Microevolution of Sex Determination Mechanisms: Case Studies in Caenorhabditis Elegans Christopher Holden Chandler Iowa State University

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2010 Microevolution of sex determination mechanisms: Case studies in Caenorhabditis elegans Christopher Holden Chandler Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Ecology and Evolutionary Biology Commons

Recommended Citation Chandler, Christopher Holden, "Microevolution of sex determination mechanisms: Case studies in Caenorhabditis elegans" (2010). Graduate Theses and Dissertations. 11538. https://lib.dr.iastate.edu/etd/11538

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Microevolution of sex determination mechanisms: case studies in Caenorhabditis elegans

Christopher Holden Chandler

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Ecology and Evolutionary Biology

Program of Study Committee: Fredric J. Janzen, Major Professor Anne Bronikowski Jo Anne Powell-Coffman Steve Proulx Jeanne Serb Jonathan Wendel

Iowa State University

Ames, Iowa

2010

TABLE OF CONTENTS

ABSTRACT iv CHAPTER 1. GENERAL INTRODUCTION 1 Dissertation Organization 1 Introduction 1 Review of sex determination in C. elegans 10 References 13 CHAPTER 2. THE EVOLUTION OF SEX-DETERMINING MECHANISMS: 22 LESSONS FROM TEMPERATURE-SENSITIVE MUTATIONS IN SEX DETERMINATION GENES IN CAENORHABDITIS ELEGANS Abstract 22 Introduction 23 Materials and Methods 27 Results 33 Discussion 35 Acknowledgments 38 References 38 Tables 41 Figures 46 CHAPTER 3. CLOSE TEMPORAL CORRESPONDENCE BETWEEN THE 51 ORIGINS OF SELF-FERTILITY AND FOG-2 IN CAENORHABDITIS ELEGANS Abstract 51 Introduction 52 Materials and Methods 54 Results and Discussion 56 Acknowledgments 59 References 60 Tables 62 Figures 63 iii

CHAPTER 4. CRYPTIC INTRASPECIFIC VARIATION IN SEX 64 DETERMINATION IN CAENORHABDITIS ELEGANS REVEALED BY MUTATIONS Abstract 64 Introduction 65 Materials and Methods 69 Results 73 Discussion 75 Acknowledgments 81 References 82 Tables 87 Figures 90 Appendices 94 CHAPTER 5. CONCLUSIONS 102 Discussion 102 References 108 ACKNOWLEDGMENTS 111 iv

ABSTRACT

In all species with two sexes, every individual is faced with a crucial decision: which sex to become. Different species make this decision in a staggering variety of ways, using a range of both environmental and genetic cues. Such sex determination mechanisms (SDMs) have been the focus of active research in many biological sub-disciplines, as they make an excellent model system for genetic and developmental biologists and can have significant ecological and evolutionary consequences. Unfortunately, relatively little is known about within-species variation in SDMs, and how this variation leads to between-species divergence. In this dissertation, I examine the microevolution of SDMs using strains of the nematode “worm” Caenorhabditis elegans with temperature-sensitive mutations in the sex- determining genes tra-2 and her-1. This species has two sexes: obligately outcrossing males, and self-fertilizing hermaphrodites which can facultatively outcross with males.

I first characterize these mutant strains at the phenotypic and DNA sequence levels, showing that they display thermal sex ratio reaction norms similar to many reptiles with temperature-dependent sex determination. They also differ from each other at the molecular level, suggesting that transitions between SDMs can occur in a variety of ways, and that even

SDMs appearing outwardly similar may differ in their genetic basis. However, these mutations have deleterious pleiotropic effects on overall fitness, implying that SDM evolution is constrained, or that compensatory mutations are necessary to ameliorate these effects if new sex determination mutations become fixed.

Next, I show that fog-2, a gene thought to be key for the evolution of self-fertility in this species, is not necessarily so critical after all, as self-fertility in fog-2 null mutants can be v restored in mutants with altered tra-2 activity. Therefore, self-fertility could have evolved prior to fog-2, which may have been a later innovation to fine-tune tra-2 regulation and perhaps avoid some negative pleiotropic effects. Molecular dating of the duplication event that generated fog-2, however, shows that it probably evolved almost simultaneously with the origin of self-fertility in this species. Thus, although fog-2 was not the first step in the evolution of self-fertility in C. elegans, it was surely an important step in the process strongly favored by selection.

Finally, I introgress the mutations carried by one of these strains into several additional wild genetic isolates and discover that the mutations’ effects are significantly dependent upon the genetic background in which they occur, demonstrating the microevolutionary potential of this SDM. I then use quantitative trait locus (QTL) mapping to identify background loci responsible for this variation. I find that most of it can be explained by only a handful of loci with moderate to large effects. Some of these loci lack known candidate sex-determining genes, highlighting the potential for these previously undiscovered genes with minor or redundant functions to play a role in SDM evolution.

Together, these studies show that SDMs can change in a variety of ways. The presence of cryptic genetic variation suggests that there may be abundant standing variation to compensate for the deleterious effects of new mutations, and that neutral developmental drift may play a role in SDM divergence. They also showcase how studies of natural and lab- generated variation can complement one another to yield novel insights, providing a useful starting point for more detailed exploration of sex determination and its evolution in this species. 1

CHAPTER 1. GENERAL INTRODUCTION

Dissertation Organization

This dissertation is composed of five chapters. The first provides a general overview of our current understanding of the evolution of sex determination mechanisms, as well as a brief review of sex determination in Caenorhabditis elegans, the model organism upon which this dissertation is based. The middle three chapters are manuscripts describing stand-alone research projects, written for submission to biological journals. Finally, I conclude with a fifth chapter that integrates discussion of these three research projects and considers research avenues likely to yield key insights in the future.

Introduction

How a developing organism “decides” whether to become male or female has captivated humans for thousands of years (Mittwoch, 2000). This fascination is especially strong for evolutionary biologists, and for many good reasons. Sexual reproduction and outcrossing are taxonomically widespread, and have probably played an important role in allowing organisms to adapt (e.g., Morran et al., 2009). Haldane (1922) first recognized the relationship between sex determination and reproductive isolating mechanisms nearly a century ago, and “Haldane’s rule” continues to be an important phenomenon for evolutionary biologists (e.g., Baird, 2002), and others have proposed additional mechanisms by which sex determination mechanisms (SDMs) can promote speciation (e.g., Ser et al., 2010). The particular SDMs thought to have been displayed by extinct marine reptiles and dinosaurs have been proposed as important factors in their radiation (Organ et al., 2009) and extinction 2

(Miller et al., 2004), respectively. In addition, the allocation of reproductive investments into the two sexes is of paramount importance for individuals seeking to maximize their fitness

(e.g., Trivers & Willard, 1973). Today, the study of SDMs is even recognized as having potential practical significance for conservation biology (e.g., Cotton & Wedekind, 2007;

Cotton & Wedekind, 2009; Gutierrez & Teem, 2006; Mitchell et al., 2008). Finally, SDMs are emerging as an important model for understanding the evolution of developmental networks and pathways in general. Thus, examining how SDMs evolve is likely to be of interest to biologists of all walks.

SDM diversity can be broken down first into two broad categories: genotypic sex determination (GSD) and environmental sex determination (ESD). In GSD species, an organism’s sex is determined at conception by its genotype. In ESD species, on the other hand, environmental factors during development determine sex. Some view these categories as the ends of a continuum rather than as a clean distinction (e.g., Barske & Capel, 2008;

Sarre et al., 2004). Examples such as the lizard Bassiana duperreyi, which has heteromorphic sex chromosomes but displays temperature-induced sex reversal, bolster this view (Radder et al., 2008; but see Valenzuela et al., 2003).

Further diversity is seen within each of these categories. GSD mechanisms include various chromosomal SDMs, such as the XX/XY system seen in mammals (Graves, 1998) and the ZZ/ZW system seen in birds (Smith et al., 2009). Some insects use haplodiploidy, whereby fertilized eggs become females and unfertilized eggs develop into males (e.g., Wu et al., 2005). Other GSD species lack true sex chromosomes, instead using a polygenic system in which the combined action of many loci determines sex (e.g., Vandeputte et al., 2007). 3

Likewise, a variety of environmental signals influence sex determination in ESD species.

Probably the most common is temperature, occurring in many reptiles (Janzen & Phillips,

2006). However, many other signals have been documented, including light availability in plants (Korpelainen, 1998), host crowding for parasitic organisms (Blackmore & Charnov,

1989), and the sex of nearby conspecifics (Berec et al., 2005).

Even systems that may initially appear similar may not be homologous, revealing even more diversity. For example, mammals and many fish (Mank et al., 2006) have XX/XY sex chromosome systems. But mammalian sex determination, for example, relies on the action of the Sry gene (Koopman et al., 1991), while the master sex-determining gene on the medaka (Oryzias latipes) Y chromosome is DMY, a recent duplicate of another vertebrate sex-determining gene (Kondo et al., 2004; Zhang, 2004). Moreover, some Oryzias species lack the DMY gene, and have XX/XY sex chromosomes that are not homologous to those of

O. latipes (Takehana et al., 2007); other Oryzias species even have ZZ/ZW systems

(Takehana et al., 2008). Insects provide another example: the mechanisms behind haplodiploidy differ among hymenopterans. Some rely on complementary sex-determination, in which individuals that are heterozygous at the sex-determining locus become females, while hemizygous and diploid homozygous individuals are males, but other species use as- yet uncharacterized systems (Charlesworth, 2008; Hasselmann et al., 2008; Wu et al., 2005).

Some divergence is still present among species in these pathways downstream of the master sex-determining genes, but curiously, genes and gene functions are increasingly conserved farther downstream. This pattern suggests that SDMs evolve mainly by recruiting new upstream regulators (Pomiankowski et al., 2004; Wilkins, 1995). This hypothesis is 4 supported by comparisons of both closely- and distantly-related organisms. For example, the role of the doublesex gene, which is one of the most downstream genes in the Drosophila sex-determining pathway, is shared by houseflies (Musca; Hediger et al., 2004), the medfly

(Ceratitis; Pane et al., 2005), honeybees (Apis; Cho et al., 2007), and mosquitos (Anopheles;

Scali et al., 2005). However, the more upstream gene sex-lethal, though present in Musca and

Ceratitis, is not sex-specifically spliced in either species, suggesting that it does not have the same sex-determining role in these species that it does in Drosophila (Meise et al., 1998;

Saccone et al., 1998). The most downstream elements appear to show some conservation of function even among phyla: for example, the vertebrate DM-domain genes, the gene mab-3 in C. elegans, and the dipteran doublesex genes all show some homology and are involved in sex determination or sexual differentiation (Raymond et al., 1998). In fact, homologs of these genes with possible roles in sexual differentiation have even been found in organisms as distantly related as cnidarians, suggesting that their role in sexual development is extremely ancient (Miller et al., 2003). However, upstream addition cannot necessarily explain all variation in SDMs. In C. elegans and C. briggsae, for instance, the middle-acting fem genes have divergent roles in hermaphrodite spermatogenesis (Hill & Haag, 2009; Hill et al., 2006), and the role of fem-3 in spermatogenesis may also differ between C. elegans and C. briggsae

(Haag et al., 2002), but more upstream and downstream genes are conserved.

The large diversity of SDMs suggests that they evolve rapidly. This idea is supported by phylogenetic analyses. A broad phylogenetic study in reptiles, for instance, inferred there have been at least eight independent transitions between ESD and GSD (Janzen & Krenz,

2004), and an analysis of sex chromosomes in Australian agamid lizards also found evidence 5 of frequent transitions (Ezaz et al., 2009), suggesting that such switches occur readily (but see Pokorna & Kratochvil, 2009 for a counter-argument). Numerous transitions between various SDMs have also been shown in teleost fishes (Mank & Avise, 2009; Mank et al.,

2006; Ser et al., 2010). Similarly, genes involved in sex determination (and sexual differentiation in general) show extremely high rates of molecular evolution, evidenced by extraordinarily large interspecific sequence divergence (e.g., deBono & Hodgkin, 1996;

Stothard et al., 2002; Whitfield et al., 1993); and human and chimpanzee Y-chromosomes show differences not only in gene sequence, but also enormous amounts of rearrangement and re-modeling (Hughes et al., 2010). Sex-determining genes whose products interact directly have been shown to co-evolve rapidly (Haag et al., 2002; Stothard & Pilgrim, 2006).

Surprisingly, though, at least some of these genes show very little polymorphism within species (Graustein et al., 2002; Walthour & Schaeffer, 1994). These observations suggest that both strong purifying and positive selection may act on sex-determining genes (King et al.,

2007).

What is the nature of these selective forces that shape SDMs? It is difficult to imagine that all of this diversity arose by neutral processes such as drift. Accordingly, abundant theoretical work has identified several different types of selection that can influence the evolution of SDMs. This research has focused on two main areas: sex-ratio selection, and sexual conflict and sexual selection.

The oldest theoretical work concerning SDMs involves sex ratio. Fisher (1930) pointed out that because each sex contributes equally to the next generation’s gene pool, if one sex is rare, it will have a higher per-capita contribution, and thus, selection will favor 6 increased production of the under-represented sex, until the population reaches an equal primary sex ratio. This work has been extended (Bulmer & Bull, 1982) to show that equal primary sex ratios are favored under a variety of SDMs, and to consider situations in which the costs of producing each sex differ (e.g., Kozielska et al., 2006). Others have investigated specific conditions, such as cytoplasmic sex ratio distorters or meiotic drive (e.g., Caubet et al., 2000; Kozielska et al., 2009) and metapopulation dynamics (Vuilleumier et al., 2007), that can cause transitions in SDMs in conjunction with sex-ratio selection. Empirical support for Fisherian sex-ratio selection is also strong: both lab- (e.g., Basolo, 1994; Conover & Van

Voorhees, 1990; Conover et al., 1992) and field-based (Charlat et al., 2007) studies have shown swift evolutionary change from skewed to even offspring sex ratios, although the response is not always so rapid (Carvalho et al., 1998).

Some situations exist, however, where the primary sex ratio is not expected to evolve to parity. Such conditions have been proposed as adaptive explanations for the maintenance of SDMs, such as ESD, which may commonly produce skewed sex ratios. The hypothesis put forth by Charnov and Bull (1977) has received considerable attention. This model applies to organisms that reproduce in an unpredictable and patchy environment. Moreover, the patch an individual develops in must have lifelong effects on its fitness, and these fitness effects must differ between the two sexes. If these conditions are met, an organism can maximize its fitness by becoming the sex that receives the greatest benefits from the environment it finds itself in. In other words, when developing in an environment that produces highly fecund females but weak males, one should become a female; when conditions are unfavorable for females but result in highly competitive males, one should become a male. Though it enjoys 7 compelling support in some species (e.g., Blackmore & Charnov, 1989), in reptiles, which are probably the taxon in which ESD is most common, empirical evidence has been indirect or equivocal (Janzen & Phillips, 2006), at least until recently: one study elegantly showed that the pattern of ESD seen in the Jacky dragon (Amphibolurus muricatus) does indeed maximize sex-specific reproductive success (Warner & Shine, 2008).

Sex-ratio selection is not the only force capable of driving transitions between SDMs.

Pomiankowski et al. (2004) showed that selection to strengthen the sex-determining signal and minimize mis-expression of genes promoting the development of the opposite sex can lead to the recruitment of new upstream sex-determining genes, increasing SDM complexity.

Sexually antagonistic variation, that is, an autosomal polymorphic gene in which the two alleles have opposite effects in the two sexes, can theoretically promote the invasion of a new, linked sex-determining gene, converting the old autosome into a new sex chromosome

(van Doorn, 2009; van Doorn & Kirkpatrick, 2007). Intralocus sexual conflict in Lake

Malawi cichlids over a coloration polymorphism (in which one of the alleles provides a cryptic coloration pattern in females but disrupts male nuptial coloration) is thought to have been resolved in exactly this manner (Roberts et al., 2009). Conflict between parents and their offspring, too, can influence sex determination. If the optimal brood sex ratio from the parents’ perspective differs from each individual offspring’s optimum, this conflict can lead to the evolution of dominant sex-determining genes under zygotic control, such as XX/XY or

ZZ/ZW systems (Uller et al., 2007; Werren et al., 2002).

Theoretical studies provide an excellent framework for exploring the conditions under which transitions in SDMs are expected, but they offer little in the way of understanding the 8 mechanisms underlying these transitions or the biological constraints limiting them. For this type of question, we must necessarily turn to empirical studies. Fortunately, a handful of instances of possible ongoing transitions in SDMs have been documented. Three sex chromosomes (X, Y, and W) occur in the platyfish (Xiphophorus maculatus), with females being either XX, WX, or WY, and males being either XY or YY (Kallman, 1968); in other words, both males and females may be either homogametic or heterogametic. In the housefly

(Musca domestica), an autosomal male-determining factor (M) that can override the sex chromosomes occurs in some populations, and in some of those an autosomal dominant female-determining factor (FD) that can override M also segregates (Dubendorfer et al., 2002;

Feldmeyer et al., 2008); FD was recently shown to be a gain-of-function allele of the Musca tra ortholog (Hediger et al., 2010). Populations of the frog Rana rugosa have also undergone multiple switches between XX/XY and ZZ/ZW systems (Ogata et al., 2003; Ogata et al.,

2008). Male factors can translocate at low frequency in the fly Megaselia scalaris, creating new sex chromosomes (Traut, 1994). The common thread through all of these cases is that they involve major modifications to the SDM or sex chromosomes. But can changes in the sex determination pathway occur without changing the heterogametic sex or converting autosomes to sex chromosomes? These examples are all certainly interesting and worthy of our attention. However, we should be cautious using them to make generalizations without further research and wider taxonomic sampling of intraspecific variation. On one hand, these cases may be representative examples of how SDMs typically evolve. But on the other, perhaps they were discovered simply because they have obvious consequences (e.g., highly biased sex ratios in some crosses), with many examples of more typical but subtler cases of 9 intraspecific variation in sex determination yet to be discovered. In addition, we still lack a mechanistic molecular understanding of the sex-determining factors responsible for these changes in sex chromosomes, although progress is being made (e.g., Hediger et al., 2010).

A few examples of intraspecific variation in sex determination do not involve large- scale chromosomal differences (e.g., Blackmore & Charnov, 1989; Ewert et al., 2005;

Girondot et al., 1994; Janes & Wayne, 2006; Janzen, 1992; Rhen & Lang, 1998). Except for one showing variation in transcription of sex determination genes in Drosophila (Tarone et al., 2005), these cases largely document variation in thermal sex ratio reaction norms in ESD species, mostly vertebrates. Unfortunately, the genetic basis of sex determination in these taxa is inadequately understood, so at present they are not ideal models for exploring the genetic basis of SDM evolution. However, they do suggest that genetic variation in reaction norms (as well as genotype-by-environment-interactions) for sex ratio and sexual traits would be a powerful way to study the microevolution of SDMs. Although none of the handful of well-developed model organisms display ESD, in some of these, lab-generated conditional mutations can create ESD-like patterns. Harnessing these mutations could allow us to uncover variation in SDMs that would otherwise go undetected. Laboratory-engineered mutant strains have, in fact, already proved useful in studying SDM evolution. Hodgkin

(2002), for instance, constructed an array of mutant C. elegans strains in which sex was determined by many different cues, including autosomal alleles, maternal effects, and importantly, temperature, demonstrating that there are many ways to modify SDMs. Baldi et al. (2009), by knocking down just two genes, achieved the remarkable feat of engineering C. remanei worms that reproduced by self-fertilization, even though this species is normally an 10 obligate outcrosser. Even though the ultimate goal is to understand how SDMs evolve in nature, these two studies show that the potential for laboratory studies to advance this field should not be overlooked.

In this dissertation, I implement this experimental laboratory approach with C. elegans strains carrying mutations that render sex determination temperature-sensitive in order to explore the microevolution and genetic basis of changes in SDMs. Chapter two introduces and characterizes these strains, describing along the way some insights into the evolution of SDMs that can be gleaned from the mutations themselves. In chapter three, I describe a genetic interaction between one of these mutations and a mutation in a third sex- determining gene, and the implications of this interaction for the evolution of germline sex determination and self-fertility in this species. Chapter four demonstrates how such conditional mutations can be used to reveal “cryptic” variation in the sex determination pathway. In addition, I characterize the genetic architecture of this previously hidden, within- species variation to investigate how it may lead to among-species divergence in SDMs.

Review of sex determination in C. elegans

Several recent reviews describe both germline and somatic sex determination in detail

(e.g., Ellis, 2008; Wolff & Zarkower, 2008). Here, I provide a brief overview of how the sex determination pathway functions in this species, focusing on the aspects that are most relevant for chapters 2-4, specifically, regulation of tra-2.

C. elegans is androdioecious; that is, individuals may be either males or hermaphrodites. Hermaphrodites may not transfer sperm to others; they can only self-fertilize or receive sperm from males. Self-sperm is produced during the L3 stage of development, 11 followed by a switch to oogenesis in L4, after which only oocytes are produced. The primary determiner of sex is the X:autosome ratio, which is assessed by a number of autosomal and

X-linked signal elements (Carmi et al., 1998; Hodgkin et al., 1994; Nicoll et al., 1997;

Powell et al., 2005; Skipper et al., 1999), triggering a series of inhibitory genetic interactions

(see Figure 2.1). These signal elements determine expression levels of the xol-1 gene, which is active in XO animals and expressed at only low levels in XX animals (Luz et al., 2003;

Miller et al., 1988; Rhind et al., 1995). Although its primary function is in XO animals, xol-1 also has an important but poorly understood feminizing function in XX worms (Miller et al.,

1988). When active, xol-1 inhibits the activity of the sdc genes, which both initiate dosage compensation in XX animals and repress her-1 (DeLong et al., 1993; Nusbaum & Meyer,

1989; Villeneuve & Meyer, 1987).

her-1, a masculinizing gene, regulates tra-2; HER-1 is a secreted protein that binds to

TRA-2A, a transmembrane receptor whose activity is inhibited by its ligand (Hamaoka et al.,

2004; Hunter & Wood, 1992; Kuwabara, 1996; Perry et al., 1993). tra-2 function is enhanced by tra-3 and sel-10 (Barnes & Hodgkin, 1996; Jager et al., 2004; Sokol & Kuwabara, 2000).

In particular, TRA-3 protein cleaves and releases the intracellular domain of TRA-2A, enhancing its feminizing activity. In addition, translational regulation of tra-2 by laf-1 is important for both somatic and germline sex determination (Goodwin et al., 1997; Hubert &

Anderson, 2009). tra-2, when active, then regulates tra-1 through two distinct pathways.

First, tra-2 inhibits a complex composed of the gene products of fem-1, fem-2, and fem-3, along with cul-2 (Ahringer et al., 1992; Gaudet et al., 1996; Mehra et al., 1999); this complex post-translationally inhibits tra-1 (deBono et al., 1995; Hodgkin, 1980; Hodgkin, 1987; 12

Schvarstein & Spence, 2006; Starostina et al., 2007; Zarkower & Hodgkin, 1992), and therefore, tra-2 activates tra-1 by its action through these intermediates. The intracellular portion of TRA-2A also interacts with the TRA-1A product directly; this interaction has a feminizing function in the soma, but is also required for spermatogenesis in hermaphrodites

(Doniach, 1986; Lum et al., 2000; Wang & Kimble, 2001).

In the soma, tra-1 is the final regulator of sexual fate. A transcription factor, this gene controls the expression of a variety of genes involved in sexual differentiation (e.g., Conradt

& Horvitz, 1999; Mason et al., 2008; Peden et al., 2007; Schwartz & Horvitz, 2007; Yi et al.,

2000). In the germline, however, the story is not so simple, as tra-1 is not the final regulator of germline cell fate, because several additional interactions are necessary for spermatogenesis in hermaphrodites (Ellis, 2008). First, as mentioned above, the direct interaction between TRA-2A and TRA-1A is essential for spermatogenesis. Second, tra-2 is translationally regulated to transiently inhibit oogenesis and allow sperm production for self- fertility. This outcome is primarily achieved by the coordinated action of the GLD-1 and

FOG-2 proteins, which together bind tra-2 transcripts and block their translation (Clifford et al., 2000; Goodwin et al., 1993; Jan et al., 1999; Nayak et al., 2005; Schedl & Kimble, 1988).

Finally, the control of TRA-2 degradation by RPN-10 is important for hermaphrodite spermatogenesis as well (Shimada et al., 2006).

Interestingly, though spermatogenesis in C. briggsae also relies on tra-2 regulation, it is achieved quite differently. The fem genes apparently are not required for hermaphrodite spermatogenesis, for instance (Hill et al., 2006), and the exact role of fem-2 is subtly distinct

(Hill & Haag, 2009). Most strikingly, C. briggsae lacks fog-2 entirely (Nayak et al., 2005), 13 instead regulating tra-2 through a gene called she-1 (Guo et al., 2009). These two differences support the hypothesis that self-fertility evolved independently in these congeneric two species (Kiontke et al., 2004), again highlighting Caenorhabditis as a very useful system in which to examine SDM evolution.

References

Ahringer, J., Rosenquist, T. A., Lawson, D. N. & Kimble, J. 1992. The Caenorhabditis elegans sex-determining gene fem-3 is regulated post-transcriptionally. EMBO Journal 11: 2303-2310. Baird, S. E. 2002. Haldane's rule by sexual transformation in Caenorhabditis. Genetics 161: 1349-1353. Baldi, C., Cho, S. & Ellis, R. E. 2009. Mutations in two independent pathways are sufficient to create hermaphroditic nematodes. Science 326: 1002-1005. Barnes, T. M. & Hodgkin, J. 1996. The tra-3 sex determination gene of Caenorhabditis elegans encodes a member of the calpain regulatory protease family. EMBO Journal 15: 4477-4484. Barske, L. A. & Capel, B. 2008. Blurring the edges in vertebrate sex determination. Current Opinion in Genetics & Development 18: 499-505. Basolo, A. L. 1994. The dynamics of Fisherian sex-ratio evolution: theoretical and experimental investigations. American Naturalist 144: 473-490. Berec, L., Schembri, P. J. & Boukal, D. S. 2005. Sex determination in Bonellia viridis (Echiura : Bonelliidae): population dynamics and evolution. Oikos 108: 473-484. Blackmore, M. S. & Charnov, E. L. 1989. Adaptive variation in environmental sex determination in a nematode. American Naturalist 134: 817-823. Bulmer, M. G. & Bull, J. J. 1982. Models of polygenic sex determination and sex-ratio control. Evolution 36: 13-26. Carmi, I., Kopczynski, J. B. & Meyer, B. J. 1998. The nuclear hormone receptor SEX-1 is an X-chromosome signal that determines nematode sex. Nature 396: 168-173. Carvalho, A. B., Sampaio, M. C., Varandas, F. R. & Klaczko, L. B. 1998. An experimental demonstration of Fisher's principle: Evolution of sexual proportion by natural selection. Genetics 148: 719-731. Caubet, Y., Hatcher, M. J., Mocquard, J. P. & Rigaud, T. 2000. Genetic conflict and changes in heterogametic mechanisms of sex determination. Journal of Evolutionary Biology 13: 766-777. Charlat, S., Hornett, E. A., Fullard, J. H., Davies, N., Roderick, G. K., Wedell, N. & Hurst, G. D. 2007. Extraordinary flux in sex ratio. Science 317: 214. Charlesworth, D. 2008. Evolutionary genetics: Changed sex determination in honeybees. Current Biology 18: R610-R612. 14

Charnov, E. L. & Bull, J. 1977. When is sex environmentally determined? Nature 266: 828-30. Cho, S., Huang, Z. Y. & Zhang, J. Z. 2007. Sex-specific splicing of the honeybee doublesex gene reveals 300 million years of evolution at the bottom of the insect sex- determination pathway. Genetics 177: 1733-1741. Clifford, R., Lee, M. H., Nayak, S., Ohmachi, M., Giorgini, F. & Schedl, T. 2000. FOG-2, a novel F-box containing protein, associates with the GLD-1 RNA binding protein and directs male sex determination in the C. elegans hermaphrodite germline. Development 127: 5265-5276. Conover, D. O. & Van Voorhees, D. A. 1990. Evolution of a balanced sex ratio by frequency- dependent selection in a fish. Science 250: 1556-1558. Conover, D. O., Vanvoorhees, D. A. & Ehtisham, A. 1992. Sex-ratio selection and the evolution of environmental sex determination in laboratory populations of Menidia menidia. Evolution 46: 1722-1730. Conradt, B. & Horvitz, H. R. 1999. The TRA-1A sex determination protein of C. elegans regulates sexually dimorphic cell deaths by repressing the egl-1 cell death activator gene. Cell 98: 317-327. Cotton, S. & Wedekind, C. 2007. Introduction of Trojan sex chromosomes to boost population growth. Journal of Theoretical Biology 249: 153-161. Cotton, S. & Wedekind, C. 2009. Population consequences of environmental sex reversal. Conservation Biology 23: 196-206. deBono, M. & Hodgkin, J. 1996. Evolution of sex determination in Caenorhabditis: Unusually high divergence of tra-1 and its functional consequences. Genetics 144: 587-595. deBono, M., Zarkower, D. & Hodgkin, J. 1995. Dominant feminizing mutations implicate protein-protein interactions as the main mode of regulation of the nematode sex- determining gene tra-1. Genes & Development 9: 155-167. DeLong, L., Plenefisch, J. D., Klein, R. D. & Meyer, B. J. 1993. Feedback control of sex determination by dosage compensation revealed through Caenorhabditis elegans sdc-3 mutations. Genetics 133: 875-96. Doniach, T. 1986. Activity of the sex-determining gene tra-2 is modulated to allow spermatogenesis in the C. elegans hermaphrodite. Genetics 114: 53-76. Dubendorfer, A., Hediger, M., Burghardt, G. & Bopp, D. 2002. Musca domestica, a window on the evolution of sex-determining mechanisms in insects. International Journal of Developmental Biology 46: 75-79. Ellis, R. E. 2008. Sex determination in the Caenorhabditis elegans germ line. Current Topics in Developmental Biology 83: 41-64. Ewert, M. A., Lang, J. W. & Nelson, C. E. 2005. Geographic variation in the pattern of temperature-dependent sex determination in the American snapping turtle (Chelydra serpentina). Journal of Zoology 265: 81-95. Ezaz, T., Quinn, A. E., Sarre, S. D., O'Meally, D., Georges, A. & Graves, J. A. M. 2009. Molecular marker suggests rapid changes of sex-determining mechanisms in 15

Australian dragon lizards. Chromosome Research 17: 91-98. Feldmeyer, B., Kozielska, M., Kuijper, B., Weissing, F. J., Beukeboom, L. W. & Pen, I. 2008. Climatic variation and the geographical distribution of sex-determining mechanisms in the housefly. Evolutionary Ecology Research 10: 797-809. Fisher, R. A. 1930. The Genetical Theory of Natural Selection. Clarendon Press, Oxford. Gaudet, J., VanderElst, I. & Spence, A. M. 1996. Post-transcriptional regulation of sex determination in Caenorhabditis elegans: Widespread expression of the sex- determining gene fem-1 in both sexes. Molecular Biology of the Cell 7: 1107-1121. Girondot, M., Zaborski, P., Servan, J. & Pieau, C. 1994. Genetic contribution to sex determination in turtles with environmental sex determination. Genetical Research 63: 117-127. Goodwin, E. B., Hofstra, K., Hurney, C. A., Mango, S. & Kimble, J. 1997. A genetic pathway for regulation of tra-2 translation. Development 124: 749-758. Goodwin, E. B., Okkema, P. G., Evans, T. C. & Kimble, J. 1993. Translational regulation of tra-2 by its 3’ untranslated region controls sexual identity in C. elegans. Cell 75: 329-339. Graustein, A., Gaspar, J. M., Walters, J. R. & Palopoli, M. F. 2002. Levels of DNA polymorphism vary with mating system in the nematode genus Caenorhabditis. Genetics 161: 99-107. Graves, J. A. M. 1998. Evolution of the mammalian Y chromosome and sex-determining genes. Journal of Experimental Zoology 281: 472-481. Guo, Y. Q., Lang, S. & Ellis, R. E. 2009. Independent recruitment of F-box genes to regulate hermaphrodite development during nematode evolution. Current Biology 19: 1853-1860. Gutierrez, J. B. & Teem, J. L. 2006. A model describing the effect of sex-reversed YY fish in an established wild population: The use of a Trojan Y chromosome to cause extinction of an introduced exotic species. Journal of Theoretical Biology 241: 333-341. Haag, E. S., Wang, S. P. & Kimble, J. 2002. Rapid coevolution of the nematode sex- determining genes fem-3 and tra-2. Current Biology 12: 2035-2041. Haldane, J. B. 1922. Sex ratio and unisexual sterility in hybrid animals. Journal of Genetics 12: 101-109. Hamaoka, B. Y., Dann, C. E., Geisbrecht, B. V. & Leahy, D. J. 2004. Crystal structure of Caenorhabditis elegans HER-1 and characterization of the interaction between HER-1 and TRA-2A. Proceedings of the National Academy of Sciences of the United States of America 101: 11673-11678. Hasselmann, M., Gempe, T., Schiott, M., Nunes-Silva, C. G., Otte, M. & Beye, M. 2008. Evidence for the evolutionary nascence of a novel sex determination pathway in honeybees. Nature 454: 519-U7. Hediger, M., Burghardt, G., Siegenthaler, C., Buser, N., Hilfiker-Kleiner, D., Dubendorfer, A. & Bopp, D. 2004. Sex determination in Drosophila melanogaster and Musca domestica converges at the level of the terminal regulator doublesex. Development 16

Genes and Evolution 214: 29-42. Hediger, M., Henggeler, C., Meier, N., Perez, R., Saccone, G. & Bopp, D. 2010. Molecular characterization of the key switch F provides a basis for understanding the rapid divergence of the sex-determining pathway in the housefly. Genetics 184: 155-170. Hill, R. C., de Carvalho, C. E., Salogiannis, J., Schlager, B., Pilgrim, D. & Haag, E. S. 2006. Genetic flexibility in the convergent evolution of hermaphroditism in Caenorhabditis nematodes. Developmental Cell 10: 531-8. Hill, R. C. & Haag, E. S. 2009. A sensitized genetic background reveals evolution near the terminus of the Caenorhabditis germline sex determination pathway. Evolution & Development 11: 333-342. Hodgkin, J. 1980. More sex-determination mutants of Caenorhabditis elegans. Genetics 96: 649-64. Hodgkin, J. 1987. Primary sex determination in the nematode C. elegans. Development 101: 5-16. Hodgkin, J. 2002. Exploring the envelope: Systematic alteration in the sex-determination system of the nematode Caenorhabditis elegans. Genetics 162: 767-780. Hodgkin, J., Zellan, J. D. & Albertson, D. G. 1994. Identification of a candidate primary sex determination locus, fox-1, on the x-chromosome of Caenorhabditis elegans. Development 120: 3681-3689. Hubert, A. & Anderson, P. 2009. The C. elegans sex determination gene laf-1 encodes a putative DEAD-box RNA helicase. Developmental Biology 330: 358-67. Hughes, J. F., Skaletsky, H., Pyntikova, T., Graves, T. A., van Daalen, S. K. M., Minx, P. J., Fulton, R. S., McGrath, S. D., Locke, D. P., Friedman, C., Trask, B. J., Mardis, E. R., Warren, W. C., Repping, S., Rozen, S., Wilson, R. K. & Page, D. C. 2010. Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content. Nature 463: 536-539. Hunter, C. P. & Wood, W. B. 1992. Evidence from mosaic analysis of the masculinizing gene her-1 for cell-interactions in C. elegans sex determination. Nature 355: 551-555. Jager, S., Schwartz, H. T., Horvitz, H. R. & Conradt, B. 2004. The Caenorhabditis elegans F- box protein SEL-10 promotes female development and may target FEM-1 and FEM-3 for degradation by the proteasome. Proceedings of the National Academy of Sciences of the United States of America 101: 12549-12554. Jan, E., Motzny, C. K., Graves, L. E. & Goodwin, E. B. 1999. The STAR protein, GLD-1, is a translational regulator of sexual identity in Caenorhabditis elegans. EMBO Journal 18: 258-269. Janes, D. E. & Wayne, M. L. 2006. Evidence for a genotype X environment interaction in sex-determining response to incubation temperature in the leopard gecko, Eublepharis macularius. Herpetologica 62: 56-62. Janzen, F. J. 1992. Heritable variation for sex-ratio under environmental sex determination in the common snapping turtle (Chelydra serpentina). Genetics 131: 155-161. Janzen, F. J. & Krenz, J. G. (2004) Phylogenetics: Which was first, TSD or GSD? In: Temperature-Dependent Sex Determination in Vertebrates, (Valenzuela, N. & Lance, 17

V. A., eds.). pp. 121-130. Smithsonian Books, Washington, D.C. Janzen, F. J. & Phillips, P. C. 2006. Exploring the evolution of environmental sex determination, especially in reptiles. Journal of Evolutionary Biology 19: 1775-1784. Kallman, K. D. 1968. Evidence for the existence of transformer genes for sex in the teleost Xiphophorus maculatus. Genetics 60: 811-28. King, V., Goodfellow, P. N., Wilkerson, A. J. P., Johnson, W. E., O'Brien, S. J. & Pecon- Slattery, J. 2007. Evolution of the male-determining gene SRY within the cat family Felidae. Genetics 175: 1855-1867. Kiontke, K., Gavin, N. P., Raynes, Y., Roehrig, C., Piano, F. & Fitch, D. H. A. 2004. Caenorhabditis phylogeny predicts convergence of hermaphroditism and extensive intron loss. Proceedings of the National Academy of Sciences of the United States of America 101: 9003-9008. Kondo, M., Nanda, I., Hornung, U., Schmid, M. & Schartl, M. 2004. Evolutionary origin of the medaka Y chromosome. Current Biology 14: 1664-1669. Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P. & Lovell-Badge, R. 1991. Male development of chromosomally female mice transgenic for Sry. Nature 351: 117-21. Korpelainen, H. 1998. Labile sex expression in plants. Biological Reviews 73: 157-180. Kozielska, M., Pen, I., Beukeboom, L. W. & Weissing, F. J. 2006. Sex ratio selection and multi-factorial sex determination in the housefly: a dynamic model. Journal of Evolutionary Biology 19: 879-888. Kozielska, M., Weissing, F. J., Beukeboom, L. W. & Pen, I. 2009. Segregation distortion and the evolution of sex-determining mechanisms. Heredity 104: 100-112. Kuwabara, P. E. 1996. A novel regulatory mutation in the C. elegans sex determination gene tra-2 defines a candidate ligand/receptor interaction site. Development 122: 2089-2098. Lum, D. H., Kuwabara, P. E., Zarkower, D. & Spence, A. M. 2000. Direct protein-protein interaction between the intracellular domain of TRA-2 and the transcription factor TRA-1A modulates feminizing activity in C. elegans. Genes & Development 14: 3153-3165. Luz, J. G., Hassig, C. A., Pickle, C., Godzik, A., Meyer, B. J. & Wilson, I. A. 2003. XOL-1, primary determinant of sexual fate in C. elegans, is a GHMP kinase family member and a structural prototype for a class of developmental regulators. Genes & Development 17: 977-990. Mank, J. E. & Avise, J. C. 2009. Evolutionary diversity and turn-over of sex determination in teleost fishes. Sexual Development 3: 60-67. Mank, J. E., Promislow, D. E. L. & Avise, J. C. 2006. Evolution of alternative sex- determining mechanisms in teleost fishes. Biological Journal of the Linnean Society 87: 83-93. Mason, D. A., Rabinowitz, J. S. & Portman, D. S. 2008. dmd-3, a doublesex-related gene regulated by tra-1, governs sex-specific morphogenesis in C. elegans. Development 135: 2373-82. Mehra, A., Gaudet, J., Heck, L., Kuwabara, P. E. & Spence, A. M. 1999. Negative regulation 18

of male development in Caenorhabditis elegans by a protein-protein interaction between TRA-2A and FEM-3. Genes & Development 13: 1453-1463. Meise, M., Hilfiker-Kleiner, D., Dubendorfer, A., Brunner, C., Nothiger, R. & Bopp, D. 1998. Sex-lethal, the master sex-determining gene in Drosophila, is not sex-specifically regulated in Musca domestica. Development 125: 1487-1494. Miller, D., Summers, J. & Silber, S. 2004. Environmental versus genetic sex determination: a possible factor in dinosaur extinction? Fertility and Sterility 81: 954-64. Miller, L. M., Plenefisch, J. D., Casson, L. P. & Meyer, B. J. 1988. xol-1: a gene that controls the male modes of both sex determination and X-chromosome dosage compensation in C. elegans. Cell 55: 167-183. Miller, S. W., Hayward, D. C., Bunch, T. A., Miller, D. J., Ball, E. E., Bardwell, V. J., Zarkower, D. & Brower, D. L. 2003. A DM domain protein from a coral, Acropora millepora, homologous to proteins important for sex determination. Evolution & Development 5: 251-258. Mitchell, N. J., Kearney, M. R., Nelson, N. J. & Porter, W. P. 2008. Predicting the fate of a living fossil: how will global warming affect sex determination and hatching phenology in tuatara? Proceedings of the Royal Society B-Biological Sciences 275: 2185-2193. Mittwoch, U. 2000. Three thousand years of questioning sex determination. Cytogenetics and Cell Genetics 91: 186-191. Morran, L. T., Parmenter, M. D. & Phillips, P. C. 2009. Mutation load and rapid adaptation favour outcrossing over self-fertilization. Nature 462: 350-352. Nayak, S., Goree, J. & Schedl, T. 2005. fog-2 and the evolution of self-fertile hermaphroditism in Caenorhabditis. PLoS Biology 3: 57-71. Nicoll, M., Akerib, C. C. & Meyer, B. J. 1997. X-chromosome-counting mechanisms that determine nematode sex. Nature 388: 200-204. Nusbaum, C. & Meyer, B. J. 1989. The Caenorhabditis elegans gene sdc-2 controls sex determination and dosage compensation in XX animals. Genetics 122: 579-93. Ogata, M., Hasegawa, Y., Ohtani, H., Mineyama, M. & Miura, I. 2008. The ZZ/ZW sex- determining mechanism originated twice and independently during evolution of the frog, Rana rugosa. Heredity 100: 92-99. Ogata, M., Ohtani, H., Igarashi, T., Hasegawa, Y., Ichikawa, Y. & Miura, I. 2003. Change of the heterogametic sex from male to female in the frog. Genetics 164: 613-620. Organ, C. L., Janes, D. E., Meade, A. & Pagel, M. 2009. Genotypic sex determination enabled adaptive radiations of extinct marine reptiles. Nature 461: 389-392. Pane, A., De Simone, A., Saccone, G. & Polito, C. 2005. Evolutionary conservation of Ceratitis capitata transformer gene function. Genetics 171: 615-624. Peden, E., Kimberly, E., Gengyo-Ando, K., Mitani, S. & Xue, D. 2007. Control of sex- specific apoptosis in C. elegans by the BarH homeodomain protein CEH-30 and the transcriptional repressor UNC-37/Groucho. Genes & Development 21: 3195-3207. Perry, M. D., Li, W. Q., Trent, C., Robertson, B., Fire, A., Hageman, J. M. & Wood, W. B. 1993. Molecular characterization of the her-1 gene suggests a direct role in cell 19

signaling during Caenorhabditis elegans sex determination. Genes & Development 7: 216-228. Pokorna, M. & Kratochvil, L. 2009. Phylogeny of sex-determining mechanisms in squamate reptiles: are sex chromosomes an evolutionary trap? Zoological Journal of the Linnean Society 156: 168-183. Pomiankowski, A., Nothiger, R. & Wilkins, A. 2004. The evolution of the Drosophila sex- determination pathway. Genetics 166: 1761-1773. Powell, J. R., Jow, M. M. & Meyer, B. J. 2005. The T-box transcription factor SEA-1 is an autosomal element of the X : A signal that determines C. elegans sex. Developmental Cell 9: 339-349. Radder, R. S., Quinn, A. E., Georges, A., Sarre, S. D. & Shine, R. 2008. Genetic evidence for co-occurrence of chromosomal and thermal sex-determining systems in a lizard. Biology Letters 4: 176-8. Raymond, C. S., Shamu, C. E., Shen, M. M., Seifert, K. J., Hirsch, B., Hodgkin, J. & Zarkower, D. 1998. Evidence for evolutionary conservation of sex-determining genes. Nature 391: 691-5. Rhen, T. & Lang, J. W. 1998. Among-family variation for environmental sex determination in reptiles. Evolution 52: 1514-1520. Rhind, N. R., Miller, L. M., Kopczynski, J. B. & Meyer, B. J. 1995. xol-1 acts as an early switch in the C. elegans male/hermaphrodite decision. Cell 80: 71-82. Roberts, R. B., Ser, J. R. & Kocher, T. D. 2009. Sexual conflict resolved by invasion of a novel sex determiner in Lake Malawi cichlid fishes. Science 326: 998-1001. Saccone, G., Peluso, I., Artiaco, D., Giordano, E., Bopp, D. & Polito, L. C. 1998. The Ceratitis capitata homologue of the Drosophila sex-determining gene Sex-lethal is structurally conserved, but not sex-specifically regulated. Development 125: 1495-1500. Sarre, S. D., Georges, A. & Quinn, A. 2004. The ends of a continuum: genetic and temperature-dependent sex determination in reptiles. Bioessays 26: 639-645. Scali, C., Catteruccia, F., Li, Q. X. & Crisanti, A. 2005. Identification of sex-specific transcripts of the Anopheles gambiae doublesex gene. Journal of Experimental Biology 208: 3701-3709. Schedl, T. & Kimble, J. 1988. fog-2, a germ-line-specific sex determination gene required for hermaphrodite spermatogenesis in Caenorhabditis elegans. Genetics 119: 43-61. Schvarzstein, M. & Spence, A. M. 2006. The C. elegans sex-determining GLI protein TRA-1A is regulated by sex-specific proteolysis. Developmental Cell 11: 733-740. Schwartz, H. T. & Horvitz, H. R. 2007. The C. elegans protein CEH-30 protects male- specific neurons from apoptosis independently of the Bcl-2 homolog CED-9. Genes & Development 21: 3181-94. Ser, J. R., Roberts, R. B. & Kocher, T. D. 2010. Multiple interacting loci control sex determination in Lake Malawi cichlid fish. Evolution 64: 486-501. Shimada, M., Kanematsu, K., Tanaka, K., Yokosawa, H. & Kawahara, H. 2006. Proteasomal ubiquitin receptor RPN-10 controls sex determination in Caenorhabditis elegans. 20

Molecular Biology of the Cell 17: 5356-5371. Skipper, M., Milne, C. A. & Hodgkin, J. 1999. Genetic and molecular analysis of fox-1, a numerator element involved in Caenorhabditis elegans primary sex determination. Genetics 151: 617-631. Smith, C. A., Roeszler, K. N., Ohnesorg, T., Cummins, D. M., Farlie, P. G., Doran, T. J. & Sinclair, A. H. 2009. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature 461: 267-271. Sokol, S. B. & Kuwabara, P. E. 2000. Proteolysis in Caenorhabditis elegans sex determination: cleavage of TRA-2A by TRA-3. Genes & Development 14: 901-906. Starostina, N. G., Lim, J. M., Schvarzstein, M., Wells, L., Spence, A. M. & Kipreos, E. T. 2007. A CUL-2 ubiquitin ligase containing three FEM proteins degrades TRA-1 to regulate C. elegans sex determination. Developmental Cell 13: 127-139. Stothard, P., Hansen, D. & Pilgrim, D. 2002. Evolution of the PP2C family in Caenorhabditis: Rapid divergence of the sex-determining protein FEM-2. Journal of Molecular Evolution 54: 267-282. Stothard, P. & Pilgrim, D. 2006. Conspecific and interspecific interactions between the FEM-2 and the FEM-3 sex-determining proteins despite rapid sequence divergence. Journal of Molecular Evolution 62: 281-291. Takehana, Y., Demiyah, D., Naruse, K., Hamaguchi, S. & Sakaizumi, M. 2007. Evolution of different Y chromosomes in two medaka species, Oryzias dancena and O. latipes. Genetics 175: 1335-1340. Takehana, Y., Hamaguchi, S. & Sakaizumi, M. 2008. Different origins of ZZ/ZW sex chromosomes in closely related medaka fishes, Oryzias javanicus and O. hubbsi. Chromosome Research 16: 801-811. Tarone, A. M., Nasser, Y. M. & Nuzhdin, S. V. 2005. Genetic variation for expression of the sex determination pathway genes in Drosophila melanogaster. Genetical Research 86: 31-40. Traut, W. 1994. Sex determination in the fly Megaselia scalaris, a model system for primary steps of sex chromosome evolution. Genetics 136: 1097-1104. Trivers, R. L. & Willard, D. E. 1973. Natural selection of parental ability to vary the sex ratio of offspring. Science 179: 90-2. Uller, T., Pen, I., Wapstra, E., Beukeboom, L. W. & Komdeur, J. 2007. The evolution of sex ratios and sex-determining systems. Trends in Ecology & Evolution 22: 292-297. Valenzuela, N., Adams, D. C. & Janzen, F. J. 2003. Pattern does not equal process: exactly when is sex environmentally determined? American Naturalist 161: 676-83. van Doorn, G. S. (2009) Intralocus Sexual Conflict. In: Year in Evolutionary Biology 2009, Vol. 1168. pp. 52-71 Annals of the New York Academy of Sciences. van Doorn, G. S. & Kirkpatrick, M. 2007. Turnover of sex chromosomes induced by sexual conflict. Nature 449: 909-912. Vandeputte, M., Dupont-Nivet, M., Chavanne, H. & Chatain, B. 2007. A polygenic hypothesis for sex determination in the European sea bass Dicentrarchus labrax. Genetics 176: 1049-1057. 21

Villeneuve, A. M. & Meyer, B. J. 1987. sdc-1: a link between sex determination and dosage compensation in C. elegans. Cell 48: 25-37. Vuilleumier, S., Lande, R., Van Alphen, J. J. M. & Seehausen, O. 2007. Invasion and fixation of sex-reversal genes. Journal of Evolutionary Biology 20: 913-920. Walthour, C. S. & Schaeffer, S. W. 1994. Molecular population genetics of sex determination genes: The transformer gene of Drosophila melanogaster. Genetics 136: 1367-1372. Wang, S. P. & Kimble, J. 2001. The TRA-1 transcription factor binds TRA-2 to regulate sexual fates in Caenorhabditis elegans. EMBO Journal 20: 1363-1372. Warner, D. A. & Shine, R. 2008. The adaptive significance of temperature-dependent sex determination in a reptile. Nature 451: 566-U5. Werren, J. H., Hatcher, M. J. & Godfray, H. C. J. 2002. Maternal-offspring conflict leads to the evolution of dominant zygotic sex determination. Heredity 88: 102-111. Whitfield, L. S., Lovellbadge, R. & Goodfellow, P. N. 1993. Rapid sequence evolution of the mammalian sex-determining gene Sry. Nature 364: 713-715. Wilkins, A. S. 1995. Moving up the hierarchy: A hypothesis on the evolution of a genetic sex determination pathway. Bioessays 17: 71-77. Wolff, J. R. & Zarkower, D. 2008. Somatic sexual differentiation in Caenorhabditis elegans. Current Topics in Developmental Biology 83: 1-39. Wu, Z., Hopper, K. R., Ode, P. J., Fuester, R. W., Tuda, M. & Heimpel, G. E. 2005. Single- locus complementary sex determination absent in Heterospilus prosopidis (Hymenoptera : Braconidae). Heredity 95: 228-234. Yi, W., Ross, J. M. & Zarkower, D. 2000. mab-3 is a direct tra-1 target gene regulating diverse aspects of C. elegans male sexual development and behavior. Development 127: 4469-4480. Zarkower, D. & Hodgkin, J. 1992. Molecular analysis of the C. elegans sex-determining gene tra-1: a gene encoding two zinc finger proteins. Cell 70: 237-249. Zhang, J. Z. 2004. Evolution of DMY, a newly emergent male sex-determination gene of medaka fish. Genetics 166: 1887-1895. 22

CHAPTER 2. THE EVOLUTION OF SEX-DETERMINING MECHANISMS: LESSONS FROM TEMPERATURE-SENSITIVE MUTATIONS IN SEX DETERMINATION GENES IN CAENORHABDITIS ELEGANS

A paper published in the Journal of Evolutionary Biology

Christopher H. Chandler, Patrick C. Phillips, and Fredric J. Janzen1

Abstract

Sexual reproduction is one of the most taxonomically conserved traits, yet sex- determining mechanisms are quite diverse. For instance, there are numerous forms of environmental sex determination, in which an organism’s sex is determined not by genotype, but by environmental factors during development. Important questions remain regarding transitions between sex-determining mechanisms, in part because the organisms exhibiting unique mechanisms often make difficult study organisms. One potential solution is to utilize mutant strains in model organisms better suited to answering these questions. We have characterized two such strains of the model nematode Caenorhabditis elegans. These strains harbor temperature-sensitive mutations in key sex-determining genes. We show that they display a sex ratio reaction norm in response to rearing temperature similar to other organisms with environmental sex determination. Next, we show that these mutations also cause deleterious pleiotropic effects on overall fitness. Finally, we show that these mutations are fundamentally different at the genetic sequence level. These strains will be a useful complement to naturally occurring taxa with environmental sex determination in future

1FJJ and PCP collected data on thermal sex ratio reaction norms, performed temperature-shift experiments, and provided feedback on this manuscript. CHC collected data on thermal sex ratio reaction norms, sequenced the mutant tra-2 allele, collected fitness data, performed data analysis, and wrote this manuscript. 23 research examining the molecular basis of and the selective forces driving evolutionary transitions between sex determination mechanisms.

Introduction

Sexual reproduction is one of the most taxonomically conserved traits, but, paradoxically, the mechanisms that determine sex are incredibly diverse (Haag & Doty,

2005). These sex-determining mechanisms (SDMs) can be broadly grouped into two main categories: genotypic sex determination (GSD), whereby an individual’s sex is determined at conception by its genotype; and environmental sex determination (ESD), whereby an individual’s sex is determined by some environmental cue, such as temperature or light, during development.

Much progress has been made in understanding the evolutionary maintenance of each of these categories of SDMs. GSD, for instance, should be advantageous because most GSD systems easily maintain a 1 : 1 primary sex ratio due to the segregation of genetic factors

(e.g., sex chromosomes) during meiosis (Janzen & Phillips, 2006). Likewise, adaptive hypotheses for the maintenance of ESD are also well supported in many taxa, although there are some exceptions, notably the case of many reptiles with temperature-dependent sex determination (TSD; Janzen & Phillips, 2006; however, see Warner & Shine, 2008). In general, ESD appears to be favored when it maximizes offspring fitness by producing each sex only in its optimal developmental environment. In the Atlantic silverside (Menidia menidia), for example, fish born in the cool waters of the early breeding season develop as females, while those born in later warm waters grow up to be males (Conover & Heins, 24

1987). ESD is adaptive in this species because the longer growing season afforded to the female fish allows them to reach a larger size by the time breeding occurs, and a size advantage is more beneficial to females than it is to males (Conover & Heins, 1987).

On the other hand, the evolutionary origins of SDMs and the selective pressures that drive transitions between SDMs are not as well understood. What we do know is that such transitions happen much more frequently than one might intuitively expect (although sex determination in some taxa, such as mammals and birds, appears to be conserved; Mank et al., 2006). For instance, phylogenetic analysis indicates that there have been at least three independent switches from GSD to ESD in lizards and six transitions from ESD to GSD in turtles (Janzen & Krenz, 2004). Transitions between different SDMs within the same broad category (e.g., between male heterogamety and female heterogamety) are also common

(Mank et al., 2006). The high rate at which these transitions occur highlights our lack of understanding of this important aspect of evolutionary biology.

Two important questions remain. First, why do transitions between SDMs occur? In other words, what selective forces, if any, drive these changes, and what obstacles to the fixation of new SDMs must be overcome? This question has been investigated in previous theoretical studies, which suggest that sex-ratio selection (Bull, 1983; Bulmer & Bull, 1982;

Wilkins, 1995), sexual selection (Pomiankowski et al., 2004), and parent-offspring genomic conflict (Uller et al., 2007) may all be important factors in driving evolutionary changes in

SDMs. However, empirical support is sorely lacking. For instance, it is unclear whether the underlying assumption in many of Bull’s (1983) models that mutations affecting sex 25 determination have no pleiotropic fitness effects is biologically realistic. Furthermore, other theoretical studies make conflicting predictions. For instance, Van Dooren & Leimar (2003) showed that the conditions previously hypothesized to cause a switch from ESD to GSD due to the invasion of genes with major effects on sex determination could also cause decreased canalization, or increased randomness, in sex determination. Similarly, another study has indicated that sex-ratio selection alone is not sufficient to cause a complete transition from one SDM to another (Kozielska et al., 2006).

The second question is, how do these transitions occur? What types of genetic changes lead to transitions from one SDM to another? For instance, relatively little is known about the genetic basis of ESD, specifically, how environmental signals exhibiting continuous variation are transduced into binary signals telling the organism to develop as a male or a female. It is also unknown whether the many taxa that independently evolved TSD and other forms of ESD utilize diverse molecular mechanisms to achieve environmental sensitivity, or whether this trait has evolved convergently. Hodgkin (2002) constructed several mutant strains of the nematode “worm” Caenorhabditis elegans exhibiting artificial

SDMs, including two exhibiting apparently TSD-like patterns, suggesting that sex determination may be altered in many different ways. However, not all of these mutations have been characterized at the sequence level, and the phenotypes of the TSD-like strains have not been characterized in detail.

Clear answers to these questions have eluded biologists mainly due to the lack of a suitable model system. The few species exhibiting natural variation in sex determination have 26 offered some insight but still suffer from shortcomings. For instance, the molecular genetics of sex determination in the platyfish (Xiphophorus maculatus) are only beginning to be understood (e.g., Veith et al., 2003), and the most popular hypothesis regarding the selective pressures influencing variation in sex determination in the housefly (Musca domestica)—that a latitudinal gradient in sex chromosome distribution is due to sex-linked variation in insecticide resistance—is unsupported (Hamm et al., 2005).

Where, then, should we turn? One possible approach is to use mutants generated in the laboratory by genetic studies in model organisms. The mutant C. elegans strains constructed by Hodgkin (2002) are an excellent example. This species is ideally suited to experimental studies of the evolution of sex determination for several reasons: it is easily and inexpensively reared in the lab at very large population sizes; its extremely short generation times (3-4 days at 20°C) allow for the propagation of many generations in short periods; its genome is sequenced and many molecular tools have been developed for it; its sex determination pathway has been thoroughly studied; many mutant strains are readily available; and populations can be frozen, stored, and thawed years later (Stiernagle, 2006).

Here, we explore some of these unanswered questions about SDMs using the two

TSD-like mutant strains of C. elegans initially described in Hodgkin (2002). We show that they exhibit phenotypic patterns remarkably similar to those seen in reptiles with TSD, demonstrating that this system can be used as a model to study the evolution of ESD. We also further characterize this system by testing for pleiotropic effects of these mutations on one component of overall organismal fitness, and by sequence analysis of the mutant alleles. 27

Materials & Methods

Study species and strains

Caenorhabditis elegans is an androdioecious species, with populations consisting of self-fertilizing hermaphrodites and outcrossing males. In lab populations, hermaphrodites vastly outnumber males, which are maintained at approximately the frequency of spontaneous non-disjunction of the X-chromosome (0.1% - 0.2%) (Stewart & Phillips, 2002).

Worms go through four larval stages during development, designated L1-L4, each one ending with a molt. If conditions are crowded or food is scarce, worms can enter an alternative to the L3 stage called the dauer, in which worms can survive for months, subsequently entering the L4 stage when conditions are right. Although there are a few differences between the sexes in patterns of cell division during embryogenesis, most sex- specific traits develop after embryogenesis, during these larval stages (Herman, 2005).

In wild-type worms, sex is determined by the ratio of X-chromosomes to autosomes

(Goodwin & Ellis, 2002). In XX worms, a cascade of inhibitory interactions is triggered that ultimately promotes expression of tra-1, the terminal regulator in the global sex determination pathway (Figure 1). High levels of tra-1 lead to hermaphrodite/female development. In XO worms, the pathway ultimately suppresses tra-1 expression, thereby promoting male development (Figure 1).

We used strains CB5362 [tra-2(ar221); xol-1(y9); XX] and CB6415 [dpy-26(n199); her-1(e1561); XO], generously provided to us by J. Hodgkin. Background information on strain CB5362 is described in Hodgkin (2002), and CB6415 is an independent construction 28 of CB3674, also described in Hodgkin (2002). CB5362 worms are XX and possess a temperature-sensitive mutation in tra-2, causing male development at high temperatures, and a loss-of-function mutation in xol-1, enhancing the tra-2 sex reversal and killing XO individuals (i.e., males derived by GSD rather than TSD). CB6415 worms are XO and possess a temperature-sensitive mutation in her-1, causing hermaphrodite development at high temperatures, and a loss-of-function mutation in dpy-26, killing XX worms (i.e., GSD females).

Worms were maintained according to standard lab protocols (Stiernagle, 2006). Stock worm cultures were maintained in 10-cm petri plates containing NGM Lite (US Biological) seeded with a lawn of OP50 E. coli. Worms were transferred to new plates every 4-7 days by cutting a ~2.5 cm2 chunk of agar and placing it face down on a new plate.

Measuring thermal reaction norms for sex ratio

We obtained age-synchronized populations of worms from plates containing many unhatched eggs according to standard protocols (Stiernagle, 2006). Briefly, we washed worms and eggs off plates and treated the resulting suspension with a bleach and NaOH solution, killing all adults and larvae but leaving eggs unaffected. Suspensions were incubated for 24h, and the following day the density of live L1 larvae was estimated. We pipetted approximately 100-150 larvae onto 10-cm Petri plates seeded with a lawn of OP50

E. coli. These plates were then wrapped in parafilm and placed in incubators at various temperatures until worms reached adulthood. Approximately 100 adult worms from each plate were scored for sex, and the sex ratio of each plate was calculated. We scored sex ratio 29 for ten plates at each developmental temperature and constructed a plot of sex ratio vs. temperature. To test how sex ratio varies with rearing temperature, we used generalized linear models with a logit link function and a binomial error distribution. In these models, we treated temperature as a categorical variable because we measured sex ratio at only four temperatures for each strain, and because plots of residuals versus predicted values indicated that residuals were not normally distributed around zero when temperature was treated as a continuous variable. Statistical analyses were performed using SAS v. 9.1.3 (SAS Institute

Inc., Cary, NC), and the significance of the overall temperature effect was obtained using the

CONTRAST statement.

Temperature-shift experiments

We performed temperature-shift experiments to determine the thermosensitive period of development in which sex is determined in strain CB5362. Worms were bleached and placed onto plates, and deposited into incubators as described above. In the forward shift experiment, worms were initially reared at a hermaphrodite producing temperature (15°C), but each plate was switched to a male-producing temperature (20°C) at some point in development. In the back shift experiment, worms began development at a male-producing temperature (20°C) but were later switched to a hermaphrodite-producing temperature

(15°C). To evaluate the thermosensitive period, we plotted the sex ratio as a function of the developmental stage at which the temperature was switched; the thermosensitive period is the sloping part of this curve. Statistical significance was assessed in SAS v. 9.1.3 (SAS Institute

Inc., Cary, NC) using generalized linear models with sex ratio as the response variable and 30 the timing of the temperature switch as the independent variable, again treated categorically, and using a logit link function and a binomial error distribution.

Fitness assays

Separately, we also measured the fitness of each strain, using total lifetime offspring production as a proxy for fitness because it is not dependent on developmental timing and is therefore independent of temperature, allowing us to make comparisons across temperatures as well as among strains. Although this measure does not account for natural selection acting on larvae prior to counting, it has been successfully employed in previous studies (e.g. Estes

& Lynch, 2003). We performed assays using both temperature-sensitive strains as well as wild-type N2 worms at various temperatures. N2 worms are an appropriate wild-type control for comparison because the mutagenesis screens in which these mutations were originally isolated were performed in the N2 genetic background.

Prior to picking individual worms for fitness assays, populations were raised at the desired temperature for at least one generation. When worms were at the L4 larval stage, they were picked individually onto 5-cm plates seeded with a single drop of OP50 E. coli suspension. To measure hermaphrodite fitness, we allowed hermaphrodites to develop until they began depositing eggs. After oviposition began, we transferred worms to fresh plates every ~24 h until egg-laying ceased. We counted live larvae on the plates when they were big enough to be picked individually, using the total number of offspring produced as a measure of hermaphrodite fertility. To measure male fitness, we placed single L4 males onto plates with single fog-2 mutant females. Loss-of-function mutations in the fog-2 gene knock out 31 spermatogenesis in hermaphrodites, transforming them into females, ensuring that all offspring on the plate were sired by the male. We transferred both females and males together to fresh plates every 24 h, adding additional L4 females daily to ensure that male fitness measures were not limited by encounter rates with females or their supply of eggs. Again, we measured male fertility by counting living offspring. For CB5362 we were unable to obtain male fitness data at 23ºC or hermaphrodite data at 13ºC because those sexes were not produced at those temperatures. For CB6415, we were unable to obtain male data at 23ºC because few males were produced or at 13ºC because this strain grows very poorly at that temperature.

We explored statistical models to assess fitness differences among strains. Because our measure of fitness was a count, we initially used generalized linear models with a

Poisson error distribution. However, because of the number of excess zeros in our dataset, the

Poisson models suffered from severe overdispersion and were therefore a poor fit. We also tried mixed models using a zero-inflated Poisson distribution (Quintero et al., 2007), but these, too, were a poor fit. We therefore used randomization tests, implemented in R v. 2.6.2

(R Development Core Team; scripts available upon request) to compare the mean offspring production for each mutant strain against the wild-type N2 at each temperature; data from different temperatures were not combined because our analyses indicated that temperature had statistically significant effects on our measure of worm fitness (results not shown). These randomization tests make no assumptions about the distribution of the data. For each test, we computed the mean fitness of the wild-type and mutant worms and calculated the observed 32 difference between these means. We then randomized the data for 10,000 iterations to generate null distributions for these differences, which we used to calculate p-values and

95% confidence intervals.

Sequencing the mutant tra-2 allele in CB5362

We designed primers spanning the entire tra-2 gene and ~1.5kb of flanking sequence on either side of the gene from the wild-type sequence obtained from Wormbase (Bieri et al.,

2007) using the PCR Suite (http://www2.eur.nl/fgg/kgen/primer/), a tool that facilitates the design of overlapping primer sets using Primer3 (Rozen & Skaletsky, 2000). This resulted in

24 primer pairs whose product sizes ranged from 500-900 bp, with each set of primers overlapping with its neighbors by at least 100 bp. (Primer sequences are available upon request.) DNA was extracted from a pooled sample of thousands of CB5362 worms washed from a Petri plate using a Qiagen DNeasy Tissue Extraction Kit (Qiagen) and used as a template for PCR amplification with the primers we generated. PCR products were run on

1.5% agarose gels, and bands were cut using razor blades. PCR products were purified either from the cut bands using Qiagen spin columns or QIAEX II gel extraction kits (Qiagen); or directly from PCR reactions using ExoSAP-IT (USB Corporation). Purified PCR products were used as template for sequencing reactions using ABI Prism BigDye Terminator Cycle

Sequencing Ready Reaction Mix v3.0 (PE Applied Biosystems). Sequencing products were purified using Centri-Sep spin columns (Princeton Separations) and electrophoresed on an

ABI 3730 DNA Analyzer at the Iowa State University DNA Facility. Partial sequences were 33 assembled into one contiguous sequence by aligning against the wild-type tra-2 sequence from Wormbase in BioEdit v. 7.01 (Hall, 1999).

We used BioEdit to translate the mutant nucleotide sequence into an amino acid sequence, and compared the mutant nucleotide and amino acid sequences with the wild-type sequences obtained from WormBase. We also used PredictProtein (Rost et al., 2004) to predict the effects of the observed amino acid substitutions on the structure of the protein. We did not sequence the mutant her-1 allele in strain CB6415 because this allele has already been sequenced (Perry et al., 1994).

Results

Thermal reaction norms for sex ratio

Both strains showed a significant shift in sex ratio in response to rearing temperature

(CB5362: !2 = 7131.6, overall model P < 0.0001, Table 1; CB6415: !2 = 626.5, overall model

P < 0.0001, Table 2; Figure 2). Strain CB5362 produced nearly 100% hermaphrodites at temperatures below 15°C and nearly 100% males above 20°C. Strain CB6415 showed the opposite pattern, with around 80% males at 13°C and 20% males at 24°C.

Temperature-shift experiments

Temperature-shift experiments with strain CB5362 indicated that the sex ratio also varied significantly with the time at which the temperature switch occurred (forward shift: !2

= 2493.4, overall model P < 0.0001, Table 3; back shift: !2 = 1259.1, overall model P <

0.0001, Table 4). The thermosensitive period for sex determination in strain CB5362 occurs 34 from the late L1 phase to the late L3 phase (Figure 3), indicated by the sloping portion of the curves.

Fitness assays

Strain significantly affected worm fitness (Figure 4; Table 5). At nearly all temperatures, the temperature-sensitive mutations resulted in decreased fitness for both sexes, as measured by total offspring production.

Sequencing the tra-2 mutant allele

We identified one C " T nucleotide substitution in the tra-2 (ar221) allele, which caused a leucine to be substituted for a proline at amino acid residue 127 (Figure 5). This substitution occurs in an extracellular loop of the TRA-2A protein, a cell membrane receptor; this extracellular loop is thought to interact with HER-1 protein, a repressor of TRA-2A activity.

Discussion

In spite of roughly 30 years of active research on the ecology and evolution of TSD and SDMs in general, many important questions still remain. Particularly, we are only beginning to understand the selective forces causing, and the genetic basis of, evolutionary transitions from one SDM to another. The use of sex determination mutants such as the C. elegans strains described here shows great promise in the potential to advance research on these questions. Indeed, in just a short period of time, we have characterized this system in a way that took many years to accomplish in reptiles with TSD. 35

Our results indicate a remarkable similarity between the patterns of sex determination seen in our temperature-sensitive mutant strains of C. elegans and other organisms exhibiting

TSD. Strain CB5362 exhibited a pattern similar to that of reptiles exhibiting TSD type 1B, i.e., males at warmer temperatures and hermaphrodites/females at cooler temperatures, with a transitional range of temperatures (at which a mixed sex ratio is observed) of just a few degrees C (Figure 2). Temperature seems to exert its effects on sex determination relatively early in development in this strain (Figure 3), again resembling reptiles, in which the thermosensitive period is generally considered to occur during the middle third of embryonic development (Janzen & Paukstis, 1991). Strain CB6415, on the other hand, showed the opposite sex ratio reaction norm, resembling TSD type 1A, and showed a much larger transitional range of temperatures (Figure 2); we currently lack data regarding the thermosensitive period in this strain. The similarities between reptiles and our relatively simple mutant strains are striking, though vertebrates and C. elegans share few homologous genes in their sex determination cascades.

The differences seen between our two strains at the molecular level are also interesting. We found that strain CB5362 possesses a Pro"Leu mis-sense mutation at amino acid 127 of its tra-2 allele, likely altering the structure of the protein (Figure 5). This mutation occurs near the site of mutation in another known tra-2 allele that is insensitive to negative regulation by HER-1 (Kuwabara, 1996). Therefore, we hypothesize that the temperature-sensitive ar221 allele in strain CB5362 causes a conformational change in the 36 protein that mimics HER-1 binding at high temperatures, rendering the protein inactive and leading to male development.

In contrast, the temperature-sensitive e1561 allele of her-1 possessed by strain

CB6415 does not contain any amino acid substitutions at all; instead, this allele carries a temperature-sensitive promoter mutation (Perry et al., 1994). The mechanism causing the temperature-sensitivity of this mutation is unknown, but the genetic differences between our strains further support the hypothesis, proposed by previous researchers and already well supported by phylogenetic (e.g., Janzen & Krenz, 2004) and developmental data (e.g.,

Valenzuela et al., 2006), that TSD need not share a similar genetic basis or even be homologous in all other organisms, as well.

For TSD to evolve, the mutations that cause it must be able to persist and spread throughout populations. Our fitness data suggest that these mutants would face a potential hurdle to this process: at nearly all temperatures, our TSD-like worm strains produced fewer offspring than wild-type worms (Figure 4; Table 5), and infertile and intersex individuals

(e.g., Egl, or egg-laying defective, phenotypes) were observed at non-negligible frequencies

(personal observation, data not shown). Consequently, in addition to their effects on sex determination, these mutations may have deleterious pleiotropic effects on overall fitness.

(To be fair, the fitness disadvantage in strain CB6415 are likely exaggerated by the dpy-26 mutation, which kills XX embryos; because all surviving adults in this strain are XO, this means that only one half of the zygotes are viable, since XX and nullo-X embryos are both lethal.) 37

The deleterious fitness effects of these mutations also suggest an added layer of complexity not included in many theoretical models investigating transitions between SDMs.

Although such models have been important in advancing our understanding of the evolution of SDMs, many of them assume that changes in the sex determination pathway have no pleiotropic effects on fitness (e.g., Bull, 1983). Although this assumption may hold in some cases, these strains clearly show that its validity is not universal. During the transition from

GSD to TSD the TSD state must not only be hypothetically superior to GSD, but must directly compete with GSD individuals during the transition, such that any additional pleiotropic effects on fitness would limit the likelihood of the transition. Thus, it will be worthwhile to re-visit these models and incorporate this new information.

This work helps to establish two things. First, these two mutant strains of C. elegans suggest that TSD can potentially evolve very quickly from GSD, from relatively simple mutations, and in multiple ways, but that these simple types of mutations might have other fitness effects restricting the conditions under which TSD can reach fixation. These findings provide useful insights that are relevant to other TSD systems, such as those found in reptiles, which are clearly different from these induced mutations. Second, these strains and other existing sex determination mutants in model organisms like C. elegans provide the basis for new experimental approaches for critically testing theories of the evolution of environmental sex determination. 38

Acknowledgments

We thank Lori Albergotti, Jenni Anderson, Anne Bronikowski, Bernadette Guerra,

Jeremy Espinoza, Andrea LeClere, Anne Heun, Richard Jovelin, Levi Morran, Erin Myers,

Rebecca Ortiz, Autum Pairett, Suzanne McGaugh, and Tina Tague, for help in the lab and for assistance with data collection. We especially thank Jonathan Hodgkin for the strains. The

Janzen lab and two anonymous reviewers provided helpful comments on earlier versions of this manuscript, and Man-Yu Yum and the Iowa State University Office of Statistical

Consulting provided valuable assistance with statistical analyses. This research was funded by NSF grants DEB-0089680 to FJJ and DEB-0236280 and DEB-0641066 to PCP, and by a research support grant and a research infrastructure grant from the Iowa State University

Center for Integrated Animal Genomics (CIAG). This research was partially conducted while

FJJ was on sabbatical at the Center for Ecology and Evolutionary Biology at the University of Oregon.

References

Bieri, T., Blasiar, D., Ozersky, P. et al. 2007. Wormbase: new content and better access. Nucl. Acids Res. 35: D506-D510. Bull, J.J. 1983. Evolution of sex determining mechanisms. Benjamin/Cummings, Menlo Park, CA. Bulmer, M.G., and Bull, J.J. 1982. Models of polygenic sex determination and sex ratio control. Evolution. 36: 13-26. Conover, D.O., and Heins, S.W. 1987. Adaptive variation in environmental and genetic sex determination in a fish. Nature. 326: 496-498. Estes, S., and Lynch, M. 2003. Rapid fitness recovery in mutationally degraded lines of Caenorhabditis elegans. Evolution. 57: 1022-1030. Goodwin, E.B., and Ellis, R.E. 2002. Turning clustering loops: Sex determination in Caenorhabditis elegans. Current Biology. 12: R111-R120. Haag, E.S., and Doty, A.V. 2005. Sex determination across evolution: Connecting the dots. PLoS Biology. 3: 21-24. 39

Herman, R. K. 2005. Introduction to sex determination (December 24, 2005), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.71.1, http://www.wormbook.org. Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41: 95-98. Hamm, R.L., Shono, T., and Scott, J.G. 2005. A cline in frequency of autosomal males is not associated with insecticide resistance in house fly (Diptera: Muscidae). J. Econ. Entomol. 98: 171-176. Hodgkin, J. 2002. Exploring the envelope: Systematic alteration in the sex-determination system of the nematode Caenorhabditis elegans. Genetics. 162: 767-780. Janzen, F.J., and Krenz, J.G. 2004. Phylogenetics: Which was first, TSD or GSD? In: Temperature-Dependent Sex Determination in Vertebrates (N. Valenzuela and V.A. Lance, eds), pp. 121-130. Smithsonian Books, Washington, D.C. Janzen, F.J., and Paukstis, G.L. 1991. Environmental sex determination in reptiles: ecology, evolution, and experimental design. Q. Rev. Biol. 66: 149-179. Janzen, F.J., and Phillips, P.C. 2006. Exploring the evolution of environmental sex determination, especially in reptiles. J. Evol. Biol. 19: 1775-1784. Kozielska, M., Pen, I., Beukeboom, L.W., and Weissing, F.J. 2006. Sex ratio selection and multi-factorial sex determination in the housefly: a dynamic model. J. Evol. Biol. 19: 879-888. Mank, J.E., Promislow, D.L., and Avise, J.C. 2006. Evolution of alternative sex-determining mechanisms in teleost fishes. Biol. J. Linn. Soc. 87: 83-93. Perry, M.D., Trent, C., Robertson, B., Chamblin, C., and Wood, W.B. 1994. Sequenced alleles of the Caenorhabditis elegans sex-determining gene her-1 include a novel class of promoter mutations. Genetics. 138: 317-327. Quintero, H.E., Abebe, A., and Davis, D.A. 2007. Zero-inflated discrete statistical models for fecundity analysis in channel catfish, Ictalurus punctatus. Journal of the World Aquaculture Society. 38: 175-187. Pomiankowski, A., Nöthiger, R., and Wilkins, A. 2004. The evolution of the Drosophila sex- determination pathway. Genetics. 166: 1761-1773. Rost, B., Yachdav, G., and Liu, J.F. 2004. The PredictProtein server. Nucl. Acids Res. 32: W321-W326. Rozen, S., and Skaletsky, H.J. 2000. Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (S. Krawetz and S. Misener, eds), pp. 365-386. Humana Press, Totowa, NJ. Stiernagle, T. 2006. Maintenance of C. elegans (February 11, 2006), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.101.1, http:// www.wormbook.org. Stewart, A.D., and Phillips, P.C. 2002. Selection and maintenance of androdioecy in Caenorhabditis elegans. Genetics. 160: 975-982. 40

Stothard, P., Hansen, D., and Pilgrim, D.. 2002. Evolution of the PP2C family in Caenorhabditis: Rapid divergence of the sex-determining protein FEM-2. J. Mol. Evo. 54: 267-282. Uller, T., Pen, I., Wapstra, E., Beukeboom, L.W., and Komdeur, J. 2007. The evolution of sex ratios and sex-determining systems. Trends Ecol. Evol. 22: 292-297. Valenzuela, N., LeClere, A., and Shikano, T. 2006. Comparative gene expression of steroidogenic factor 1 in Chrysemys picta and Apalone mutica turtles with temperature-dependent and genotypic sex determination. Evol. Dev. 8: 424-432. Van Dooren, T.J.M., and Leimar, O. 2003. The evolution of environmental and genetic sex determination in fluctuating environments. Evolution. 57: 2667-2677. Veith, A.M., Froschauer, A., Körting, C., et al. 2003. Cloning of the dmrt1 gene of Xiphophorus maculatus: dmY/dmrt1Y is not the master sex-determining gene in the platyfish. Gene. 317: 59-66. Warner, D.A., and Shine, R. 2008. The adaptive significance of temperature-dependent sex determination in a reptile. Nature. 451: 566-568. Wilkins, A.S. 1995. Moving up the hierarchy: a hypothesis on the evolution of a genetic sex determination pathway. Bioessays. 17: 71-77. 41

Tables

Table 2.1. Full results from a generalized linear model testing whether sex ratio varies significantly with rearing temperature in strain CB5362. We used a binomial error distribution and logit link function, and treated temperature as a categorical variable because residuals were not normally distributed around zero when temperature was treated continuously.

Parameter Estimate !2 P Intercept 3.09 1619.6 <0.0001 Temp. (15.0°C) -5.74 2882.0 <0.0001 Temp (16.5°C) -3.10 1163.8 <0.0001 Temp (18.0°C) -1.17 101.14 <0.0001 42

Table 2.2. Full results from a generalized linear model testing whether sex ratio varies significantly with rearing temperature in strain CB6415. This model was constructed identically to the one used for strain CB5362.

Parameter Estimate !2 P Intercept -1.92 264.0 <0.0001 Temp. (15.0°C) 3.30 278.2 <0.0001 Temp (16.5°C) 1.86 168.9 <0.0001 Temp (18.0°C) 0.58 14.4 0.0001 43

Table 2.3. Full results from a generalized model testing whether sex ratio in strain CB5362 varies significantly with the time at which temperature is switched from a male-producing (20°C) temperature to a hermaphrodite-producing temperature (15°C). We used a binomial error distribution and logit link function, and treated the time of switch as a categorical variable.

Parameter Estimate !2 P Intercept -2.68 310.3 <0.0001 Time of shift (L1 stage - 6 hr) 4.96 393.3 <0.0001 Time of shift (L1 - 12 hr) 4.69 631.3 <0.0001 Time of shift (L2 - 18 hr) 3.48 345.4 <0.0001 Time of shift (L2 - 24 hr) 2.08 119.7 <0.0001 Time of shift (L2 - 30 hr) 1.93 125.6 <0.0001 Time of shift (L3 - 36 hr) 1.52 73.2 <0.0001 Time of shift (L3 - 42 hr) 1.46 68.5 <0.0001 Time of shift (L3 - 48 hr) 1.06 30.5 <0.0001 Time of shift (L3 - 60.5 hr) 0.68 11.8 0.0006 Time of shift (L4 - 72 hr) 0.47 5.3 0.0218 44

Table 2.4. Full results from a generalized model testing whether sex ratio in strain CB5362 varies significantly with the time at which temperature is switched from a hermaphrodite- producing (15°C) temperature to a hermaphrodite-producing temperature (20°C).

Parameter Estimate !2 P Intercept 1.19 230.8 <0.0001 Time of shift (L1 stage - 0 hr) -2.73 558.0 <0.0001 Time of shift (L2 - 12 hr) -2.92 515.4 <0.0001 Time of shift (L3 - 24 hr) -1.71 284.3 <0.0001 Time of shift (L3 - 36 hr) -1.33 172.3 <0.0001 Time of shift (L4 - 48 hr) -0.63 32.4 <0.0001 Time of shift (Adult - 72 hr) -0.54 30.4 <0.0001 45

Table 2.5. Results of randomization tests comparing fitness, as measured by total lifetime offspring production, among wild-type worms and strains carrying temperature-sensitive mutations in sex determination genes, for both males and hermaphrodites. In most cases, the fitness of the mutants is lower than that of wild-types. Analyses were performed separately for each rearing temperature because temperature had significant effects on worm fitness. P- values shown in the table are two-tailed. Observed Difference indicates the actual difference observed between the mean fitnesses of the two groups, and the Expected Null 95% CI Min and Max indicate the 95% confidence interval for the expected value of the difference under the null hypothesis of no significant fitness differences, as calculated by randomization. A value of “n/a” indicates that insufficient individuals were available to perform that particular comparison.

Expected Expected Sex and Observed Comparison P Null 95% CI Null 95% CI Temperature Difference Min. Max 13°C N2 vs. CB5362 0.0004 114.57 -57.40 67.00 Hermaphrodites N2 vs. CB6415 0.0001 168.97 -63.87 71.27 16°C N2 vs. CB5362 0.0001 204.38 -90.95 95.03 Hermaphrodites N2 vs. CB6415 0.0001 250.15 -110.14 108.89 23°C N2 vs. CB5362 n/a n/a n/a n/a Hermaphrodites N2 vs. CB6415 0.0001 184.76 -90.78 90.00 13°C N2 vs. CB5362 n/a n/a n/a n/a Males N2 vs. CB6415 n/a n/a n/a n/a 16°C N2 vs. CB5362 0.0269 192.07 -184.21 162.21 Males N2 vs. CB6415 0.0003 259.26 -148.20 144.51 23°C N2 vs. CB5362 0.9375 -2.01 -42.25 48.16 Males N2 vs. CB6415 n/a n/a n/a n/a 46

Figures

Figure 2.1. The wild-type sex determination cascade in C. elegans. Adapted from Stothard et al. (2002). 47

Figure 2.2. Sex ratio reaction norms as a function of constant rearing temperature in two C. elegans strains with temperature-sensitive mutations in the sex determination pathway. Best- fit curves were generated by logistic regression. Adapted from Janzen & Phillips (2006). 48

Figure 2.3. Results from temperature shift experiments to determine the developmental stages during which sex determination is sensitive to temperature in strain CB5362. The x- axis indicates the developmental stage worms were at when the temperature shift occurred for each data point. In both forward (15°C"20°C) and back (20°C"15°C) shift experiments, the thermosensitive period ranged from the late L1 stage to the late L3/early L4 stage, indicated by the shaded area covering the sloping portion of the curve. 49

Figure 2.4. Fitness as measured by total lifetime offspring production in N2, CB5362, and CB6415 worms, reared at 13°C, 16°C, and 23°C. Data points for each strain have been horizontally offset slightly on the plots for visual clarity. Bars indicate mean ± SD, truncated at 0. The median number of worms assayed for each combination of strain, sex, and rearing temperature was 12. 50

Figure 2.5. Schematic diagram of the structure of TRA-2A, the primary protein product of tra-2, as predicted by PredictProtein (Rost et al. 2004) and hydrophobicity plots (Kuwabara 1996). The mutation in the ar221 allele changes amino acid 127 from a proline to a leucine, in a region of the protein thought to bind HER-1, which negatively regulates TRA-2A. 51

CHAPTER 3. CLOSE TEMPORAL CORRESPONDENCE BETWEEN THE ORIGINS OF SELF-FERTILITY AND FOG-2 IN CAENORHABDITIS ELEGANS

A paper submitted to Genetics Research

Christopher H. Chandler

Abstract

Gene duplication events are associated with many evolutionary novelties, including the origin of self-fertile hermaphrodites in Caenorhabditis elegans. In this species, the fog-2 gene is a novel member of the F box gene family and directs hermaphrodite spermatogenesis by temporarily down-regulating the feminizing gene tra-2 in the germline; XX worms homozygous for null fog-2 mutations are females rather than hermaphrodites. Here, I use a temperature-sensitive tra-2 allele to show that quantitative modulation of tra-2 activity can restore self-fertility even in fog-2 mutants, consistent with previous studies. This observation suggests that other factors also regulate the switch from spermatogenesis to oogenesis, and that fog-2, though important, may have been a later addition to germline sex determination, rather than the key innovation that led to self-fertility. To further explore this hypothesis, I used a Bayesian relaxed molecular clock model to estimate to estimate that fog-2 diverged from its closest paralog between 3.42 ! 107 and 1.14 ! 108 generations ago. This result is remarkably congruent with an independent date estimate for the origin of self-fertility in C. elegans. Thus, even if the gene duplication event responsible for the creation of fog-2 was not the first step in the evolution of this unique mating system, the temporal proximity of the 52 origins of fog-2 and self fertility suggests this gene still probably played an important role in this trait’s emergence.

Introduction

Gene duplication is recognized as a potent generator of evolutionary novelty (Flagel

& Wendel, 2009). One class of pathways in which gene duplication has clearly been influential is sex determination mechanisms. For example, DMY, the master sex-determining gene in the medaka (Oryzias latipes) was generated by a recent duplication event from the

DMRT1 gene, whose role in sex determination is conserved across vertebrates (Lutfalla et al.,

2003; Matsuda et al., 2002; Matsuda et al., 2007).

Gene duplication is also associated with novel mating systems in the nematode genus

Caenorhabditis, in which most species are gonochoristic, with males and females. C. briggsae and C. elegans, however, are androdioecious, possessing outcrossing males and self-fertile hermaphrodites. Phylogenetic analyses show that the distribution of self-fertility in this genus is most parsimoniously explained by multiple, independent origins (Kiontke et al., 2004); indeed, hermaphrodites have evolved at least ten times within rhabditids as a whole (Kiontke & Fitch, 2005).

This conclusion is corroborated by the different molecular mechanisms underlying self-fertility in the two hermaphroditic Caenorhabditis species. In C. briggsae, the gene she-1 controls spermatogenesis in hermaphrodites (Guo et al., 2009). This gene, generated by a recent duplication within C. briggsae, encodes a novel F box protein. Hermaphrodite spermatogenesis in C. elegans is governed by fog-2, another novel F box protein specific to 53

C. elegans (Nayak et al., 2005). Thus, self-fertility in both species is associated with gene duplication events.

Although she-1’s exact mode of action is more mysterious due to its recent discovery, fog-2 has been studied considerably. XX worms homozygous for null alleles of fog-2 are females, not hermaphrodites, but are otherwise normal, and males are unaffected (Schedl &

Kimble, 1988). The fog-2 gene acts with gld-1 to transiently repress feminizing tra-2 activity in the hermaphrodite germline by blocking tra-2 translation (Clifford et al., 2000). Loss-of- function mutations in several other genes, however, can at least partially suppress the null fog-2 phenotype (summarized in Nayak et al., 2005). In particular, suppression is seen with mutations altering the balance of feminizing tra-2 and masculinizing fem-3 activity.

Thus, the tra-2 (feminizing) to fem-3 (masculinizing) ratio is thought to determine germline cell fate. According to this model, this ratio is controlled primarily by fog-2 in wild- type animals, but even when fog-2 is knocked out, mutations that further modify this ratio may rescue self-fertility. In this case, could self-fertility in C. elegans have evolved prior to the origin of fog-2? In other words, did the duplication and subsequent neofunctionalization of fog-2 cause self-fertility in the first place? Or was fog-2 a later adaptation to help “fine- tune” tra-2 regulation specifically in the hermaphrodite germline, after primitive hermaphrodites had already evolved? Baldi et al. (2009) recently demonstrated “proof-of- concept” for this latter possibility by engineering self-fertile hermaphrodites in C. remanei, an obligately outcrossing cousin of C. elegans, using RNAi-mediated knockdown of just two genes. 54

To address this question, I first performed a more refined test of the hypothesis that quantitative alterations to tra-2 activity can restore self-fertility in fog-2(q71) null homozygotes, using the temperature-sensitive hypomorphic tra-2(ar221) allele. I predicted that XX animals homozygous for this mutation would show even higher rates of fog-2 suppression than heterozygotes, and that suppression would also depend on temperature. I then used a molecular clock approach to estimate when fog-2 was generated by gene duplication. My results show that although other factors can achieve self-fertility even in the absence of fog-2, and thus that fog-2 might not have been the first step in the evolution of self-fertility, the gene duplication that generated fog-2 was likely still important in the origin of this novel trait because the two events occurred in close temporal proximity to one another.

Materials and Methods

Suppression of fog-2 by tra-2(ar221)

I constructed tra-2(ar221); fog-2(q71) double mutants by crossing tra-2(ar221ts); rol-9(sc148) homozygotes with fog-2(q71) homozygotes. rol-9 is closely linked to fog-2 and here serves as a counter-selectable phenotypic marker. I allowed the F1 offspring to self at a partially restrictive temperature, and selected non-Rol F2 offspring with partially masculinized tails (ar221 homozygotes) and whose offspring were also all non-Rol.

Genotypes were subsequently verified with test crosses and a PCR-RFLP marker (Chandler, unpublished). I maintained stock populations at 13°C, and transferred L4 hermaphrodites to individual plates for oviposition at 13°, 16°, 18°, and 24° to obtain double homozygotes for self-fertility assays at each temperature. tra-2(ar221)/+; fog-2(q71) worms were obtained by 55 crossing homozygous double mutant female adults with fog-2(q71) homozygotes at 13°, 16°,

18°, and 24°. For self-fertility assays, L4 animals were transferred to individual plates and scored as self-fertile if they produced offspring, or female if they produced no offspring and displayed the characteristic “piano-key” phenotype caused by the accumulation of unfertilized oocytes (Stewart & Phillips, 2002).

Molecular dating of fog-2

I downloaded gene sequences for fog-2 and its five closest paralogs (Nayak et al.,

2005) from WormBase release WS207 (www.wormbase.org). I aligned introns separately using ClustalW v.1.81 (Thompson et al., 1994) and then concatenated them into a single dataset; because fbxa-106 has one fewer intron than the other genes, the fbxa-106 sequence for that intron was coded as missing data. I used the BEAST v. 1.5.2 software package

(Drummond & Rambaut, 2007) to perform molecular clock calculations. I used the HKY model with a relaxed molecular clock, empirical base substitution rates, speciation modeled as a Yule process, and a normal prior on the rate with mean 2.7 ! 10-9 and SD 0.4 ! 10-9

(Denver et al., 2009), with rate heterogeneity among sites described by a gamma distribution with four categories. I ran MCMC chains for 5 ! 106 generations, with a burn-in of 10%. I used Tracer v.1.4.1, TreeAnnotator and FigTree v.1.2.3 to obtain parameter estimates, the consensus tree, and date estimates for tree notes. A strict molecular clock model yielded narrower confidence intervals but was otherwise consistent and did not alter any conclusions.

To estimate the timing of the origin of self-fertility in C. elegans, I repeated the calculations of Cutter et al. (2008) using the newer mutation rate reported by Denver et al. (2009). 56

Results and Discussion

C. elegans hermaphrodites homozygous for null mutations in the fog-2 gene are unable to produce sperm and are therefore transformed into functional females. My results confirm, however, previous evidence that quantitative alterations to tra-2 activity can restore self-fertility, even in homozygous fog-2 mutants. Although many double homozygotes reared at 16° and 18° were sterile due to masculinization by the tra-2 mutation, which produces many sterile masculinized animals at these temperatures (Chandler et al. 2009), and at 24° were all pseudomales, at 13° most were self-fertile hermaphrodites (Table 3.1). Previously, suppression of fog-2 was only tested in tra-2 heterozygotes, since animals homozygous for tra-2 null alleles are male, and suppression rates were much lower (Schedl & Kimble, 1988).

Worms homozygous for fog-2 but heterozygous for tra-2(ar221), on the other hand, were mostly females but occasionally hermaphrodites (Table 1). Generalized linear models

(using a logit link function, and excluding the masculinized worms) testing the effects of tra-2 genotype and rearing temperature on self-fertility revealed that the differences in self- fertility rates were significantly influenced by tra-2 genotype ("2 = 54.1, P = 1.9 ! 10-13) but not temperature ("2 = 2.25, P = 0.13). Testing the effects of temperature in tra-2 heterozygotes and homozygotes separately, temperature was nearly significant for heterozygotes ("2 = 3.59, P = 0.058), but self-fertility declined with increasing temperature, counter to expectations. For homozygotes, the effects of temperature were significant ("2 =

4.56, P = 0.033) and consistent with predictions, but sample sizes were small because of the high degree of masculinization, especially at 18°. Thus, the effects of temperature on self- fertility were ambiguous, but the effect of tra-2 dose was consistent with predictions. 57

Overall, these results generally support the hypothesis that quantitative alterations to tra-2 activity can restore self-fertility even in the absence of functional fog-2. Thus, while fog-2 may be a primary driver of spermatogenesis in wild-type hermaphrodites, its activity is not essential, as the switch from spermatogenesis to oogenesis can still occur in its absence.

Therefore, additional factors must also modulate the tra-2 to fem-3 ratio during development to achieve the switch from spermatogenesis to oogenesis. A reasonable model to explain these observations is that null fog-2 mutations push this ratio well above the sperm/oocyte threshold so that the function of these secondary regulators is rendered invisible, but that additional mutations such as tra-2(ar221) can bring this ratio back into a range in which these regulators are relevant.

Next, I used a Bayesian relaxed molecular clock model to estimate when fog-2 diverged from its closest paralog (Figure 3.1). This split happened most likely between 3.42

! 107 and 1.14 ! 108 generations ago. Using the method of Cutter et al. (2008), based on codon bias decay, with the newer mutation rates estimated by Denver et al. (2009), produces an estimate of 7.76 ! 107 generations ago for the origin of self-fertility in C. elegans.

Although they do not permit me to conclude with certainty whether self-fertility preceded the origin of fog-2, these independent estimates are strikingly congruent. Their similarity suggests that even if self-fertility first evolved without fog-2, the origin of this novel gene coincided closely in time with the origin of self-fertility. This is perhaps not unexpected: primitive hermaphrodites might not have been especially fecund, although by obviating the need for a mate they certainly would have had advantages over females in colonization abilities. Thus, there would have been strong selection to “accommodate” any negative 58 pleiotropic side-effects of their novel tra-2/fem-3 regulation and maximize reproductive output, probably by regulating tra-2 specifically in the germline, functions fog-2 could have provided. Indeed, even now selection appears to operate on the timing of the sperm/oocyte switch to maximize population growth rates (Hodgkin & Barnes, 1991).

There are two caveats to the molecular clock results, but neither alters the above conclusions. First, duplication need not precede divergence (Proulx & Phillips, 2006); that is, fog-2 could have initially acquired, at least partially, its new function as an allelic variant of its ancestor, and this allele could have then become fixed at a new locus after duplication.

However, since the molecular clock model actually estimates divergence, not duplication per se, the conclusions remain unaltered. Second, spontaneous gene conversion events in this gene family have been documented in lab populations (Katju et al., 2008). However, even if gene conversion shaped natural patterns of molecular evolution, they would only make duplication events appear more recent than they really are. In this case, fog-2 would have still evolved prior to or concurrently with self-fertility, not as a much later addition, and thus the importance of fog-2 to the origins of self-fertile hermaphrodites would still be supported.

It would be interesting to adopt the same approach in C. briggsae, to compare the timing of the origins of self-fertility and she-1, whose role in that species is analogous to that of fog-2. In fact, besides the method used by Cutter et al. (2008), which could similarly be applied to C. briggsae, Cutter et al. (2010) also reasoned that self-fertility must have evolved between 8.92 ! 105 and 1.02 ! 107 generations ago, based on between- and within-species sequence divergence. Moreover, even animals homozygous for null alleles of she-1 can still be self-fertile at some temperatures, leading to a similar hypothesis that self-fertility in this 59 species may have appeared first in facultative hermaphrodites lacking she-1. Unfortunately, however, attempts to date the origin of she-1 in C. briggsae were inconclusive, because the gain and loss of introns in she-1 and its closest paralogs made intron homology difficult to identify, and even introns that are likely homologous yielded poor sequence alignments.

While fog-2, then, may not have been the singular genetic novelty that led to the evolution of self-fertility in C. elegans, as suggested by the double mutant analysis, these two evolutionary innovations coincided quite closely. Thus, this gene duplication still likely played a pivotal role in the emergence of this derived mating system. It is intriguing that an independent duplication in the same gene family played a similar role in C. briggsae (Guo et al., 2009). As researchers apply next-generation genomic and genetic tools to additional related species, it will be very exciting to compare the mechanisms by which other hermaphroditic nematode species have achieved this remarkable feat.

Acknowledgments

I am especially grateful to G. Chadderdon and A. Heun for assistance in the lab, and

F. Janzen the Janzen laboratory, R. Ellis, E. Haag, and two anonymous reviewers for helpful comments and suggestions on earlier versions of this manuscript. A. Bronikowski, F. Janzen,

P. Phillips, J. A. Powell-Coffman, S. Proulx, J. Serb, and J. Wendel also provided valuable discussions and advice. J. Hodgkin, P. Phillips, and the Caenorhabditis Genetics Center generously provided worm strains that were used in this research. This work was funded by the ISU Department of Ecology, Evolution, and Organismal Biology, the ISU Center for

Integrated Animal Genomics, the Society for Integrative and Comparative Biology, the Iowa 60

Academy of Sciences and Iowa Science Foundation, and an ISU Ecology and Evolutionary

Biology Bill Clark Award.

References

Baldi, C., Cho, S. & Ellis, R. E. (2009). Mutations in two independent pathways are sufficient to create hermaphroditic nematodes. Science 326, 1002-1005. Clifford, R., Lee, M. H., Nayak, S., Ohmachi, M., Giorgini, F. & Schedl, T. (2000). FOG-2, a novel F-box containing protein, associates with the GLD-1 RNA binding protein and directs male sex determination in the C. elegans hermaphrodite germline. Development 127, 5265-5276. Cutter, A. D., Wasmuth, J. D. & Washington, N. L. (2008). Patterns of molecular evolution in Caenorhabditis preclude ancient origins of selfing. Genetics 178, 2093-2104. Cutter, A. D., Yan, W., Tsvetkov, N., Sunil, S. & Félix, M. A. (2010). Molecular population genetics and phenotypic sensitivity to ethanol for a globally diverse sample of the nematode Caenorhabditis briggsae. Molecular Ecology 19, 798-809. Denver, D. R., Dolan, P. C., Wilhelm, L. J., Sung, W., Lucas-Lledó, J. I., Howe, D. K., et al. (2009). A genome-wide view of Caenorhabditis elegans base-substitution mutation processes. Proceedings of the National Academy of Sciences, USA 106, 16310-16314. Drummond, A. J. & Rambaut, A. (2007). BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7, 214. Flagel, L. E. &Wendel, J. F. (2009). Gene duplication and evolutionary novelty in plants. New Phytologist 183, 557-564. Guo, Y., Lang, S. & Ellis, R. E. (2009). Independent recruitment of F box genes to regulate hermaphrodite development during nematode evolution. Current Biology 19, 1853-1860. Hodgkin, J., & Barnes, T. M. (1991). More is not better: brood size and population growth in a self-fertilizing nematode. Proceedings of the Royal Society of London, B 246, 19-24. Katju, V., LaBeau, E. M., Lipinski, K. J. & Bergthorsson, U. (2008). Sex change by gene conversion in a Caenorhabditis elegans fog-2 mutant. Genetics 180, 669-72. Kiontke, K. & Fitch, D.H.A. (2005) The phylogenetic relationships of Caenorhabditis and other rhabditids. In WormBook (ed. The C. elegans Research Community). http:// www.wormbook.org. Kiontke, K., Gavin, N. P., Raynes, Y., Roehrig, C., Piano, F. & Fitch, D. H. A. (2004). Caenorhabditis phylogeny predicts convergence of hermaphroditism and extensive intron loss. Proceedings of the National Academy of Sciences, USA 101, 9003-9008. Lutfalla, G., Crollius, H. R., Brunet, F. G., Laudet, V. & Robinson-Rechavi, M. (2003). Inventing a sex-specific gene: A conserved role of DMRT1 in teleost fishes plus a recent duplication in the medaka Oryzias latipes resulted in DMY. Journal of Molecular Evolution 57, S148-S153. 61

Matsuda, M., Nagahama, Y., Shinomiya, A., Sato, T., Matsuda, C., Kobayashi, T., et al. (2002). DMY is a Y-specific DM-domain gene required for male development in the medaka fish. Nature 417, 559-563. Matsuda, M., Shinomiya, A., Kinoshita, M., Suzuki, A., Kobayashi, T., Paul-Prasanth, B., et al. (2007). DMY gene induces male development in genetically female (XX) medaka fish. Proceedings of the National Academy of Sciences, USA 104, 3865-3870. Nayak, S., Goree, J. & Schedl, T. (2005). fog-2 and the evolution of self-fertile hermaphroditism in Caenorhabditis. PLoS Biology 3, 57-71. Proulx, S. R. & Phillips, P. C. (2006). Allelic divergence precedes and promotes gene duplication. Evolution 60, 881-892. Schedl, T. & Kimble, J. (1988). fog-2, a germ-line-specific sex determination gene required for hermaphrodite spermatogenesis in Caenorhabditis elegans. Genetics 119, 43-61. Stewart, A. D. & Phillips, P. C. (2002). Selection and maintenance of androdioecy in Caenorhabditis elegans. Genetics 160, 975-982. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-80. 62

Tables

Table 3.1. Phenotypes of tra-2(ar221); fog-2(q71) and tra-2(ar221)/+; fog-2(q71) worms.

Number of Number of Number tra-2 genotype Temperature (°C) hermaphrodites females masculinized tra-2(ar221) 13 18 3 0 tra-2(ar221) 16 16 0 5 tra-2(ar221) 18 5 0 16 tra-2(ar221)/+ 13 6 19 0 tra-2(ar221)/+ 16 6 18 0 tra-2(ar221)/+ 18 7 19 0 tra-2(ar221)/+ 24 1 22 0 63

Figures

Figure 3.1. Phylogenetic tree of fog-2 and its closest paralogs based on intron sequences. Numbers by nodes indicate 95% highest posterior density intervals for divergence date estimates, expressed in number of generations. 64

CHAPTER 4. CRYPTIC INTRASPECIFIC VARIATION IN SEX DETERMINATION IN CAENORHABDITIS ELEGANS REVEALED BY MUTATIONS

A paper submitted to Heredity

Christopher H. Chandler

Abstract

Sex determination mechanisms (SDMs) show striking diversity and appear to evolve rapidly. Although interspecific comparisons and studies of ongoing major transitions in sex determination (e.g., the establishment of new sex chromosomes) have shed light on how

SDMs evolve, comparatively little attention has been given to intraspecific variation with less drastic effects. Here, I use mutant strains carrying a temperature-sensitive sex determination mutation, along with a second null mutation, in different wild genetic backgrounds to uncover hidden variation in the SDM of the model nematode Caenorhabditis elegans. I then use quantitative trait locus (QTL) mapping to begin to investigate its genetic basis. I identified several QTL, and although this variation apparently involved genotype-by- temperature interactions, QTL effects were generally consistent across temperatures. These

QTL collectively and individually explained a relatively large fraction of the variance in tail morphology (a sexually dimorphic trait), and two QTL contained no genes known to be involved in somatic sex determination. These results demonstrate the existence of within- species variation in sex determination in this species, and underscore the potential for microevolutionary change in this important developmental pathway. 65

Introduction

Although reproduction with two distinct sexes is taxonomically widespread, the mechanisms that determine an individual’s sex are remarkably diverse across species. At the highest level, sex determination mechanisms (SDMs) can be divided into two major categories: those in which the organism’s sex is determined by its genotype (genotypic sex determination; GSD), and those in which sex is determined by some environmental input during development (environmental sex determination; ESD). There is great variation within these categories in the most upstream determiner of sex. There are GSD systems, for instance, relying on different types of sex chromosomes as in mammals and birds (Haag and

Doty, 2005), systems in which sex determination appears to be influenced by many genes

(Vandeputte et al., 2007), and systems in which one sex is haploid and the other diploid

(Cook and Crozier, 1995). Likewise, ESD systems use an array of different environmental variables, including population density and host crowding (Blackmore and Charnov, 1989), light availability (Korpelainen, 1998), and perhaps most commonly, temperature

(temperature-dependent sex determination, TSD; Janzen and Phillips, 2006).

Within these types of SDMs lies even more diversity, in the genetic pathways that translate the upstream sex-determining factor into a signal triggering male or female development. Many dipterans, for example, possess an XX/XY sex chromosome system

(Sanchez, 2008), but although the most downstream gene in this pathway, doublesex, is conserved, there are important differences among species elsewhere in the pathway. For example, sex-specific splicing of tra is regulated by Sxl in Drosophila (Cline and Meyer,

1996) but is directed by tra itself in an auto-regulatory feedback loop in Ceratitis (Pane et al., 66

2002) and Musca (Hediger et al., 2010), with Sxl lacking a sex-specific function in both of these species (Meise et al., 1998; Saccone et al., 1998).

From these types of interspecific pathway comparisons, as well as phylogenetic and theoretical studies, we have gained some key insights into the evolution of SDMs. First, changes in SDMs may occur commonly and easily, at least in some clades. For example, different GSD and TSD mechanisms are phylogenetically scattered in reptiles (Janzen and

Phillips, 2006) and teleost fishes (Mank et al., 2006), indicating frequent and independent transitions. Second, genes involved in sex determination evolve rapidly and often co-evolve with one another. This conclusion is supported by huge sequence divergence among related species in these genes (e.g., deBono and Hodgkin, 1996; Whitfield et al., 1993) and functional analyses (e.g., Haag et al., 2002). Lastly, changes to SDMs typically occur in the upstream portions of the pathway (Pomiankowski et al., 2004; Wilkins, 1995), as these show more divergence among species, whereas downstream components are more conserved (e.g.,

Raymond et al., 1998).

To appreciate more fully how SDMs change over time, however, an understanding of both between-species divergence as well as within-species variation is necessary. Although earlier work on intraspecific variation and the microevolution of SDMs (e.g., Bull and

Charnov, 1977) was largely theoretical and abstract due to a lack of molecular understanding of most SDMs (Pomiankowski et al., 2004), great strides are rapidly being made in this area.

For example, Hediger et al. (2010) recently showed that gain-of-function alleles of the

Musca domestica tra ortholog correspond to the dominant feminizing factors segregating in some populations. Similarly, a variety of XX/XY and ZZ/ZW SDMs involving linkage group 67

(LG) 5 and LG 7 occur in different species of Lake Malawi cichlids, which have diversified only in the last million years; in some cases, sex is even determined by an epistatic interaction between LG5 and LG7 (Ser et al., 2010). The maintenance or fixation of these types of sex-determining variants is typically attributed to various types of selection (e.g.,

Kozielska et al., 2009; Roberts et al., 2009).

One commonality in these and other cases of intraspecific variation in SDMs (e.g.,

Kallman, 1968; Ogata et al., 2008) is that they involve variants with major effects, such as novel sex-determining genes or chromosomes, or taxa in which related species show very different SDMs (e.g., medakas; Takehana et al., 2008). Thus, there is evidence that SDM evolution is often characterized by major and rapid changes. However, what about species not currently experiencing such extreme changes; are they in complete stasis or do SDMs change gradually as well? Intraspecific SDM variation of smaller effect has received comparatively little attention, perhaps because of an ascertainment bias towards variants with drastic effects. However, gradual or cumulative change should not be dismissed completely just yet. For example, heritable quantitative variation has been shown to occur in sex ratio reaction norms in several species with ESD (e.g., Blackmore and Charnov, 1989; Rhen and

Lang, 1998), although its genetic basis is unknown and effective heritability in the wild may be low. In addition, minor-effect alleles may be masked in GSD species if SDMs show some degree of genetic robustness, allowing the underlying pathway to evolve (True and Haag,

2001). In fact, other developmental signaling pathways have been shown to evolve even without change in the final phenotypic output, such as the signaling network underlying vulval development in nematodes (Félix, 2007; Milloz et al., 2008; Zauner and Sommer, 68

2007). Moreover, strong alleles may not necessarily be the result of a single mutation, but rather assembled cumulatively by standing variation and successive minor-effect mutations

(Rebeiz et al., 2009). Finally, certain patterns in SDM evolution may not be fully explained by this model of swift and significant changes in master sex-determiners. For example, coevolution among interacting sex-determining genes, even intermediate and downstream ones, occurs without changes in the roles of the genes, their interaction, or in the master sex- determining signal itself (Haag et al., 2002).

In this study, I investigate variation in sex determination in Caenorhabditis elegans, a model nematode “worm.” This is an ideal study species because its sex determination cascade has been well characterized by years of study (reviewed in Wolff and Zarkower,

2008). In wild-type worms, sex is determined by sex chromosomes; males are XO, while hermaphrodites, which are essentially females that produce a limited supply of sperm early in development, are XX. By examining the joint quantitative effects of specific mutations in two key sex determination genes (Chandler et al., 2009) in different genetic backgrounds, I uncover cryptic intraspecific variation in the sex determination pathway. I then use quantitative trait locus (QTL) mapping to begin to investigate its underlying genetic basis and microevolutionary potential, with the goal of addressing the following questions: (i) how many loci are involved, and what are the magnitudes of their effects?; (ii) do any QTL lack candidate genes with known roles in sex determination?; (iii) do QTL influence overall pathway activity, with effects consistent across environments (in this case, temperatures), or are they more complex, with genotype-by-environment interactions? I discuss the implications of my findings for our understanding of how SDMs evolve. 69

Materials & Methods

Strains and strain construction

Strain CB5362 tra-2(ar221ts)II; xol-1(y9)X (Chandler et al., 2009; Hodgkin, 2002) consists of XX worms which are primarily hermaphrodites at permissive temperatures (<

~16°C) and males at warmer temperatures (> ~20°C). At intermediate temperatures, tail phenotypes are variably intersexed (Figure 4.1). This strain was originally constructed with the N2 genetic background (Brenner, 1974). I introgressed these two mutations into the genetic backgrounds of four additional wild isolates, chosen for their molecular, phenotypic, and geographic diversity (Milloz et al., 2008): CB4856 from Hawaii, MY2 from Germany,

AB1 from Australia, and JU258 from Madeira (Barriere and Félix, 2005; Haber et al., 2005;

Hodgkin and Doniach, 1997).

I backcrossed the tra-2(ar221) and xol-1(y9) alleles into each genetic background separately, selecting for each mutation with a combination of molecular and phenotypic markers, for ten generations with CB4856, and four generations with MY2, AB1, and JU258.

Following backcrossing, I crossed the tra-2 and xol-1 introgression lines, selfed the offspring, and selected double mutants with each new genetic background.

I performed QTL mapping using the temperature-sensitive lines with N2 and the

CB4856 genetic backgrounds, since they display many single nucleotide polymorphisms

(SNPs) and are commonly used for mapping (e.g., Gutteling et al., 2007; Seidel et al., 2008).

To construct recombinant inbred lines (RILs), which are available from the author upon request, for QTL mapping, I first performed reciprocal crosses between these strains. I picked

F1 offspring at 13°C, allowed them to self-fertilize and oviposit, and used a PCR marker 70 flanking an indel polymorphism on chromosome III to verify heterozygosity of cross- progeny. I picked F2 offspring to individual plates, subsequently transferring 1-4 offspring to new plates for a total of 10 generations. At the F10 generation, RILs were grown to large population sizes to obtain working cultures and frozen stocks.

Phenotypic assays

I scored each temperature-sensitive strain, as well as wild-type male and hermaphrodite

N2 worms as a control, for both gonadal sex ratio and tail phenotype at four rearing temperatures (24°C, 18°C, 16°C, and 13°C), using standard bleaching protocols to obtain age-synchronized populations (with about ~150-200 worms each) for assays. At adulthood, I mounted worms onto glass slides (typically containing 20-50 worms/slide) with 25 mM

NaN3 for Nomarski microscopy, using standard methods (Shaham, 2006). I photographed all worms using a Zeiss Axioplan II with differential interference contrast (DIC) optics within a few hours of mounting.

I cropped individual worms from digital images and scored them for gonadal sex and tail phenotypes blindly with regard to strain and rearing temperature. Gonadal sex was scored as a binary trait (0 = hermaphrodite, 1 = male). Hermaphrodites were identified by their distinctive two-armed gonad morphology and/or the presence of oocytes within the adult worm, while males were recognized by their one-armed gonads and a lack of oocytes. Worms with gonads that were abnormal, unclear, or ambiguous (~5% of the total) were excluded from sex ratio analyses. Tail morphology was scored on a semi-quantitative scale from 1-6

(Figure 4.1). A score of 1 was given to worms indistinguishable from wild-type hermaphrodites, with a fully developed tail spike. A score of 2 was assigned to worms with 71 an abnormal but still hermaphrodite-like tail, indicated by a truncated (but still present) tail spike and/or slight swelling at the base of the tail. Worms with a more intersexed tail morphology, lacking a tail spike altogether but also lacking a flattened male shape, were given a score of 3. A score of 4 was given to individuals with a more male-like tail shape, but without the fan and rays characteristic of normal male tails. A score of 5 was given to worms having a male-shaped tail with at least some of the male characteristics such as a fan or rays, but in which these features were reduced in number or size. A score of 6 was reserved for worms with tails indistinguishable from those of wild-type males, complete with full fan, rays, and spicules. To confirm the repeatability of the rating scale, I blindly re-scored a subset of worms and calculated Kappa with quadratic weightings, a statistic commonly used to measure repeatability in ordinal ratings (Banerjee et al., 1999).

Genotyping

I washed worms off stock cultures in deionized water into 1.5 mL tubes, centrifuged them, removed the supernatant, and froze the pelleted samples at -80°C. I extracted DNA from thawed tissue samples using a Qiagen DNeasy Blood & Tissue kit according to the manufacturer’s directions (Qiagen, Valencia, CA, USA). DNA concentrations were quantified with a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington,

DE, USA), and samples were diluted to 10 ng/µL. RIL genotyping at 90 SNPs (Appendix

4.1) was performed using the Sequenom MassARRAY system (Sequenom, San Diego, CA,

USA) at the Iowa State University Genomic Technologies Facility.

Analyses

To test the effects of rearing temperature and genetic background on gonadal sex ratio 72 in CB5362 and the introgression lines, I compared nested models using hierarchical likelihood ratio tests. For sex ratio, I evaluated a series of logistic models to test the effects of temperature, strain, and strain-by-temperature interaction. For tail morphology, I used ordered logistic models, an extension of logistic models allowing for more than two categories in the response variable, to test the effects of temperature, strain, and two different strain-by-temperature interactions. Each ordered logistic model was composed of a series of five parallel logistic models (because there are six possible tail scores), with each logistic model j expressing the probability that an individual’s tail score is greater than j. Maximum likelihood values and parameter estimates for each model were obtained using the optim function in R v2.10.0 (R Development Core Team) using the BFGS search algorithm.

I performed QTL mapping using the software package R/qtl v1.14-2 in R (Broman et al., 2003), using gonadal sex ratio and tail scores each at four rearing temperatures. To look for QTL with effects on reaction norm shape, I also performed QTL analyses on tail reaction norm slopes from 13°C to 16°C, and from 16°C to 18°C. Strain means were used as the phenotypic values. I first checked the genotype data for evidence of segregation distortion and disagreement with the publicly available genetic map (WormBase web site, http:// www.wormbase.org, release WS208). I performed an initial exploratory QTL analysis by interval mapping. Subsequently, I used the stepwiseqtl function to search for additive

QTL and compare multiple-QTL models. The latter approach compares models using LOD scores, imposing a penalty for the inclusion of additional QTL, and is advantageous because it allows one to test the effects of multiple QTL simultaneously, offering increased detection power (Broman and Sen, 2009). Penalties were computed from 1000 permutations of the 73 scantwo function. For each QTL, 1.5-LOD confidence intervals were estimated using the lodint function, and effect estimates and the proportion of variance explained were both estimated using fitqtl. All analyses were conducted using multiple imputation with 64 draws.

Results

Variation among genetic backgrounds

A total of 711 worms from CB5362 and the four introgression lines, and 9336 worms from the RIL population were examined (average n = ~35 for each temperature by strain combination). All control hermaphrodite N2 worms were given tail scores of 1, and all male

N2 worms were given tail scores of 6. Repeatability of tail scores was very high (weighted !

= 0.97, n = 368).

The “Temp+Strain” model best explained variation in gonadal sex ratio (Table 4.1;

Figure 4.2), indicating that sex ratio reaction norms varied among strains in their horizontal positions, but not shapes. The “Temp+Strain+I1+I2” model was selected as the best to explain variation in tail scores (Table 4.1; Figure 4.2), suggesting that tail morphology reaction norms in different strains were not simply horizontally displaced as a whole, but rather that reaction norm shape and the distribution of tail scores differed among strains as well, indicating a temperature-by-strain interaction.

QTL analyses

In total, 157 recombinant inbred lines were generated; a subset of 66 was both phenotyped (Figure 4.3) and genotyped (Appendix 4.2); of the 90 original markers, 66 were informative. The range of phenotypes in the RILs exceeded that of the parental lines, except 74 at 24°C (Figure 4.3). A predominance of RILs with more feminized phenotypes, particularly at 18°C, suggests there may have been unintentional selection during RIL construction.

Although there were no apparent problems in the genetic map estimated from the genotype data, there were a few regions showing some segregation distortion (Table 4.2). One region of very strong segregation distortion on chromosome I probably resulted from incompatibility between the Bristol and Hawaiian alleles at the zeel-1 and peel-1 loci (Seidel et al., 2008). Regions of modest segregation distortion on chromosomes III, IV and V may have been the result of inadvertent selection for hermaphrodites during RIL construction, since these regions all contained QTL, and the overrepresented allele in each case was associated with more feminized phenotypes. Two additional markers on chromosome III and one on chromosome II showing distortion were not closely linked to any QTL but may have been the result of genotyping errors, indicated by the relatively large number of individuals missing genotypes at these markers.

A total of six distinct main QTL were identified by model selection (Table 4.3). The only trait for which all of these QTL were evident simultaneously was tail score at 16°C.

However, the QTL on chromosome IV was also evident for tail phenotype at 13°C and 18°C and for sex ratio at 16°C, and the QTL on chromosome I and one of the QTL on chromosome

V were also detected for tail phenotype at 13°C. No QTL were detected for tail score at 24°C, sex ratio at 13°C or 24°C, or for either measure of tail reaction norm shape.

The QTL identified for sex ratio at 18°C (Table 4.3) are probably statistical artifacts, for several reasons. The confidence interval for the QTL on chromosome I for this trait is very narrow and is entirely within the region of strong segregation distortion corresponding 75 to the zeel-1/peel-1 incompatibility (Table 4.2). Second, the two QTL on chromosome IV are closely linked, in fact with overlapping confidence intervals, and are in repulsion; such a pattern can often provide a strong but spurious model fit, and therefore it is best not to consider models with more than one QTL between any two adjacent markers, as in this case

(Broman and Sen, 2009). Finally, no models considering these three QTL individually or in pair-wise combinations performed better than the null model (all penalized LOD scores < 0).

Although not all these QTL are obvious in LOD profiles from standard interval mapping (Figure 4.4), this is expected because of the increased power of multiple-QTL models, since they test the effects of each putative QTL while accounting for variation due to other QTL (similar to composite interval mapping). This scenario is particularly likely for my data, because one QTL (on chromosome IV) had very large effects that would obscure the signal for the QTL of modest effect during interval mapping. Importantly, composite interval mapping (Wang et al. 2007) produced similar results and did not impact overall conclusions, suggesting my findings are robust to the particular choice of statistical models for QTL mapping (for a discussion of the differences between these two methods, see Broman and

Sen, 2009).

Discussion

To understand how SDMs evolve, we need to investigate variation in these pathways within species, in addition to divergence among species. Most prior studies on SDM microevolution have focused on individual or closely related groups of species segregating alleles with extremely large effects, such as loss-of-function alleles or dominant male- or female-determining factors, and which may be undergoing major transitions to new SDMs 76

(e.g., Hediger et al., 2010; Ser et al., 2010). In contrast, in this study, I have characterized variation in the SDM of C. elegans, an important model organism which is unlikely to be currently experiencing such a radical transition.

My results show that the joint effects of the tra-2(ar221) and xol-1(y9) alleles on gonadal sex ratio and sexually dimorphic tail phenotypes vary subtly but significantly with the wild genetic background in which they occur. Moreover, the discovery of at least one

QTL influencing both gonadal sex and tail morphology (Table 4.3; Figure 4.4) supports the idea that at least some of this variation is related to sex determination itself and not, say, genes influencing the differentiation of sex-specific tail phenotypes after sex has been determined. Interestingly, many RILs showed more extreme phenotypes than either parental line, similar to the results of Zauner and Sommer (2007). This pattern of transgressive segregation is not uncommon (Rieseberg et al., 1999; Rieseberg et al., 2003) and can be explained by, among other mechanisms, the co-occurrence of antagonistic QTL alleles within each parental line, which then recombine to produce more extreme phenotypes in the F2 and later generations. In this case, the transgressive phenotypes were biased in one direction

(Figure 4.3), specifically towards hermaphrodite-skewed sex ratios and feminized tail morphology. This bias may reflect unintentional selection for less masculinized hermaphrodites during RIL construction, consistent with patterns of segregation distortion at markers linked to QTL (Table 4.2; Table 4.3).

The presence of a genotype-by-environment (GxE; in this case, the environmental variable is temperature) interaction for tail phenotype (Table 4.1; Figure 4.2) suggests that this variation is not merely due to differences in overall pathway activity, but rather due to 77 variation in how sex-determining genes are regulated. In addition, although variation in transcription levels of sex-determining genes has been documented in Drosophila melanogaster (Tarone et al., 2005), translational and post-translational regulation both play crucial roles in sex determination in C. elegans (e.g., Clifford et al., 2000; Sokol and

Kuwabara, 2000) and therefore may be important components of this variation. QTL mapping revealed a small handful of loci underlying this variation, individually explaining moderate to large proportions (up to about 50%) of the among-strain variance in tail morphology and sex ratio at any particular temperature (Table 4.3). Thus, although this variation in C. elegans is less obvious compared to other species with known SDM polymorphisms, since it is only revealed in the context of a mutant genotype, its genetic basis is probably not too complex to dissect further with high-resolution mapping and candidate gene studies.

Some QTL had apparent effects at multiple temperatures. Although finer mapping is necessary to exclude completely the possibility that the seemingly common QTL at different temperatures are distinct but closely linked, this observation suggests that these QTL have effects that are generally consistent across environments, particularly the QTL with the largest effects, and therefore may reflect differences in overall pathway activity. Other QTL had effects that were temperature-specific, suggesting possible regulatory differences among these genetic backgrounds. However, qualitative similarity of LOD profiles across temperatures for both tail morphology and sex ratio (Figure 4.4) is also suggestive of common effects that were simply too weak to be detected in some cases. Moreover, despite the presence of GxE interactions among the five genetic backgrounds (Table 4.1) and 78 apparently substantial variation for reaction norm slope between 16°C and 18°C (Figure 4.3) among the RILs, no QTL influencing reaction norm slope were detected. This finding implies that the genetic architecture of reaction norm shape may differ from that of reaction norm intercept (and hence overall pathway activity or expression), perhaps distributed across more loci with effects too small to be identified in this study. Whether this conclusion applies to other reaction norms (e.g., thermal sex ratio reaction norms in TSD reptiles) remains to be tested. In contrast, however, several QTL mapping studies of phenotypic plasticity and GxE interactions in both morphological and life history traits have detected QTL influencing reaction norm slopes and with environment-specific effects (e.g., Gurganus et al., 1998;

Gutteling et al. 2007; Vieira et al. 2000).

What conclusions can we draw from these findings? First, even if a species is not currently experiencing a radical transition between SDMs such as the fixation of a novel male-determining factor or the conversion of an autosome to a sex chromosome, it may still harbor functional variation in its SDM. This observation suggests that in addition to major transitions in upstream sex-determining genes, SDMs may also be subject to more gradual change in other parts of the pathway, for example, in the relative importance of redundant gene interactions. In C. elegans, for instance, tra-2 regulates tra-1 in two distinct ways: directly, and via the fem genes; both are required for hermaphrodite spermatogenesis (Lum et al., 2000). In C. briggsae, though, which evolved self-fertility independently, indirect regulation through the fem intermediates is dispensable for spermatogenesis in hermaphrodites (Hill et al., 2006). Moreover, both fem-3 and fem-2 are epistatic to tra-1 in the C. elegans germline, but only fem-3 is in C. briggsae (Hill and Haag, 2009). Thus, these 79 species have taken different paths to the same trait. Such observations have led to the proposal that the differential loss and strengthening of ancestral redundant gene interactions in separate lineages (driven by either drift or, probably in the case of this example, selection) caused some of the interspecific differences in SDMs we see today (Ellis, 2006). Sex determination in C. elegans must involve such previously unknown, and probably minor or redundant, factors, and at least some of these are variable within this species. For example, two of the QTL (on chromosomes I and V) influencing somatic sexual phenotypes contained no candidate genes with a known role in somatic sex determination (Table 4.3). It will be interesting to see whether these minor components are shared by other Caenorhabditis species; it is worth noting that qualitative similarities have been discovered between intra- and interspecific variation in the signaling pathway underlying Caenorhabditis vulva patterning (Félix, 2007; Milloz et al., 2008) and in the basis of sexually dimorphic abdominal coloration in Drosophila (Kopp et al., 2003).

In addition, the presence of this variation may help explain co-evolutionary change seen in interacting sex-determining genes. Co-evolution is expected if amino acid substitutions altering the function of one gene help promote the fixation of compensatory mutations in its interaction partners (Haag et al., 2002). Although polymorphism in the sex- determining genes that have been examined in C. elegans is low (Graustein et al., 2002;

Haag and Ackerman, 2005), to illustrate this possibility, there is one non-synonymous single nucleotide polymorphism (SNP) in tra-3, whose function in sex determination is to activate

TRA-2A protein by cleavage (Sokol and Kuwabara, 2000) and which is an excellent candidate for the strongest QTL identified in this study (Table 4.3). If this polymorphism 80 affects TRA-3’s affinity for TRA-2A and is responsible for selectable phenotypic variation, it could favor compensatory changes in TRA-2A structure. Interestingly, this SNP mediates temperature’s influence on C. elegans body size (Kammenga et al., 2007), suggesting that the initial changes to sex-determining genes might have pleiotropic effects that could promote their fixation.

Along those lines, the selective forces influencing the maintenance or fixation of these variants in SDMs are an important consideration. Prior theoretical and empirical work has suggested that sex ratio selection (e.g., Bulmer and Bull, 1982; Conover and Van

Voorhees, 1990; Wilkins, 1995), sexual selection and sexual conflict (e.g., Pomiankowski et al., 2004; van Doorn and Kirkpatrick, 2007), and parent-offspring conflict (e.g., Werren et al., 2002), can drive the evolution of SDMs. This and other recent work examining the

“cryptic” evolution of developmental signaling pathways may offer additional hypotheses.

Milloz et al. (2008) hypothesized that cryptic variation among strains of C. elegans in cell signaling related to vulva patterning (i) could be neutral; (ii) might not be cryptic at all, but phenotypically exposed to selection in different environments; or (iii) may be a correlated response to selection on other traits affected by the same signaling pathways. Zauner and

Sommer (2007) proposed that variation in cell-cell interactions involved in vulval patterning within and among Pristionchus species might be due to selection for robustness to developmental noise in different environments, similar to the second hypothesis above. These possibilities likely apply to this SDM variation as well. For example, many “core” sex- determining genes have secondary roles in dosage compensation, meiosis, etc. (e.g., gld-1;

Clifford et al., 2000; Francis et al., 1995). Moreover, this type of cryptic variation may have 81 evolutionary consequences, for example on evolvability (de Visser et al., 2003), and SDM and sex chromosome evolution in particular may contribute to post-zygotic reproductive isolation (e.g., Baird, 2002; Wade et al., 1997).

This work illustrates how laboratory-generated mutations can be exploited to expose hidden variation in, and thus explore the microevolution of, sex determination, even in species that appear to lack such variation at first glance. I have shown that even taxa not currently undergoing major transitions in SDMs may harbor variation in sex determination, and such hidden variation is thought to lead eventually to pathway divergence. Further investigation of the QTL identified here, such as fine mapping to pinpoint the causative genes and more detailed cellular analyses of phenotypes, should provide a better view of their molecular bases. Examining how these variants interact with one another, and whether they have any phenotypic effects in non-mutant genotypes, will also illuminate what selective forces, if any, influence their evolution.

Acknowledgments

I thank G. Chadderdon, R. Den Adel, A. Heun, T. Mitchell, and T. Pepper for assistance in the lab, and F. Janzen, E. Myers, I. Dworkin, the Janzen laboratory, and two anonymous reviewers for very helpful constructive criticism on earlier versions of this manuscript. A. Bronikowski, F. Janzen, J. A. Powell-Coffman, S. Proulx, J. Serb, and J.

Wendel also provided valuable discussions and advice. J. Hodgkin, P. Phillips, and the

Caenorhabditis Genetics Center generously provided worm strains, and photographs of worms for phenotypic analysis were taken at the Iowa State University (ISU) Microscopy and Nano-Imaging Facility. H. Teotonio provided helpful guidance in the choice of SNP 82 genotyping methods. This work was funded by the ISU Department of Ecology, Evolution, and Organismal Biology, the ISU Center for Integrated Animal Genomics, the Society for

Integrative and Comparative Biology, the Iowa Academy of Sciences and Iowa Science

Foundation, and an ISU Ecology and Evolutionary Biology Bill Clark Award.

References

Baird SE (2002). Haldane's rule by sexual transformation in Caenorhabditis. Genetics 161: 1349-1353. Banerjee M, Capozzoli M, McSweeney L, Sinha D (1999). Beyond Kappa: A review of interrater agreement measures. Can J Stat 27: 3-23. Barriere A, Félix MA (2005). High local genetic diversity and low outcrossing rate in Caenorhabditis elegans natural populations. Curr Biol 15: 1176-1184. Blackmore MS, Charnov EL (1989). Adaptive variation in environmental sex determination in a nematode. Am Nat 134: 817-823. Brenner S (1974). The genetics of Caenorhabditis elegans. Genetics 77: 71-94. Broman KW, Sen S (2009). A Guide to QTL Mapping with R/qtl. Springer: New York, NY. Broman KW, Wu H, Sen S, Churchill GA (2003). R/qtl: QTL mapping in experimental crosses. Bioinformatics 19: 889-890. Bull JJ, Charnov EL (1977). Changes in heterogametic mechanism of sex determination. Heredity 39: 1-14. Bulmer MG, Bull JJ (1982). Models of polygenic sex determination and sex-ratio control. Evolution 36: 13-26. Chandler CH, Phillips PC, Janzen FJ (2009). The evolution of sex-determining mechanisms: lessons from temperature-sensitive mutations in sex determination genes in Caenorhabditis elegans. J Evol Biol 22: 192-200. Clifford R, Lee MH, Nayak S, Ohmachi M, Giorgini F, Schedl T (2000). FOG-2, a novel F- box containing protein, associates with the GLD-1 RNA binding protein and directs male sex determination in the C. elegans hermaphrodite germline. Development 127: 5265-5276. Cline TW, Meyer BJ (1996). Vive la différence: males vs females in flies vs worms. Annu Rev Genet 30: 637-702. Conover DO, Van Voorhees DA (1990). Evolution of a balanced sex ratio by frequency- dependent selection in a fish. Science 250: 1556-1558. Cook JM, Crozier RH (1995). Sex determination and population biology in the Hymenoptera. Trends Ecol Evol 10: 281-286. de Visser JAGM, Hermisson J, Wagner GP, Meyers LA, Bagheri HC, Blanchard JL et al (2003). Perspective: Evolution and detection of genetic robustness. Evolution 57: 1959-1972. 83 deBono M, Hodgkin J (1996). Evolution of sex determination in Caenorhabditis: Unusually high divergence of tra-1 and its functional consequences. Genetics 144: 587-595. Ellis RE (2006). Enigma variations: control of sexual fate in nematode germ cells. Genome Biol 7: 227. Félix MA (2007). Cryptic quantitative evolution of the vulva intercellular signaling network in Caenorhabditis. Curr Biol 17: 103-114. Francis R, Maine E, Schedl T (1995). Analysis of the multiple roles of gld-1 in germline development: interactions with the sex determination cascade and the glp-1 signaling pathway. Genetics 139: 607-630. Graustein A, Gaspar JM, Walters JR, Palopoli MF (2002). Levels of DNA polymorphism vary with mating system in the nematode genus Caenorhabditis. Genetics 161: 99-107. Gurganus, MC, Fry JD, Nuzhdin SV, Pasyukova EG, Lyman RF, Mackay TFC (1998). Genotype-environment interaction at quantitative trait loci affecting sensory bristle number in Drosophila melanogaster. Genetics 149: 1883-1898. Gutteling EW, Riksen JAG, Bakker J, Kammenga JE (2007). Mapping phenotypic plasticity and genotype-environment interactions affecting life-history traits in Caenorhabditis elegans. Heredity 98: 28-37. Haag ES, Ackerman AD (2005). Intraspecific variation in fem-3 and tra-2, two rapidly coevolving nematode sex-determining genes. Gene 349: 35-42. Haag ES, Doty AV (2005). Sex determination across evolution: Connecting the dots. PLoS Biol 3: 21-24. Haag ES, Wang SP, Kimble J (2002). Rapid coevolution of the nematode sex-determining genes fem-3 and tra-2. Curr Biol 12: 2035-2041. Haber M, Schungel M, Putz A, Muller S, Hasert B, Schulenburg H (2005). Evolutionary history of Caenorhabditis elegans inferred from microsatellites: evidence for spatial and temporal genetic differentiation and the occurrence of outbreeding. Mol Biol Evol 22: 160-173. Hediger M, Henggeler C, Meier N, Perez R, Saccone G, Bopp D (2010). Molecular characterization of the key switch F provides a basis for understanding the rapid divergence of the sex-determining pathway in the housefly. Genetics 184: 155-170. Hill RC, de Carvalho CE, Salogiannis J, Schlager B, Pilgrim D, Haag ES (2006). Genetic flexibility in the convergent evolution of hermaphroditism in Caenorhabditis nematodes. Dev Cell 10: 531-538. Hill RC, Haag ES (2009). A sensitized genetic background reveals evolution near the terminus of the Caenorhabditis germline sex determination pathway. Evol Dev 11: 333-342. Hodgkin J (2002). Exploring the envelope: Systematic alteration in the sex-determination system of the nematode Caeraorhabditis elegans. Genetics 162: 767-780. Hodgkin J, Doniach T (1997). Natural variation and copulatory plug formation in Caenorhabditis elegans. Genetics 146: 149-164. Janzen FJ, Phillips PC (2006). Exploring the evolution of environmental sex determination, 84

especially in reptiles. J Evol Biol 19: 1775-1784. Kallman KD (1968). Evidence for the existence of transformer genes for sex in the teleost Xiphophorus maculatus. Genetics 60: 811-828. Kammenga JE, Doroszuk A, Riksen JAG, Hazendonk E, Spiridon L, Petrescu AJ et al (2007). A Caenorhabditis elegans wild type defies the temperature-size rule owing to a single nucleotide polymorphism in tra-3. PLoS Genet 3: 358-366. Kopp A, Graze RM, Xu SZ, Carroll SB, Nuzhdin SV (2003). Quantitative trait loci responsible for variation in sexually dimorphic traits in Drosophila melanogaster. Genetics 163: 771-787. Korpelainen H (1998). Labile sex expression in plants. Biol Rev 73: 157-180. Kozielska M, Weissing FJ, Beukeboom LW, Pen I (2009). Segregation distortion and the evolution of sex-determining mechanisms. Heredity 104: 100-112. Lum DH, Kuwabara PE, Zarkower D, Spence AM (2000). Direct protein-protein interaction between the intracellular domain of TRA-2 and the transcription factor TRA-1A modulates feminizing activity in C. elegans. Genes Dev 14: 3153-3165. Mank JE, Promislow DEL, Avise JC (2006). Evolution of alternative sex-determining mechanisms in teleost fishes. Biol J Linnean Soc 87: 83-93. Meise M, Hilfiker-Kleiner D, Dubendorfer A, Brunner C, Nothiger R, Bopp D (1998). Sex- lethal, the master sex-determining gene in Drosophila, is not sex-specifically regulated in Musca domestica. Development 125: 1487-1494. Milloz J, Duveau F, Nuez I, Félix M-A (2008). Intraspecific evolution of the intercellular signaling network underlying a robust developmental system. Genes Dev 22: 3064-3075. Ogata M, Hasegawa Y, Ohtani H, Mineyama M, Miura I (2008). The ZZ/ZW sex- determining mechanism originated twice and independently during evolution of the frog, Rana rugosa. Heredity 100: 92-99. Pane A, Salvemini M, Bovi PD, Polito C, Saccone G (2002). The transformer gene in Ceratitis capitata provides a genetic basis for selecting and remembering the sexual fate. Development 129: 3715-3725. Pomiankowski A, Nothiger R, Wilkins A (2004). The evolution of the Drosophila sex- determination pathway. Genetics 166: 1761-1773. Raymond CS, Shamu CE, Shen MM, Seifert KJ, Hirsch B, Hodgkin J et al (1998). Evidence for evolutionary conservation of sex-determining genes. Nature 391: 691-695. Rebeiz M, Pool JE, Kassner VA, Aquadro CF, Carroll SB (2009). Stepwise modification of a modular enhancer underlies adaptation in a Drosophila population. Science 326: 1663-1667. Rhen T, Lang JW (1998). Among-family variation for environmental sex determination in reptiles. Evolution 52: 1514-1520. Rieseberg LH, Archer MA, Wayne RK (1999). Transgressive segregation, adaptation and speciation. Heredity 83: 363-372. Rieseberg LH, Widmer A, Arntz AM, Burke JM (2003). The genetic architecture necessary for transgressive segregation is common in both natural and domesticated 85

populations. Philos Trans R Soc Lond B 358: 1141-1147. Roberts RB, Ser JR, Kocher TD (2009). Sexual conflict resolved by invasion of a novel sex determiner in Lake Malawi cichlid fishes. Science 326: 998-1001. Saccone G, Peluso I, Artiaco D, Giordano E, Bopp D, Polito LC (1998). The Ceratitis capitata homologue of the Drosophila sex-determining gene Sex-lethal is structurally conserved, but not sex-specifically regulated. Development 125: 1495-1500. Sanchez L (2008). Sex-determining mechanisms in insects. Int J Dev Biol 52: 837-856. Seidel HS, Rockman MV, Kruglyak L (2008). Widespread genetic incompatibility in C. elegans maintained by balancing selection. Science 319: 589-594. Ser JR, Roberts RB, Kocher TD (2010). Multiple interacting loci control sex determination in Lake Malawi cichlid fish. Evolution 64: 486-501. Shaham, S, ed. (2006). WormBook: Methods in Cell Biology (January 02, 2006). In: The C. elegans Research Community (ed). WormBook, doi 10.1895/wormbook.1.49.1, http:// www.wormbook.org. Sokol SB, Kuwabara PE (2000). Proteolysis in Caenorhabditis elegans sex determination: cleavage of TRA-2A by TRA-3. Genes Dev 14: 901-906. Takehana Y, Hamaguchi S, Sakaizumi M (2008). Different origins of ZZ/ZW sex chromosomes in closely related medaka fishes, Oryzias javanicus and O. hubbsi. Chromosome Res 16: 801-811. Tarone AM, Nasser YM, Nuzhdin SV (2005). Genetic variation for expression of the sex determination pathway genes in Drosophila melanogaster. Genet Res 86: 31-40. True JR, Haag ES (2001). Developmental system drift and flexibility in evolutionary trajectories. Evolution Dev 3: 109-119. van Doorn GS, Kirkpatrick M (2007). Turnover of sex chromosomes induced by sexual conflict. Nature 449: 909-912. Vandeputte M, Dupont-Nivet M, Chavanne H, Chatain B (2007). A polygenic hypothesis for sex determination in the European sea bass Dicentrarchus labrax. Genetics 176: 1049-1057. Vieira C, Pasyukova EG, Zeng Z-B, Hackett JB, Lyman RF, Mackay TFC (2000). Gentoype- environment interaction for quantitative trait loci affecting life span in Drosophila melanogaster. Genetics 154: 213-227. Wade MJ, Johnson NA, Jones R, Siguel V, McNaughton M (1997). Genetic variation segregating in natural populations of Tribolium castaneum affecting traits observed in hybrids with T. freemani. Genetics 147: 1235-1247. Wang S, Basten CJ, Zeng Z-B (2007). Windows QTL Cartographer 2.5. Department of Statistics, North Carolina State University, Raleigh, NC. (http://statgen.ncsu.edu/ qtlcart/WQTLCart.htm) Werren JH, Hatcher MJ, Godfray HCJ (2002). Maternal-offspring conflict leads to the evolution of dominant zygotic sex determination. Heredity 88: 102-111. Whitfield LS, Lovellbadge R, Goodfellow PN (1993). Rapid sequence evolution of the mammalian sex-determining gene sex-determining gene Sry. Nature 364: 713-715. Wilkins AS (1995). Moving up the hierarchy: A hypothesis on the evolution of a genetic sex 86

determination pathway. Bioessays 17: 71-77. Wolff JR, Zarkower D (2008). Somatic sexual differentiation in Caenorhabditis elegans. Curr Top Dev Biol 83: 1-39. Zauner H, Sommer RJ (2007). Evolution of robustness in the signaling network of Pristionchus vulva development. Proc Natl Acad Sci USA 104: 10086-10091. 87

Tables

Table 4.1. Hierarchical likelihood ratio tests comparing models evaluated to explain variation in sex ratio and tail morphology in temperature-sensitive Caenorhabditis elegans mutants.

Model name Model -log(L) !2 d.f. P Null P(male) = a 266.2 - - - 27.7 477.0 1 -106 Sex Temp P(male) = 1 / (1 + exp(-(a + bT))) 9.8 ! 10 -6 ratio *Temp+Strain P(male) = 1 / (1 + exp(-(ai + bT))) 12.9 29.7 4 5.6 ! 10

Temp+Strain+I P(male) = 1 / (1 + exp(-(ai + biT))) 9.9 6.0 4 0.2

Null P(tail > j) = aj 597.6 - - - -166 Temp P(tail > j) = 1 / (1 + exp(-(aj + bT))) 219.3 756.6 1 1.4 ! 10 Tail Temp+Strain P(tail > j) = 1 / (1 + exp(-(a + bT + h ))) 197.5 43.5 4 8.0 ! 10-9 score j i -8 Temp+Strain+I1 P(tail > j) = 1 / (1 + exp(-(ai,j + bT))) 163.1 68.8 16 1.6 ! 10 -4 *Temp+Strain+I1+I2 P(tail > j) = 1 / (1 + exp(-(ai,j + biT))) 153.8 18.7 4 9.0 ! 10 Sex ratio models are logistic models expressing the probability of a particular individual of strain i being a male; a, ai, b, and bi are parameters, and T is the rearing temperature. For tail score, I used ordinal logistic models (essentially, a series of parallel logistic models) to express the probability of a particular worm of strain i having a tail score greater than j (where j = 1, 2, 3, 4, or 5, since tail score can range from 1-6). ai,j, aj, bi, b, and hi are parameters, and T is temperature. Each model is compared to the one above it; P-values less than 0.05 indicate that the model performs significantly better than the preceding one. Asterisks indicate the best model for each trait selected by likelihood ratio tests. 88

Table 4.2. Markers showing evidence of segregation distortion.

No. with No. with No. with Marker ID Chrom. Pos. (cM) missing N2 CB4856 P genotype allele allele CE1-159 I -17.9 1 48 17 1.21 " 10-4 CE1-242 I -9.5 0 64 2 2.32 " 10-14 pas2341 I -3.7 0 47 19 5.68 " 10-4 CE2-161 II 0.6 13 40 13 2.08 " 10-4 CE3-104 III -26.8 2 22 42 1.24 " 10-2 CE3-109 III -22.5 0 23 43 1.38 " 10-2 CE3-122 III -11.2 0 24 42 2.67 " 10-2 CE3-198 III 13.2 30 31 5 1.47 " 10-5 CE3-205 III 18.1 28 33 5 5.57 " 10-6 uCE4-670 IV -7.3 0 22 44 6.77 " 10-3 CE4-120 IV -3.8 1 20 45 1.93 " 10-3 CE4-224 IV -1.2 2 19 45 1.15 " 10-3 uCE4-905 IV 1.4 2 16 48 6.33 " 10-5 uCE4-1020 IV 3.6 1 14 51 4.45 " 10-6 CE4-1 IV 5.1 2 18 46 4.65 " 10-4 CE4-194 IV 8.6 2 18 46 4.65 " 10-4 uCE4-1337 IV 11.9 7 18 41 2.75 " 10-3 CE4-213 IV 14.8 1 18 47 3.22 " 10-4 CE4-221 IV 16.4 2 20 44 2.70 " 10-3 CE5-102 V -20.0 0 46 20 1.37 " 10-3 CE5-128 V -12.8 2 44 20 2.70 " 10-3 CE5-134 V -8.0 13 46 7 8.46 " 10-8 CE5-139 V -5.0 0 49 17 8.18 " 10-5 CE5-147 V -1.9 4 46 16 1.39 " 10-4 CE5-228 V 8.3 0 44 22 6.77 " 10-3 89

Table 4.3. Positions and 1.5-LOD confidence intervals, LOD scores, effect estimates, percentage of variance explained, and potential candidate sex-determining genes of loci identified in QTL mapping.

CI- CI- Trait/ Pos Min Max Max % var. Temp Chrom. (cM) (cM) (cM) LOD Effect explained SD Candidates Tail, I 2.7 -1.9 7.1 4.9 -0.3 12.2 gld-1* 13°C fog-3* rpn-10* IV 12.7 9.7 14.7 12.5 -0.65 12.5 tra-3 V 10.0 6.0 12.0 7.0 0.43 7.0 sdc-3 Tail, I 5.0 0.1 9.1 6.0 -0.32 11.6 gld-1* 16°C fog-3* rpn-10* II -8.6 -11.6 1.4 4.2 -0.22 7.7 sea-1 fkh-6 mog-5* fbf-1* fbf-2* tra-2 nos-2* gld-3* III -26.8 -26.8 -19.8 3.8 -0.25 6.8 fem-2 IV 10.7 9.7 14.7 16.4 -0.74 48.3 tra-3 V -20.0 -20.0 -13.0 6.1 0.35 11.9 n/a V 15.0 -4.0 22.4 3.2 0.21 5.6 oma-2* her-1 sdc-3 sel-10 Tail, IV 11.9 -9.0 16.4 3.2 -0.67 20.0 fem-1 18°C oma-1* fem-3 tra-3 Sex IV 9.7 -17.3 16.4 2.6 -0.018 16.8 fem-1 ratio, oma-1* 16°C fem-3 tra-3 Sex I -9.5 -9.9 -8.9 5.5 0.28 28.4 n/a ratio, IV 8.7 6.7 10.7 3.7 0.23 17.7 n/a 18°C IV 10.7 9.7 11.7 4.9 -0.27 24.7 n/a Effect indicates the effect of the CB4856 allele relative to the N2 allele. Asterisks denote genes currently known to be involved in germline sex determination only. 90

Figures

Figure 4.1. Scoring system for tail morphology. 1 = wild-type hermaphrodite; 2 = tail whip is present but shortened or masculinized; 3 = tail whip is absent but tail retains overall hermaphrodite shape ; 4 = tail has blunted, male-like shape but lacks fan and rays; 5 = fan or rays present but reduced in size or number; 6 = wild-type male. 91

Figure 4.2. Plots of (A) gonadal sex ratio and (B) mean tail morphology score as a function of rearing temperature for tra-2(ar221); xol-1(y9) strains with different genetic backgrounds.

1.0 A 0.8 0.6 N2 CB4856

0.4 MY2 AB1 JU258 0.2 0.0 Sex ratio (proportion of males) (proportion Sex ratio 12 14 16 18 20 22 24 6 B 5 4 3 Mean tail score tail Mean 2 1

12 14 16 18 20 22 24

Temperature (°C) 92

Figure 4.3. Plots of (A) gonadal sex ratio and (B) mean tail morphology score as a function of rearing temperature for recombinant inbred lines. The parental lines are shown in bold.

1.0 A 0.8 0.6

0.4 N2 CB4856 0.2 0.0 Sex ratio (proportion of males) (proportion Sex ratio 12 14 16 18 20 22 24 6 B 5 4 3 Mean tail score tail Mean 2 1

12 14 16 18 20 22 24

Temperature (°C) 93

Figure 4.4. LOD plots from exploratory interval mapping (IM) analysis of tail morphology and sex ratio at four rearing temperatures and of tail reaction norm slope in two temperature intervals, showing overall qualitative similarity for sex ratio and tail phenotypes across temperatures. Horizontal dashed lines indicate significance thresholds for IM computed by permutation. Sex ratio at 13°C is omitted because there was no variation in sex ratio among RILs at that temperature. QTL significance (Table 4.3) was then assessed using a more powerful multiple-QTL model selection approach.

Mean tail score

8 13°C 16°C 6 18°C 4 24°C tail13 2

I II III IV V X

Chromosome Gonadal sex ratio

2.5 2.0 16°C 1.5 18°C

sex16 1.0 24°C

LOD Score LOD 0.5 0.0

I II III IV V X

Chromosome Tail reaction norm slope

2.5 2.0 16°C - 13°C 1.5 18°C - 16°C 1.0 slope1316 0.5 0.0

I II III IV V X Position 94

Appendices

Appendix 4.1. Genetic markers used for QTL mapping.

Pos. Name Chrom. (cM) SNP Forward Primer Reverse Primer CE1-159 I -17.93 T/G ACGTTGGATGCCTCTTGGACCTTCTAAGAC ACGTTGGATGTGTATTTGCGGAATCGAGGC CE1-250 I -14.68 T/A ACGTTGGATGGTTGCAATAAGTGACGATT ACGTTGGATGCAGGATTGCAAGATTGCAAA CE1-242 I -9.51 T/C ACGTTGGATGAGTTACTGGCTTCTAGACGG ACGTTGGATGATATCCAACAGGGAATCGTC pas16806 I -6.29 T/G ACGTTGGATGCGAAAAGCTGCGTGTGAATC ACGTTGGATGTGGAGAAGGAGAGTAAGTTG pas2341 I -3.74 C/T ACGTTGGATGAAAATATCCAAACCCCCTAC ACGTTGGATGCTCACGACAATTTCTGCCTG pas20379 I -1.87 C/T ACGTTGGATGTCCCAGACTATCTCATTTGC ACGTTGGATGTGGTAGGAATTTTGAAACGG pas4078 I 1.12 G/A ACGTTGGATGTAGTACATTCTTTGCACGGG ACGTTGGATGCAGATTCTAATGCATTTAGC CE1-170 I 2.71 A/G ACGTTGGATGCGCATGATATCCTTCCATTC ACGTTGGATGACGAAGCATTAGTAAGACCC CE1-186 I 5.03 A/G ACGTTGGATGCATACCGTACTCTTGTGAGA ACGTTGGATGCCTGCGTCAAGAATCTTCTC CE1-199 I 9.48 G/T ACGTTGGATGATTGTACAAGTAATTGAAAG ACGTTGGATGTCGTTTTGTGCACGAAATTG CE1-204 I 13.06 A/T ACGTTGGATGATGGTTTTGGACCAGGTTGC ACGTTGGATGTGCTCTAGCTTGTATGGAAG CE1-212 I 17.25 T/A ACGTTGGATGGTGCAAGCTAGCCTACTTTG ACGTTGGATGGGGTAAATCGTAGATCTGGG CE1-229 I 21.62 A/G ACGTTGGATGAAACAGCTGTTTTTTTTTTG ACGTTGGATGGTTTTTCGCCAAAAAAAAGCC CE1-258 I 24.4 T/A ACGTTGGATGAGAAGGTGATGTCTTGCAGG ACGTTGGATGCCATCGTTTCTCCGAACATC CE1-226 I 27.3 G/T ACGTTGGATGACTTTTCCTAGGACCTCCAG ACGTTGGATGCTCTACGGTAGATTATTGGC CE2-111 II -14.48 A/C ACGTTGGATGGCCGAATTTCGTAACTACGC ACGTTGGATGCCAAATTCTATGAGCGGGAC nP136 II -11.56 G/A ACGTTGGATGCGAAAACGACTACCAACTTG ACGTTGGATGATAAGTACGTCTGCATCGCC CE2-122 II -8.9 G/T ACGTTGGATGCAATGTTCACGTCAGATGCC ACGTTGGATGTTGCTGGCTTTTCAGGTAAC CE2-126 II -6.22 A/G ACGTTGGATGTGCGTAGTTTGATCTACCAG ACGTTGGATGCGTGATCACTGATTTTATGG CE2-134 II -3.67 A/G ACGTTGGATGCATTGGAATTATTTTTAAGAG ACGTTGGATGAAAGATACGATTCTCGTGAC CE2-139 II -1.79 G/A ACGTTGGATGCTAAAAAGTTGTTCAGTGGC ACGTTGGATGCGTTCATTTTCATCATTTC CE2-161 II 0.62 G/A ACGTTGGATGCATTCATTGGTCTCTTGAAC ACGTTGGATGGTTGTAAGCTTTATTGTCTG CE2-190 II 3.41 A/C ACGTTGGATGAACAAACAAGGCAGCTTCCC ACGTTGGATGAGTGTGCAATCCGGGAGAAG CE2-197 II 5.86 G/A ACGTTGGATGTCCTCAATTTCCCAGCTCTC ACGTTGGATGGTGGCCTTCCTTCTCCATAT pkP2111 II 8.16 T/A ACGTTGGATGCTAATTCCATATTCCACTGGC ACGTTGGATGTTCTGTGACGTCATCAGTCC CE2-204 II 11.12 A/G ACGTTGGATGATCAAGATGTGGCGACGTTC ACGTTGGATGGGGAACTGGACGATAGCTGT CE2-206 II 14.25 T/G ACGTTGGATGGTATGCGAGGAGCCTTCTTC ACGTTGGATGTTGGAACTTAGACTAGCGTG pkP2117 II 17.96 A/T ACGTTGGATGCGAACCCTAAAAAATTGCCC ACGTTGGATGAGGCTGTCCTTTTTTTTGGG CE2-212 II 20.3 A/T ACGTTGGATGTTCAGTGTTAGTTGAACAG ACGTTGGATGCTACCGCCTAGTTTTTGCAC CE2-215 II 22.44 A/T ACGTTGGATGAGTCTAAATATCTAGCCCAC ACGTTGGATGCCAATATGGAGCTGGGGAG CE3-104 III -26.85 G/T ACGTTGGATGCGTTTACGTTCATGTTCTAGG ACGTTGGATGGCAAAGAGCATATGGGATTG CE3-109 III -22.55 A/G ACGTTGGATGTTACTTGACATTGGCCTCCG ACGTTGGATGTGTAGAGCGGTATAGCTTAG pkP3084 III -15.68 G/T ACGTTGGATGGAAGAATTATCGATTTTCCG ACGTTGGATGCAGAAAATCGATAATTCGTC CE3-122 III -11.19 A/G ACGTTGGATGTAGGCATGCTGGTCTTTTGG ACGTTGGATGAATACCTGCCTGCTTAGGTG CE3-126 III -7.31 A/G ACGTTGGATGGCTGAAAATGAGCTGAGTTC ACGTTGGATGGGAATTCTTTTTTCAAAAGT CE3-133 III -4.11 T/C ACGTTGGATGGCCTTCCTTCAAACTAGACC ACGTTGGATGATGAACTTGAGATTGTACGG CE3-136 III -3.18 T/C ACGTTGGATGGTCCTTGCATCGACAGTATC ACGTTGGATGAACAGGCGGCGAGCTGGAG CE3-178 III 0.32 G/T ACGTTGGATGCCGAAAACTTCTGACTCACG ACGTTGGATGCCATTCCAATCAAGAATTCAG CE3-188 III 3.51 T/G ACGTTGGATGACTGGGTTTTAACATGGTTC ACGTTGGATGCACCTTGCTAGTTTGTATC pkP3073 III 6.99 G/A ACGTTGGATGCTCTAGAATTCAAAGCTTCTG ACGTTGGATGCGCGTGCTCTTTTTCTCTTT CE3-196 III 11.03 G/T ACGTTGGATGTTGTAAAAATTATGTTTGGC ACGTTGGATGGAACCTCTAAAATTGACCTG CE3-198 III 13.25 C/A ACGTTGGATGTCTGCTGTTTGGAATGGCTC ACGTTGGATGCTTGAAGCACATCGCTAAAA CE3-201 III 16.15 A/G ACGTTGGATGTTATGAGGGAAGCCAGAAGC ACGTTGGATGAGCTAGGAGCAATAAGCGAG CE3-205 III 18.08 T/C ACGTTGGATGGCCAGAAATCCGTGAAAATG ACGTTGGATGTTTAATTTAAATTTTCATCG CE3-212 III 21.29 A/G ACGTTGGATGTCAGCTCAGCAGCTCTTATC ACGTTGGATGAGAGAAATGAGGTGGCCTTG pkP4049 IV -25.99 T/G ACGTTGGATGCAAAAACGTAGTACTTGTG ACGTTGGATGCTACAATTCTTGATTTTAC CE4-228 IV -22.3 A/G ACGTTGGATGTGAGCAGTCAAAGATCGCAG ACGTTGGATGAACTTTTTACCGAACCAAG pkP4066 IV -18.49 G/T ACGTTGGATGTCTCTCAAAGTTTCCCCCAG ACGTTGGATGCCTGCTTGCGTAGCAGATTG snp_Y41D4[6] IV -16.24 G/A ACGTTGGATGAAGGGAAAAGTGTGGCGTA ACGTTGGATGTCCCCACTTTTTTTCGTGGC CE4-109 IV -11.26 T/C ACGTTGGATGGCCAGTTTTGCTAGAGTTCG ACGTTGGATGCTACGAGCAGTGTGTGTATG uCE4-670 IV -7.27 T/C ACGTTGGATGATCGGGTAGATTGGACGTTG ACGTTGGATGTCCTAGTCCGCCTAATTTCC CE4-120 IV -3.76 A/T ACGTTGGATGCGGGAGGTTACTGATGTTTC ACGTTGGATGATAACACCGCAGAAGTCCAG CE4-224 IV -1.18 T/C ACGTTGGATGGGTTAGTTCCCATTTGAAATC ACGTTGGATGTCGATGCACAGTCCGTGAAC uCE4-905 IV 1.42 A/G ACGTTGGATGGCACGAGCATTCTCAGAAAC ACGTTGGATGCAGTATTTTGTTGTTTCAAAG uCE4-1020 IV 3.59 T/C ACGTTGGATGCAACCCGATTCCCAGTTTTC ACGTTGGATGAAAGTACCAACTATCTCCCG CE4-1 IV 5.14 T/C ACGTTGGATGGAATGGTTGTATTGGGCCAG ACGTTGGATGGCTCATCCATGAAAGATTGC CE4-194 IV 8.59 T/C ACGTTGGATGTCGTCGCGAAATGTCGTGTC ACGTTGGATGTAAAATCTGCAATTTCAATG uCE4-1337 IV 11.92 A/G ACGTTGGATGCTCGGAAGCATTTGAACTCG ACGTTGGATGCATTGTTTCGAGTGCATTTC CE4-213 IV 14.79 T/C ACGTTGGATGTTGCCTGATGACAGGATGAC ACGTTGGATGAAAAAAACAATATTTTAGCG 95

Appendix 4.1. (continued)

Pos. Name Chrom. (cM) SNP Forward Primer Reverse Primer CE4-221 IV 16.43 T/C ACGTTGGATGCGATGAAGATGGTTTTCGATG ACGTTGGATGTCACGCCTTGTTGAATTCTC CE5-102 V -20.01 G/A ACGTTGGATGCTCGCCGAGTCAGTATTTTC ACGTTGGATGTACAATTGGAACGACCGGAG CE5-121 V -15.85 A/G ACGTTGGATGAGGGATATGTGTGCGGAAAG ACGTTGGATGCCGATACAAAATTTTTTATTC CE5-128 V -12.8 A/G ACGTTGGATGACTCGCAAAAATGGGCAACG ACGTTGGATGTCGGCTAATTAAAGACAAG CE5-134 V -8.04 A/G ACGTTGGATGACATGTGAAGGTGAAGAGCG ACGTTGGATGAAAGAGTAGGCAGGAGTCAG CE5-139 V -4.99 A/G ACGTTGGATGTCGTGTTCCATTTTCCACCC ACGTTGGATGTGCTCCCGTCGCCATTTTAC CE5-147 V -1.89 G/C ACGTTGGATGCGAGTTAGATTTACTGAGCAC ACGTTGGATGCGAAAAAGACAATTTCGGGC CE5-175 V 1.95 A/G ACGTTGGATGGACAAACGCTTGGAAGCTAC ACGTTGGATGCGATCGTAGTTGATAGAAAG CE5-207 V 4.94 G/A ACGTTGGATGGAAAAGCCCCCTTTTTTCTG ACGTTGGATGCAGCAGAAAATATGATGGATG CE5-228 V 8.32 A/G ACGTTGGATGCCCAGTTTTTAGAATCCTCG ACGTTGGATGATATAGTTGAAGCCAGAAG pas33383 V 13.21 A/T ACGTTGGATGCCTGGAGTAGTCCTACAGTA ACGTTGGATGGACTTGCGTAACATTTGCCG pas8833 V 15.16 A/T ACGTTGGATGTATTCGGGCGATCTCTAGTG ACGTTGGATGGGAAAGTTGAAGCTTCTGAG CE5-253 V 17.63 T/C ACGTTGGATGCACGTTTTTACACGTCTAAC ACGTTGGATGGTTATGACAGTGGTGGTCAG CE5-286 V 20.21 A/C ACGTTGGATGCCCGTGTAGTAGAAAATGCG ACGTTGGATGCCAGCATTTTTCTCGGGTAG CE5-258 V 22.41 A/C ACGTTGGATGCTGTATGGTGACATCACTCG ACGTTGGATGCAAAGCCATTTCTGACTGGT pas10554 V 24.95 A/G ACGTTGGATGCATAATTTCCCCCTTATTCC ACGTTGGATGAGTACCTCCTGAGAGTGTTG CE6-105 X -19.69 T/G ACGTTGGATGCTCATACATCATCGGTTCTC ACGTTGGATGGGATTTGCATTTTTTGCCCG pas14056 X -17.04 A/G ACGTTGGATGGTTTTGTCCACTACTTGTACT ACGTTGGATGTGACAGTTTTGCGACGATAC CE6-120 X -13.73 T/A ACGTTGGATGGAAAATGTATTTGGCTTCTGC ACGTTGGATGTTTTAGTTGGTCGTTTTGGC CE6-126 X -10.35 C/T ACGTTGGATGTCCAGAGCACAAGGAACTTC ACGTTGGATGTGCAAAGAGTGCAGAGGAAG CE6-133 X -7.23 T/C ACGTTGGATGGCGGTCTACCCAAACAAAAC ACGTTGGATGATAACTGTCTTGGAGGCCTT pas16968 X -4.04 C/T ACGTTGGATGCACTTTCACATGCACTACTC ACGTTGGATGAGAATCTGGTATGAGCTTAC uCE6-1056 X -0.88 A/G ACGTTGGATGGTTCTGAGCAGCCTTCTTTG ACGTTGGATGCCGGCGTTGAAACTGTTAAG pas4741 X 2.38 G/A ACGTTGGATGGAAGAAACTATTCGCAGAGC ACGTTGGATGAATAGAAAAGGCGGGGCATC CE6-183 X 5.13 C/T ACGTTGGATGGAAGCTACTCACTAAAAGCC ACGTTGGATGCTTGGTTACTAAAGGCCTTG CE6-23 X 9.37 A/G ACGTTGGATGAGCGACCCAATGAAAATGAC ACGTTGGATGGGTATGGAATTCAACCAAAGG CE6-195 X 12.63 A/G ACGTTGGATGAGTACTGAAAAAAGTTCCC ACGTTGGATGGTATTTCCTCAAGTCAAAAG CE6-197 X 14.08 G/A ACGTTGGATGCGAGAGTGTCATGGAAGTTG ACGTTGGATGCACAAAGTGAAAAAAAAATCC CE6-206 X 16.73 G/A ACGTTGGATGATGTTCTGTACTCGTCGTCC ACGTTGGATGGCGCCAATACAAGGAATTCG CE6-208 X 20.89 C/A ACGTTGGATGTTTTAAAATGTTTTTTGACC ACGTTGGATGATGATAAGGACGTCACGCAG CE6-239 X 24.07 T/C ACGTTGGATGGGCCAAGCTAATCCTCAAAG ACGTTGGATGGACTGCATTGAGTGCAAGAG 96

Appendix 4.2. Genotypes of recombinant inbred lines used in QTL mapping. For each marker, 1 and 2 indicate the N2 and Hawaiian alleles, respectively, and -1 denotes a missing genotype.

ID CE1-159 CE1-242 pas2341 CE1-170 CE1-186 CE1-199 CE1-229 CE1-258 CE1-226 CB5362 1 1 1 1 1 1 1 1 1 FJJ1009 2 2 2 2 2 2 2 2 2 RIL002 1 1 1 1 1 1 1 1 -1 RIL019 1 1 1 2 2 2 2 2 2 RIL021 1 1 1 1 1 1 1 1 1 RIL031 2 1 1 1 1 2 1 1 1 RIL037 1 1 2 2 2 2 2 2 -1 RIL060 1 1 1 -1 1 1 1 1 1 RIL062 1 1 1 -1 1 1 1 1 1 RIL067 1 1 1 1 1 1 2 2 2 RIL070 1 1 2 2 2 2 2 2 2 RIL074 1 1 2 2 2 2 2 2 2 RIL078 2 1 1 1 1 1 1 1 1 RIL085 1 1 1 1 1 1 1 1 1 RIL090 1 1 2 2 2 2 2 2 1 RIL095 2 1 1 2 2 2 2 2 2 RIL097 1 1 1 1 1 2 2 2 2 RIL101 1 1 1 1 1 1 1 1 1 RIL108 1 1 1 -1 1 1 2 2 2 RIL115 1 1 2 1 1 1 1 1 1 RIL128 2 1 1 2 2 1 2 2 -1 RIL131 2 1 2 2 2 1 1 1 1 RIL133 1 1 1 1 1 1 2 2 2 RIL138 1 1 1 1 1 1 1 1 1 RIL142 1 1 1 1 1 2 2 2 2 RIL147 2 1 1 2 2 2 2 2 2 RIL150 1 1 2 2 1 1 2 2 2 RIL153 1 1 1 2 2 2 2 2 2 RIL159 1 1 1 2 2 1 2 2 2 RIL161 1 1 1 2 2 2 2 2 2 RIL168 1 1 1 -1 1 1 1 1 1 RIL172 1 1 1 -1 1 -1 1 1 1 RIL174 2 1 1 2 2 1 2 2 2 RIL179 1 1 1 -1 1 1 1 1 1 RIL180 2 1 2 2 2 2 2 2 2 RIL181 1 1 1 1 1 1 1 1 1 RIL188 1 1 1 1 1 1 1 1 1 RIL193 2 2 1 1 1 1 2 2 2 RIL200 1 1 1 -1 1 1 2 2 2 RIL204 1 1 1 2 2 2 2 2 2 RIL206 1 1 2 2 2 2 2 2 2 RIL209 1 1 1 1 1 1 2 2 1 RIL212 1 1 2 2 2 2 2 2 2 RIL215 2 1 1 2 2 2 2 2 2 RIL217 1 1 2 2 2 2 1 1 1 RIL219 1 1 2 2 2 2 2 2 2 RIL225 1 1 2 -1 1 1 1 1 1 RIL226 1 1 1 2 2 2 1 1 2 RIL228 2 1 1 2 2 2 1 1 1 RIL229 2 1 1 1 1 1 1 1 1 RIL234 1 1 1 2 2 2 2 2 2 RIL235 1 1 2 2 2 2 2 2 2 RIL240 1 1 2 2 2 2 2 2 2 RIL241 2 1 2 -1 1 1 1 1 1 RIL243 -1 1 1 -1 1 -1 2 -1 2 RIL247 1 1 1 1 1 1 1 1 1 RIL248 1 1 1 1 1 1 1 1 1 RIL255 1 1 1 -1 1 2 2 2 2 RIL256 2 1 2 2 2 2 2 2 2 RIL260 1 1 1 1 1 1 1 1 1 RIL263 1 1 1 1 1 1 1 1 1 RIL264 1 1 1 1 1 1 2 2 2 RIL266 1 1 1 -1 1 1 1 1 1 RIL269 2 1 1 1 1 1 2 1 1 RIL270 2 1 1 1 2 2 2 2 2 RIL271 1 1 2 2 2 2 2 2 2 97

Appendix 4.2. (continued)

ID nP136 CE2-122 CE2-126 CE2-161 CE2-190 CE2-197 pkP2111 CE2-204 CE2-206 pkP2117 CE2-215 CB5362 1 1 1 1 1 1 1 1 1 1 1 FJJ1009 2 2 2 2 2 2 2 2 2 2 2 RIL002 -1 2 2 2 2 -1 2 2 2 2 2 RIL019 2 2 2 -1 2 1 1 1 1 1 2 RIL021 2 2 2 2 2 2 2 2 2 1 1 RIL031 2 1 1 1 1 -1 1 1 1 1 2 RIL037 -1 1 1 1 1 1 1 1 1 1 1 RIL060 2 2 1 1 1 1 1 1 1 1 2 RIL062 1 1 2 -1 2 2 2 2 2 2 2 RIL067 1 1 1 1 1 1 1 1 1 1 1 RIL070 1 1 1 1 1 2 2 2 2 2 2 RIL074 1 1 1 1 1 1 1 1 1 1 1 RIL078 1 1 1 1 1 1 1 1 1 1 1 RIL085 2 2 2 1 1 1 1 1 1 1 1 RIL090 1 1 1 1 1 1 2 2 2 2 1 RIL095 2 2 1 1 1 1 2 2 2 2 2 RIL097 1 1 1 1 1 1 1 1 1 1 1 RIL101 1 1 1 1 1 1 2 2 2 2 2 RIL108 1 1 1 1 1 1 1 1 1 1 1 RIL115 2 2 2 -1 2 2 2 1 1 1 1 RIL128 -1 1 1 1 1 -1 1 1 1 1 2 RIL131 2 2 2 -1 2 2 2 2 2 1 1 RIL133 1 1 1 1 1 1 1 1 1 1 1 RIL138 1 1 1 1 1 1 1 1 1 1 1 RIL142 1 2 2 2 2 2 2 2 2 1 1 RIL147 2 2 1 1 1 1 2 2 2 2 2 RIL150 1 1 1 1 1 1 1 1 2 1 1 RIL153 1 1 2 2 2 2 2 2 2 2 2 RIL159 1 1 1 -1 2 2 2 2 2 2 2 RIL161 1 1 1 1 1 1 2 2 2 2 2 RIL168 1 1 1 1 1 1 1 1 1 2 2 RIL172 2 2 1 -1 1 1 1 1 1 1 1 RIL174 1 1 1 1 1 1 1 1 1 1 1 RIL179 2 2 2 -1 2 2 2 2 2 2 1 RIL180 1 1 1 1 1 1 1 1 1 1 1 RIL181 2 2 2 -1 2 2 1 1 2 2 2 RIL188 2 2 2 2 2 2 2 2 2 2 2 RIL193 2 2 2 2 2 2 2 2 2 2 2 RIL200 2 2 2 1 2 2 2 2 2 2 2 RIL204 2 2 2 -1 2 2 2 1 1 1 1 RIL206 1 1 1 1 2 2 2 2 2 2 2 RIL209 2 2 2 1 1 1 1 1 1 1 1 RIL212 2 2 2 1 1 2 1 1 1 1 1 RIL215 2 2 2 -1 2 2 2 2 2 1 1 RIL217 1 1 1 1 1 1 1 1 1 1 1 RIL219 1 1 1 1 1 1 1 1 1 1 1 RIL225 1 1 1 1 1 1 1 1 1 1 1 RIL226 2 2 2 -1 2 2 2 2 2 2 2 RIL228 2 2 2 2 2 2 2 2 2 2 2 RIL229 1 1 1 1 1 1 1 1 1 1 1 RIL234 2 2 2 2 2 2 1 1 1 1 1 RIL235 2 2 2 2 2 2 2 2 2 2 2 RIL240 2 2 2 2 2 2 2 2 2 2 2 RIL241 1 1 1 1 1 1 1 1 1 1 1 RIL243 1 -1 1 -1 1 1 -1 -1 -1 1 1 RIL247 1 1 1 1 1 1 1 1 1 1 1 RIL248 1 1 1 1 1 1 1 2 2 2 1 RIL255 2 2 2 2 2 2 2 2 2 2 1 RIL256 1 1 1 1 1 1 2 2 2 2 2 RIL260 1 1 1 1 1 1 1 1 1 1 1 RIL263 1 1 1 1 2 2 2 2 2 2 2 RIL264 1 1 1 1 1 1 1 2 2 2 2 RIL266 2 2 2 -1 2 2 2 2 2 2 2 RIL269 2 2 2 2 2 2 1 1 1 1 2 RIL270 1 1 1 1 1 1 1 1 1 2 1 RIL271 1 1 1 1 1 1 1 1 1 1 1 98

Appendix 4.2. (continued)

ID CE3-104 CE3-109 CE3-122 CE3-126 CE3-133 CE3-136 CE3-178 CE3-188 pkP3073 CE3-198 CE3-201 CE3-205 CE3-212 CB5362 1 1 1 1 1 1 1 1 1 1 1 1 1 FJJ1009 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL002 1 1 1 1 -1 1 1 1 -1 -1 1 1 1 RIL019 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL021 2 2 2 2 1 1 1 1 1 1 1 2 2 RIL031 2 2 2 1 1 1 1 1 1 1 1 1 1 RIL037 2 2 2 -1 -1 2 2 2 1 -1 2 -1 2 RIL060 1 1 2 2 2 2 2 2 2 -1 2 -1 2 RIL062 1 1 2 2 2 2 2 2 2 -1 1 1 1 RIL067 2 2 2 2 2 2 2 2 2 -1 2 -1 2 RIL070 2 2 2 -1 2 2 2 2 2 -1 2 -1 2 RIL074 2 2 2 2 2 2 2 2 2 -1 2 -1 2 RIL078 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL085 1 1 1 1 1 1 1 1 1 -1 2 -1 2 RIL090 2 2 2 1 1 1 1 1 1 1 1 1 1 RIL095 1 1 1 1 1 1 1 1 1 1 2 -1 2 RIL097 1 1 1 1 1 1 1 1 1 1 2 -1 2 RIL101 2 2 2 2 2 2 2 2 1 1 1 -1 2 RIL108 2 2 2 2 2 2 2 2 1 1 1 1 1 RIL115 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL128 2 2 2 -1 -1 -1 2 2 -1 -1 2 -1 2 RIL131 2 2 2 1 1 1 1 1 1 1 1 1 1 RIL133 2 2 1 1 1 1 1 2 2 -1 2 -1 2 RIL138 1 1 1 1 1 1 1 1 2 -1 2 -1 2 RIL142 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL147 2 2 2 2 2 2 2 2 2 1 1 1 1 RIL150 2 2 2 2 2 2 2 2 2 -1 2 2 2 RIL153 2 2 2 2 2 2 2 2 2 1 1 1 1 RIL159 2 2 1 1 1 1 1 1 1 1 1 1 1 RIL161 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL168 2 2 2 2 2 2 2 2 2 -1 1 1 1 RIL172 -1 2 2 -1 2 2 -1 2 2 -1 2 -1 2 RIL174 1 1 1 1 2 2 2 2 2 -1 2 -1 2 RIL179 1 1 2 2 2 2 2 2 2 -1 2 -1 2 RIL180 1 1 2 -1 2 2 2 2 2 -1 2 1 1 RIL181 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL188 2 2 2 1 1 1 1 1 1 2 2 -1 2 RIL193 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL200 2 2 2 2 2 2 2 2 2 -1 2 -1 2 RIL204 2 2 2 -1 2 2 1 1 1 1 1 1 1 RIL206 2 2 2 1 1 1 1 1 1 1 1 1 1 RIL209 2 2 2 2 2 2 1 1 1 1 1 1 1 RIL212 2 2 2 -1 2 2 2 2 2 -1 2 -1 2 RIL215 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL217 2 2 1 1 1 1 1 1 1 1 1 1 1 RIL219 2 2 2 2 2 2 2 2 2 2 2 -1 2 RIL225 2 2 2 2 2 2 2 2 2 -1 2 -1 2 RIL226 2 2 1 1 1 1 1 1 1 2 2 -1 1 RIL228 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL229 2 2 2 -1 2 1 1 1 1 1 1 1 1 RIL234 2 2 2 2 1 1 1 2 2 -1 2 -1 2 RIL235 2 2 2 2 2 2 2 2 2 -1 2 -1 2 RIL240 2 2 2 2 2 2 2 2 1 1 1 1 1 RIL241 2 2 2 2 2 2 2 2 2 -1 1 1 1 RIL243 -1 1 2 -1 2 -1 -1 2 2 2 2 -1 1 RIL247 2 2 2 2 2 -1 2 2 2 -1 2 -1 2 RIL248 2 2 1 1 1 1 1 1 1 1 1 1 1 RIL255 2 2 2 -1 2 2 2 2 1 1 1 1 1 RIL256 2 1 1 1 1 1 1 1 1 1 1 1 1 RIL260 2 2 1 1 1 1 1 1 2 -1 2 -1 1 RIL263 2 2 2 2 2 2 2 2 2 -1 2 2 2 RIL264 2 2 2 2 2 2 2 2 2 -1 2 2 2 RIL266 2 2 1 2 2 2 2 2 2 -1 2 -1 2 RIL269 2 2 2 2 2 2 2 2 2 -1 2 1 1 RIL270 1 2 2 2 2 2 2 2 2 -1 2 -1 2 RIL271 1 1 2 -1 1 1 1 1 1 1 1 1 1 99

Appendix 4.2. (continued)

ID CE4-228 pkP4066 snp_Y41D4[6] CE4-109 uCE4-670 CE4-120 CE4-224 uCE4-905 uCE4-1020 CE4-1 CE4-194 uCE4-1337 CE4-213 CE4-221 CB5362 1 1 1 1 1 1 1 1 1 1 1 1 1 1 FJJ1009 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL002 2 -1 2 2 2 2 -1 2 2 -1 -1 -1 2 -1 RIL019 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL021 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL031 1 -1 1 1 2 2 2 2 2 2 2 2 2 2 RIL037 2 2 2 2 2 2 2 2 2 2 2 -1 2 2 RIL060 2 2 2 2 2 2 2 2 2 2 2 1 -1 1 RIL062 1 1 1 1 1 1 2 2 2 2 1 -1 2 2 RIL067 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL070 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL074 1 1 1 1 1 1 1 1 1 1 2 2 2 2 RIL078 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL085 1 1 1 1 1 1 1 1 2 2 2 2 2 2 RIL090 1 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL095 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL097 1 1 1 1 1 1 1 2 2 2 2 1 1 1 RIL101 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL108 2 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL115 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL128 1 -1 1 1 1 1 -1 2 2 -1 -1 -1 2 -1 RIL131 2 2 -1 2 2 1 1 1 1 1 1 1 1 1 RIL133 1 1 1 1 1 1 1 1 2 2 2 -1 2 2 RIL138 1 1 1 1 2 2 2 2 2 2 2 2 2 2 RIL142 1 1 1 1 1 2 2 2 2 2 2 2 2 2 RIL147 1 1 1 1 1 2 2 2 2 1 1 1 1 1 RIL150 1 1 1 1 1 1 1 1 2 2 2 2 2 2 RIL153 1 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL159 1 1 1 1 2 2 2 2 2 2 2 2 2 2 RIL161 1 1 1 1 2 2 2 2 2 2 2 2 2 2 RIL168 1 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL172 1 1 1 1 1 1 1 -1 2 2 2 2 2 2 RIL174 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL179 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL180 2 2 2 2 2 2 2 2 2 2 2 -1 2 2 RIL181 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL188 1 1 1 2 2 2 2 2 2 2 1 1 1 1 RIL193 1 1 1 1 1 1 1 1 1 1 1 2 2 2 RIL200 2 2 2 2 2 2 2 2 2 2 2 2 1 1 RIL204 1 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL206 1 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL209 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL212 1 1 1 2 2 2 2 2 2 2 2 2 2 1 RIL215 1 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL217 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL219 1 1 2 2 2 2 2 2 2 2 2 2 2 2 RIL225 2 2 2 2 2 2 2 2 2 2 2 -1 2 2 RIL226 1 1 2 2 2 2 2 2 2 2 2 2 2 2 RIL228 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL229 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL234 1 1 1 2 2 2 2 2 2 2 2 2 2 2 RIL235 2 2 2 2 2 2 2 2 2 1 1 1 1 1 RIL240 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL241 2 2 2 2 2 2 2 2 1 1 1 1 1 1 RIL243 1 1 1 1 1 -1 1 -1 -1 1 1 1 1 1 RIL247 1 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL248 2 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL255 1 1 1 1 2 2 2 2 2 2 2 2 2 2 RIL256 2 2 2 1 1 1 1 1 1 1 1 1 1 1 RIL260 1 1 1 1 1 1 1 1 1 1 1 1 1 1 RIL263 2 2 2 2 2 2 2 2 2 1 2 2 2 2 RIL264 1 1 2 2 2 2 2 2 2 2 2 2 2 2 RIL266 1 2 2 2 2 2 2 2 2 2 2 2 2 2 RIL269 2 2 -1 2 2 2 2 2 2 2 2 2 2 2 RIL270 2 2 -1 2 2 2 2 2 2 2 2 2 2 2 RIL271 2 2 2 2 2 2 2 2 2 2 2 2 2 2 100

Appendix 4.2. (continued)

ID CE5-102 CE5-128 CE5-134 CE5-139 CE5-147 CE5-175 CE5-207 CE5-228 CE5-258 CB5362 1 1 1 1 1 1 1 1 1 FJJ1009 2 2 2 2 2 2 2 2 2 RIL002 1 -1 -1 1 -1 -1 -1 1 -1 RIL019 2 2 2 2 2 2 2 2 1 RIL021 1 1 1 1 1 -1 -1 1 2 RIL031 2 2 1 2 1 -1 2 1 -1 RIL037 1 1 1 1 -1 1 1 2 -1 RIL060 1 1 1 1 1 2 2 2 2 RIL062 1 1 1 1 -1 2 2 2 2 RIL067 1 1 1 1 1 -1 -1 2 1 RIL070 2 2 1 1 1 1 2 2 2 RIL074 1 1 1 1 1 -1 -1 1 -1 RIL078 1 1 1 1 1 1 -1 1 1 RIL085 1 1 1 1 1 1 -1 1 2 RIL090 1 1 1 1 1 1 2 1 1 RIL095 1 1 1 1 1 1 -1 1 1 RIL097 1 1 1 1 1 1 -1 1 2 RIL101 2 2 -1 1 1 1 -1 1 1 RIL108 1 1 1 1 1 1 -1 1 1 RIL115 1 1 1 1 1 -1 -1 2 2 RIL128 1 -1 -1 1 -1 -1 -1 1 -1 RIL131 1 1 1 1 1 1 -1 1 2 RIL133 1 1 1 1 1 -1 -1 1 2 RIL138 1 1 1 1 1 -1 1 1 1 RIL142 1 1 1 1 1 1 -1 1 2 RIL147 1 2 2 2 2 -1 1 2 2 RIL150 1 1 1 1 1 -1 -1 1 2 RIL153 1 1 1 1 1 1 1 1 1 RIL159 1 1 1 1 1 -1 -1 1 1 RIL161 2 1 1 1 1 1 -1 1 1 RIL168 1 1 1 1 2 -1 2 2 2 RIL172 2 2 -1 2 2 1 2 2 2 RIL174 2 2 -1 2 2 2 1 1 1 RIL179 1 1 1 1 1 1 1 1 2 RIL180 2 2 -1 2 2 2 2 2 2 RIL181 1 1 1 1 1 -1 -1 1 1 RIL188 1 1 1 1 1 1 -1 1 2 RIL193 2 1 1 1 1 2 2 2 2 RIL200 1 1 1 1 1 1 1 1 1 RIL204 2 2 2 2 2 2 2 2 1 RIL206 2 2 2 2 2 2 2 2 -1 RIL209 1 1 1 1 1 1 -1 1 1 RIL212 2 2 -1 2 2 2 1 1 1 RIL215 1 1 1 1 1 1 -1 1 2 RIL217 2 2 2 2 2 2 2 2 2 RIL219 2 2 -1 2 2 2 2 2 2 RIL225 1 1 1 1 1 -1 1 1 1 RIL226 1 1 1 1 1 -1 -1 1 1 RIL228 2 2 -1 2 2 2 2 2 2 RIL229 1 1 1 1 1 -1 -1 1 1 RIL234 2 2 -1 2 2 2 2 1 1 RIL235 1 1 1 1 1 1 -1 1 1 RIL240 1 1 1 1 1 -1 2 2 1 RIL241 1 1 1 1 1 1 1 1 1 RIL243 1 1 1 1 1 1 -1 1 1 RIL247 1 1 1 1 2 2 2 2 2 RIL248 2 2 -1 1 1 1 -1 1 1 RIL255 2 2 -1 1 1 1 -1 1 1 RIL256 1 2 2 2 1 2 2 2 2 RIL260 1 1 1 1 1 1 -1 1 1 RIL263 1 1 1 2 2 2 2 2 2 RIL264 1 1 1 1 1 -1 1 1 1 RIL266 1 1 1 1 1 1 -1 1 1 RIL269 1 1 1 1 1 -1 1 1 1 RIL270 2 2 -1 2 1 1 1 1 1 RIL271 1 1 1 1 1 1 -1 1 1 101

Appendix 4.2. (continued)

ID CE6-105 CE6-120 CE6-126 CE6-133 CE6-23 CE6-195 CE6-197 CE6-206 CE6-208 CE6-239 CB5362 1 1 1 1 1 1 1 1 1 1 FJJ1009 2 2 2 2 2 2 2 2 2 2 RIL002 -1 -1 -1 -1 -1 1 1 -1 -1 -1 RIL019 2 1 1 1 2 -1 2 2 2 2 RIL021 2 2 2 1 1 1 1 1 1 1 RIL031 2 2 2 1 1 1 1 1 1 1 RIL037 -1 -1 1 1 1 1 1 1 1 1 RIL060 -1 2 2 2 1 1 1 1 1 1 RIL062 2 2 2 1 1 1 1 1 2 2 RIL067 2 2 2 2 2 2 2 2 2 2 RIL070 1 1 1 1 1 1 1 1 1 1 RIL074 2 2 2 2 2 2 2 2 2 2 RIL078 2 2 2 2 1 1 1 1 1 1 RIL085 1 1 1 1 1 1 1 1 1 1 RIL090 2 2 2 2 2 2 2 2 2 2 RIL095 1 1 1 1 2 2 2 2 2 2 RIL097 1 1 2 2 2 2 2 2 2 2 RIL101 2 2 2 2 2 2 2 2 2 2 RIL108 2 2 2 2 2 2 1 1 1 1 RIL115 2 2 2 1 1 1 1 1 1 1 RIL128 -1 -1 -1 -1 -1 1 1 -1 -1 -1 RIL131 2 2 2 2 2 2 2 2 2 2 RIL133 1 1 1 1 2 -1 2 2 2 2 RIL138 2 2 2 2 1 1 1 1 1 1 RIL142 1 1 1 1 1 1 1 1 1 1 RIL147 1 1 1 1 1 1 1 1 1 1 RIL150 1 1 1 1 2 -1 2 2 2 2 RIL153 2 2 2 2 2 2 2 2 2 2 RIL159 2 2 2 2 1 1 1 1 2 2 RIL161 2 2 2 2 2 2 2 2 2 2 RIL168 1 1 1 1 1 1 1 2 2 2 RIL172 2 2 2 2 2 -1 -1 2 2 2 RIL174 2 2 2 2 2 1 1 1 1 1 RIL179 1 1 1 1 2 2 2 2 2 2 RIL180 1 1 1 1 2 2 2 2 2 1 RIL181 1 1 1 1 1 1 1 1 1 1 RIL188 1 1 1 1 1 1 1 1 1 1 RIL193 2 2 2 2 2 2 2 2 2 2 RIL200 1 1 1 1 1 1 1 1 1 2 RIL204 1 1 1 1 1 1 1 1 1 2 RIL206 2 2 2 2 1 1 1 1 1 1 RIL209 1 1 1 1 1 1 1 1 1 1 RIL212 2 2 2 2 2 -1 2 2 2 2 RIL215 2 2 2 2 2 2 2 2 2 2 RIL217 2 2 1 1 2 2 2 2 1 1 RIL219 2 2 2 2 2 2 2 2 2 1 RIL225 1 1 1 1 1 1 -1 1 1 2 RIL226 2 1 2 2 2 -1 2 2 2 2 RIL228 1 2 2 2 2 2 2 1 1 1 RIL229 2 2 2 2 1 1 1 1 1 1 RIL234 1 1 1 1 1 1 1 1 1 2 RIL235 1 2 2 2 2 -1 2 2 2 2 RIL240 2 2 2 2 1 1 1 1 1 1 RIL241 2 2 2 2 2 2 2 2 2 2 RIL243 1 1 1 1 1 -1 -1 2 2 2 RIL247 2 2 2 1 2 -1 -1 2 2 2 RIL248 2 2 2 1 1 1 1 1 1 1 RIL255 2 2 2 2 1 1 -1 1 1 1 RIL256 2 2 2 2 2 2 2 2 2 2 RIL260 1 1 1 1 2 -1 2 2 2 2 RIL263 2 2 2 2 2 2 2 1 1 1 RIL264 1 1 1 2 2 2 2 2 2 2 RIL266 1 1 1 1 1 1 1 1 1 1 RIL269 2 1 1 1 2 2 2 2 2 2 RIL270 2 2 2 2 2 2 2 2 2 2 RIL271 1 1 1 1 1 1 1 1 1 1 102

CHAPTER 5. CONCLUSIONS

Discussion

Despite a growing number of interspecific comparisons of sex determination mechanisms (SDMs) (e.g., Cho et al., 2006; Cho et al., 2007; Hill & Haag, 2009; Hill et al.,

2006; Takehana et al., 2007, Takehana et al., 2008), we still know relatively little about the microevolution of SDMs, specifically, how within-species variation generates inter-specific divergence. A handful of examples involving polymorphisms in sex chromosomes (e.g.,

Dubendorfer et al., 2002; Feldmeyer et al., 2008; Kallman, 1968; Ogata et al., 2003; Ogata et al., 2008), as well as heritable quantitative variation in species with environmental sex determination (ESD) (e.g., Ewert et al., 2005; Girondot et al., 1994; Janes & Wayne, 2006;

Janzen, 1992; Rhen & Lang, 1998) have been investigated. However, it is unclear whether the former are truly representative (for example, does SDM evolution always involve changes of the most upstream regulator of sex, or can changes in the importance of redundant gene interactions lead to divergence in the middle of these pathways?), and the molecular basis of sex determination is poorly understood in the latter. Many theoretical studies (e.g.,

Caubet et al., 2000; Kozielska et al., 2006; Kozielska et al., 2009; Vuilleumier et al., 2007) have also examined transitions from one SDM to another, but these must be complemented with empirical work to test their assumptions and identify the biological intricacies that may constrain evolution in real systems. In this dissertation, I set out to examine the evolution of

SDMs specifically from a microevolutionary perspective, by identifying the types of genetic changes that can lead to changes in SDMs, using the nematode worm Caenorhabditis elegans 103 as a model system.

I began in chapter two by characterizing two temperature-sensitive mutations in key sex-determining genes at both the phenotypic and molecular levels. I found that these mutations resulted in thermal sex-ratio reaction norms strikingly similar to those seen in taxa that naturally display thermally-based ESD. Moreover, these mutations differed from one another in an important way at the molecular level: one was a nonsynonymous mutation in a protein-coding sequence, while the other was a mutation in a promoter gene. This difference suggests that multiple mutational targets can be responsible for evolutionary change in

SDMs, and that these targets can change in different ways. However, further phenotypic analysis revealed a biological constraint on SDM evolution: these mutations had strong pleiotropic effects on fertility fecundity, indicating that many mutations in sex-determining genes might be either evolutionary “dead-ends” or would at least require compensatory changes in other genes in order to be viable.

In chapter three, I used both phenotypic analysis of compound mutants and molecular dating methods to investigate steps in the evolution of a novel regulatory mechanism in germline sex determination that allows C. elegans to produce self-fertile hermaphrodites. The gene fog-2, which arose via gene duplication within C. elegans, is largely responsible for spermatogenesis in hermaphrodites, suggesting that this duplication event was critical to the evolution of androdioecy. If this duplication (and subsequent neofunctionalization) event was the first key step in the evolution of self-fertility, I predicted that fog-2 function would be absolutely essential, and therefore that self-fertility should be impossible to rescue in fog-2 null mutants. However, using a temperature-sensitive tra-2 allele, I showed that quantitative 104 alterations in tra-2 activity could restore self-fertility in fog-2 animals, consistent with prior studies. This observation suggests that self-fertility more likely evolved first by other alterations to tra-2 activity, and fog-2 (probably along with other tra-2 regulators) was probably a later innovation that aided in tra-2 regulation. However, I also Bayesian molecular clock methods to estimate the date when fog-2 began diverging from its closest C. elegans paralog, and discovered that the confidence interval for this estimate coincided almost perfectly with a previously published estimate of when C. elegans evolved self- fertility. Thus, fog-2 probably arose and evolved its new function quite rapidly once self- fertility became established.

Finally, in chapter four, I used the same temperature-sensitive tra-2 allele to uncover cryptic intraspecific variation in sex determination in C. elegans. I began by introgressing this mutation (and another mutation in a second sex-determining gene, xol-1) into the genetic background of several additional wild isolates. Phenotypic analysis of these mutant strains revealed that the thermal reaction norms for both sex ratio and tail morphology (a sexually dimorphic trait) caused by the tra-2 allele were influenced significantly by the wild genetic background in which the mutations occur. Then, by crossing two of these lines to generate a panel of recombinant inbred lines (RILs), I was able to use quantitative trait locus (QTL) mapping to dissect the genetic architecture of this background variation. Three key findings emerged: first, only a handful of QTL, with moderate to large effects, were responsible for the among-strain variance; second, although the QTL identified all influenced somatic sex determination, not all of them contained candidate genes with known roles in this pathway, suggesting that genes with redundant or minor roles, and which are often missed by 105 traditional mutagenesis studies, may be important for the microevolution of SDMs; and last, at least some of these QTL had effects that were consistent across environments, whereas no

QTL with effects on reaction norm shape could be detected, suggesting that the genetic architecture of reaction norm shape is more complex than that of reaction norm position

(intercept). This study showed conclusively, then, that there is heritable variation in this species’ SDM, and therefore that this pathway has the potential to evolve. These findings also provide a useful starting point for more detailed investigations of the genetic basis of SDM evolution and of how intraspecific polymorphism can translate into interspecific differences.

Large-effect mutations, such as those described in chapter 2, may often have negative pleiotropic effects. However, chapter 4 demonstrates that populations can harbor pre-existing genetic variation that ameliorates those effects relatively quickly, increasing the likelihood that these new mutations persist in populations. For example, many of the RILs had tail phenotypes similar to those of wild-types, even though both parental lines had drastically malformed tails at the same temperatures. In an ongoing study, some populations (founded with the five genetic backgrounds described in chapter 4) fixed for the mutant tra-2 allele produced almost completely wild-type worms after 50 generations of experimental evolution, likely by recombining pre-existing genetic variation (unpublished data). This pre-existing cryptic variation, then, could be evolutionarily important. For instance, the new mutations that altered germline tra-2 regulation early in the evolution of self-fertility in C. elegans may have had deleterious somatic effects as well. But these could have been at least partially compensated for almost immediately by recombining standing background variation, with subsequent new mutations ultimately finishing the task. 106

Chapter 4 provides a starting point for future research on the microevolution of

SDMs. Further study of the QTL identified, particularly fine mapping to pinpoint specific genes, would offer even greater insight into how SDM divergence arises. Determining whether candidate sex-determining genes are responsible for this variation would help reveal how the roles of genes in sex determination change over time, as well as provide a more nuanced understanding of sex determination in this important model system. Characterizing the responsible DNA sequence polymorphisms and how different alleles at multiple loci interact with one another may help explain the interesting patterns of molecular evolution and co-evolution documented in many genes involved in SDMs. A more detailed characterization of the phenotypic effects of these mutations in both mutant and wild-type backgrounds (e.g., at the cellular level in both tail and gonadal tissues sensu Milloz et al.,

2008) would reveal whether SDMs have tissue-specific components that may also help ameliorate negative pleiotropic effects. Finally, phenotypic data are also important to understand the selective forces that act on SDMs. For instance, consider the extreme possibility that this background variation has negligible phenotypic effects in wild-type individuals, without fitness consequences; in that case, future theoretical studies could examine how neutral drift might generate pathway divergence.

Applying the background QTL mapping approach used in chapter 4 to other sex- determining genes would also be informative. For example, what loci influence the probability of being self-fertile in fog-2; tra-2 double mutants? Such a study might uncover additional genes involved in the spermatogenesis/oogenesis switch. Would a search for background loci affecting the expressivity and penetrance of conditional her-1 and fem-3 107 mutants turn up the same QTL identified in this tra-2 study, or a completely new set of loci?

Answering this question not only would shed light on just how much complexity exists in this SDM, but also could have implications for human disease (Gibson & Dworkin, 2004).

Individuals afflicted with some genetic conditions display variable symptoms, despite carrying similar or even identical mutations, implying that disease severity is modulated by genetic background, just as the effects of this tra-2 mutation depend on the genetic background in which it occurs. For example, Marfan syndrome is caused by dominant mutations in the FBN1 gene, but related individuals carrying the same mutant allele can show striking variability in symptoms (e.g., De Backer et al., 2007). Similarly, some genetic disorders are caused by mutations in any of several genes acting in a common pathway; for instance, other Marfan-like syndromes are caused by mutations in genes with functions related to those of FBN1 (Robinson et al., 2006). Mutations in different sex determination genes in C. elegans, therefore, might be a useful model for understanding how genetic background influences the expression of related genetic disorders.

Finally, this work could be enhanced by the implementation of more advanced multivariate QTL mapping techniques. Although some have been described (e.g., Hackett et al., 2001; Jiang & Zeng, 1995; Xu et al., 2009), these techniques are not yet included in software packages such as R/qtl (Broman & Sen, 2009). Their implementation would allow us to perform hypothesis tests not possible with current methods, as well as offer greater detection power. For example, is there evidence of a QTL-by-environment interaction? Or consider the situation in which QTL in overlapping regions are found with similar effects on multiple traits or in different environments. Are these effects on the different phenotypes due 108 to the same QTL, or are they separable?

Combined, these studies illustrate how modern genetic approaches will improve our understanding of the evolution of development in the coming years. In fact, it is truly exciting that with the advent of new molecular tools that can be applied to a broader range of species, our very concept of what makes a “model organism” is evolving. Undoubtedly, this expanded arsenal of tools in the coming years will create a more complete picture of how and why all this diversity not only in sex determination, but in all aspects of organismal development, has evolved.

References

Broman, K. W. & Sen, S. 2009. A Guide to QTL Mapping with R/qtl. Springer, New York, NY. Caubet, Y., Hatcher, M. J., Mocquard, J. P. & Rigaud, T. 2000. Genetic conflict and changes in heterogametic mechanisms of sex determination. Journal of Evolutionary Biology 13: 766-777. Cho, S., Huang, Z. Y. & Zhang, J. Z. 2007. Sex-specific splicing of the honeybee doublesex gene reveals 300 million years of evolution at the bottom of the insect sex- determination pathway. Genetics 177: 1733-1741. Cho, S. C., Huang, Z. Y., Green, D. R., Smith, D. R. & Zhang, J. Z. 2006. Evolution of the complementary sex-determination gene of honey bees: Balancing selection and trans- species polymorphisms. Genome Research 16: 1366-1375. De Backer, J., Loeys, B., Leroy, B., Coucke, P., Dietz, H. & De Paepe, A. 2007. Utility of molecular analyses in the exploration of extreme intrafamilial variability in the Marfan syndrome. Clinical Genetics 72: 188-98. Dubendorfer, A., Hediger, M., Burghardt, G. & Bopp, D. 2002. Musca domestica, a window on the evolution of sex-determining mechanisms in insects. International Journal of Developmental Biology 46: 75-79. Ewert, M. A., Lang, J. W. & Nelson, C. E. 2005. Geographic variation in the pattern of temperature-dependent sex determination in the American snapping turtle (Chelydra serpentina). Journal of Zoology 265: 81-95. Feldmeyer, B., Kozielska, M., Kuijper, B., Weissing, F. J., Beukeboom, L. W. & Pen, I. 2008. Climatic variation and the geographical distribution of sex-determining mechanisms in the housefly. Evolutionary Ecology Research 10: 797-809. Gibson, G. & Dworkin, I. 2004. Uncovering cryptic genetic variation. Nature Reviews 109

Genetics 5: 681-690. Girondot, M., Zaborski, P., Servan, J. & Pieau, C. 1994. Genetic contribution to sex determination in turtles with environmental sex determination. Genetical Research 63: 117-127. Hackett, C. A., Meyer, R. C. & Thomas, W. T. B. 2001. Multi-trait QTL mapping in barley using multivariate regression. Genetical Research 77: 95-106. Hill, R. C., de Carvalho, C. E., Salogiannis, J., Schlager, B., Pilgrim, D. & Haag, E. S. 2006. Genetic flexibility in the convergent evolution of hermaphroditism in Caenorhabditis nematodes. Developmental Cell 10: 531-8. Hill, R. C. & Haag, E. S. 2009. A sensitized genetic background reveals evolution near the terminus of the Caenorhabditis germline sex determination pathway. Evolution & Development 11: 333-342. Janes, D. E. & Wayne, M. L. 2006. Evidence for a genotype X environment interaction in sex-determining response to incubation temperature in the leopard gecko, Eublepharis macularius. Herpetologica 62: 56-62. Janzen, F. J. 1992. Heritable variation for sex-ratio under environmental sex determination in the common snapping turtle (Chelydra serpentina). Genetics 131: 155-161. Jiang, C. J. & Zeng, Z. B. 1995. Multiple-trait analysis of genetic-mapping for quantitative trait loci. Genetics 140: 1111-1127. Kallman, K. D. 1968. Evidence for the existence of transformer genes for sex in the teleost Xiphophorus maculatus. Genetics 60: 811-28. Kozielska, M., Pen, I., Beukeboom, L. W. & Weissing, F. J. 2006. Sex ratio selection and multi-factorial sex determination in the housefly: a dynamic model. Journal of Evolutionary Biology 19: 879-888. Kozielska, M., Weissing, F. J., Beukeboom, L. W. & Pen, I. 2009. Segregation distortion and the evolution of sex-determining mechanisms. Heredity 104: 100-112. Milloz, J., Duveau, F., Nuez, I. & Félix, M.-A. 2008. Intraspecific evolution of the intercellular signaling network underlying a robust developmental system. Genes & Development 22: 3064-3075. Ogata, M., Hasegawa, Y., Ohtani, H., Mineyama, M. & Miura, I. 2008. The ZZ/ZW sex- determining mechanism originated twice and independently during evolution of the frog, Rana rugosa. Heredity 100: 92-99. Ogata, M., Ohtani, H., Igarashi, T., Hasegawa, Y., Ichikawa, Y. & Miura, I. 2003. Change of the heterogametic sex from male to female in the frog. Genetics 164: 613-620. Rhen, T. & Lang, J. W. 1998. Among-family variation for environmental sex determination in reptiles. Evolution 52: 1514-1520. Robinson, P. N., Arteaga-Solis, E., Baldock, C., Collod-Beroud, G., Booms, P., De Paepe, A., Dietz, H. C., Guo, G., Handford, P. A., Judge, D. P., Kielty, C. M., Loeys, B., Milewicz, D. M., Ney, A., Ramirez, F., Reinhardt, D. P., Tiedemann, K., Whiteman, P. & Godfrey, M. 2006. The molecular genetics of Marfan syndrome and related disorders. Journal of Medical Genetics 43: 769-87. Takehana, Y., Demiyah, D., Naruse, K., Hamaguchi, S. & Sakaizumi, M. 2007. Evolution of 110

different Y chromosomes in two medaka species, Oryzias dancena and O. latipes. Genetics 175: 1335-1340. Takehana, Y., Hamaguchi, S. & Sakaizumi, M. 2008. Different origins of ZZ/ZW sex chromosomes in closely related medaka fishes, Oryzias javanicus and O. hubbsi. Chromosome Research 16: 801-811. Vuilleumier, S., Lande, R., Van Alphen, J. J. M. & Seehausen, O. 2007. Invasion and fixation of sex-reversal genes. Journal of Evolutionary Biology 20: 913-920. Xu, C. W., Wang, X. F., Li, Z. K. & Xu, S. Z. 2009. Mapping QTL for multiple traits using Bayesian statistics. Genetics Research 91: 23-37. 111

ACKNOWLEDGMENTS

Numerous individuals provided valuable advice and assistance throughout my graduate work, without which this research would never have been completed. Their contributions are recognized in each chapter of this dissertation, and I am grateful to all of them. I am especially thankful for the unwavering support of my advisor, Fred Janzen, over the last six years. Fred taught me to be independent, yet was always there when I needed his advice. He constantly pushed me to think about biology in new ways, but also encouraged a balance between academics, service, and personal interests, which I credit for making my graduate school experience so enjoyable. I could not have asked for a better mentor or friend.

Each of the other members of my committee--Anne Bronikowski, Jo Anne Powell-Coffman,

Steve Proulx, Jeanne Serb, and Jonathan Wendel--also inspired me with their unique perspectives and insights, and their feedback greatly improved my dissertation.

When I joined Fred’s lab, I was completely new to C. elegans. Although he primarily works on reptiles, Fred initiated this research during a sabbatical at the University of Oregon, where he launched our collaboration with Patrick Phillips. Fred and Patrick, along with Anne

Bronikowski, began by characterizing the sex ratio reaction norms of the temperature- sensitive mutant C. elegans strains, and their results were the foundation for my dissertation.

Subsequently, Patrick, along with several members of his lab, kindly hosted me during a visit and trained me in all the essential lab skills every “worm” researcher needs. Levi Morran,

Jenni Anderson, Tina Tague, Lori Albergotti, and Richard Jovelin were exceptional teachers in this regard. Back at Iowa State, Anne Heun and Genna Chadderdon, two of the most 112 talented undergraduates I have ever met, devoted countless hours of assistance and made lab work fun. In addition, all the members of the Janzen lab exposed me to their diverse interests and provided stimulating discussions and advice over the years.

I would also like to express my gratitude to those who helped in less tangible but equally important ways. First and foremost, I am so thankful for the unconditional support of my family, especially my parents. They both fostered my passion for biology, and even from an early age I remember them always encouraging me to be myself and pursue my interests.

Without them, I would never have made it this far. Finally, I would not have survived graduate school were it not for my colleagues and friends both within and outside the EEOB department. In particular, Seth Briggs, Barbara Kagima, Erin Myers, and Jennifer Deitloff provided valuable friendship that carried me through the many trials of graduate school, as well as many wonderful memories.