 mM of each dNTP, GTPase regulator interacting protein' (RPGRIP1) was found 0.5 mM of each primer and 0.75 U of Taq DNA polymerase to map to the 14q11 chromosomal region.13,14 (Life Technologies). After an initial denaturation for 5 min at Here, we report the characterization of the complete exon- 968C, denaturation was at 968C for 20 s, annealing was for intron structure of the RPGRIP1 gene and the identification each combination of primers at 608C for 15 s and extension of mutations in two families consistent with linkage to was at 728C for 30 s, for 34 cycles followed by a final chromosome 14q11 as well as in six out of 86 unrelated extension, for 7 min at 728C. The 1 kb fragment amplified patients. Taken together, our results show that RPGRIP1 between primers PF1/PR was loaded onto a 1% low melting accounts for eight out of 142 LCA families (5.6%), while the agarose gel and purified by phenol-chloroform extraction other four reported genes account for 49 out of 142 LCA and recovered by ethanol precipitation. The purified frag- families (34.5%). ment was directly sequenced using the Big Dye Terminator Cycle Sequencing Kit (ABI Prism). The genomic structure of the RPGRIP1 gene was deter- Patients and methods mined by comparing the PF1/PR 1 kb sequence with the Patients genomic sequence of the C14000056 clone. In addition to the seven consanguineous and multiplex families selected for the genome-wide search for homo- Mutation screening of the RPGRIP1 in the two families zygosity, 86 families were studied of which 14 were multi- linked to 14q11 plex, 11 were consanguineous, and five were consanguineous The 24 exons encoding RPGRIP1 were amplified using and multiplex. All patients fulfilled the minimal criteria for specific primers designed from the intronic sequences nearby diagnosis of LCA described elsewhere.19,20 the intron-exon junctions (Table 1). The PCR and sequencing conditions are similar to that described above except for Genome-wide search for homozygosity annealing temperature which was at 568C for each exon. A genome-wide search for homozygosity was undertaken independently in all patients of the seven LCA families Segregation analysis of the G2237A mutation (n=17) using the 382 pairs of fluorescent oligonucleotides of The G2237A mutation created a Taq1 restriction site. Exon 15 the Genescan Linkage Mapping Set, Version II (Perkin Elmer of the RPGRIP1 gene was amplified as described in the Cetus) under conditions recommended by the manufacturer. previous section. PCR products were digested for 1 h at 658C Amplified fragments were electrophoresed and analysed on using restriction enzyme Taq1 (5 u) in the buffer supplied by an automatic sequencer (ABI 377). The polymorphic markers the manufacturer (Life Technologies). Digested fragments have an average spacing of 10 cM throughout the genome. were electrophoresed on a 3% agarose low melting and 1% agarose gel. Mutation screening of NRL in the two families linked to 14q11 Screening of a large series of LCA patients The three exons (two coding exons) of the NRL gene were The search for mutations was carried out by single strand amplified and sequenced using specific primers designed conformation polymorphism (SSCP) analysis and/or dena- from the intronic sequences nearby the intron-exon junc- turing high-pressure liquid chromatography (DHPLC). tions (data not shown, available on request). For SSCP analysis, genomic DNA (200 ng) was submitted to PCR amplification using 0.5 mM of specific primers (Table 1) Characterization of the complete exon-intron structure and alpha 33P dCTP (0.07 ml, 10 mCi/ml NEN). Amplified of the human RPGRIP1 gene DNA was mixed with an equal volume of formamide loading Human retinal total RNA (4.5 mg) was heated for 10 min at dye (95% formamide, 20 mM EDTA, 0.05% bromophenol 658C, in a buffer (19 ml) containing 1 mM dithiotreitol, 5 mM blue, 0.05% xylene cyanol), denatured for 10 min at 958C, MgCl2,1mM dNTP, 2.5 mM random hexamers, 16 buffer II, 1 loaded onto a polyacrylamide gel (3064060.04 cm MDE, unit RNase Inhibitor (GeneAmp RNA PCR Kit, Applied TEBU) and electrophoresed at room temperature for 14 h at Biosystems, Foster City, USA). After ice quenching (5 min), 4 W, and at 48C for 14 h at 8 W. Gels were transferred onto European Journal of Human Genetics RPGRIP1, the fifth LCA-causing gene S Gerber et al 563 Table 1 PCR primers designed for the amplification of the 24 exons encoding RPGRIP1 Exon number Forward sequence (5' ±3') Reverse sequence (5' ±3') Size of amplified product (bp) 1 GACATCCTAAAGTTGCATG GTTCCACAGTGAGAGTTC 231 2 CTCTCTGGACAAGATGTG AAATTTAAGGAGAACTCTA 245 3 TAACTGTCATGAAAGGAGAAG AGTCCTTCCCAGTGTCTT 366 4 GTTCCGGAGGGTACTGTT CTTCCCTGATCATGCTGAA 263 5 CCTCGACATGTACCAAGGT TTCCTCTGAGATGGAGGAA 411 6 AGGGCATAGTCAAGGAGAA CTGAATTGTGGCTTCTCATA 282 7 GACTACTTGGCAAGCTAGG TACTTGGAGATGAACATAGAT 282 8 CGTGCTGAGTGATATGACC ACACATTCTAACATCCCTGA