Two Interaction Sites on Mammalian Adenylyl Cyclase Type I and II

Two Interaction Sites on Mammalian Adenylyl Cyclase Type I and II: modulation by calmodulin and Gβγ Susanne Diel, Michael Beyermann, Juana M Navarro Lloréns, Burghardt Wittig, Christiane Kleuss

To cite this version:

Susanne Diel, Michael Beyermann, Juana M Navarro Lloréns, Burghardt Wittig, Christiane Kleuss. Two Interaction Sites on Mammalian Adenylyl Cyclase Type I and II: modulation by calmodulin and Gβγ. Biochemical Journal, Portland Press, 2008, 411 (2), pp.449-456. 10.1042/BJ20071204. hal-00478881

HAL Id: hal-00478881 https://hal.archives-ouvertes.fr/hal-00478881 Submitted on 30 Apr 2010

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Biochemical Journal Immediate Publication. Published on 14 Jan 2008 as manuscript BJ20071204

TWO INTERACTION SITES ON MAMMALIAN ADENYLYL CYCLASE TYPE I AND II:

Modulation by Calmodulin and G

Susanne Diel*, Michael Beyermann*, Juana María Navarro Lloréns†,

Burghardt Wittig‡, Christiane Kleuss§¶

*Leibniz-Institut für Molekulare Pharmakologie, Dept. Peptide Chemistry & Biochemistry; †Universidad Complutense de Madrid, Departamento de Bioquímica y Biología Molecular I; ‡Charité – Universitaetsmedizin Berlin, Institut für Molekularbiologie UND Bioinformatik, 14195 Berlin, Arnimallee 22, Germany; §Mologen AG ¶correspondence: Tel.: +49-30-84451594, Fax: +49-30-84451516; [email protected]

PAGE HEADING TITLE: adenylyl cyclase regulation THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINT

Licenced copy. Copying is not permitted, except with1 prior permission and as allowed by law. © 2008 The Authors Journal compilation © 2008 Biochemical Society Biochemical Journal Immediate Publication. Published on 14 Jan 2008 as manuscript BJ20071204

TWO INTERACTION SITES ON MAMMALIAN ADENYLYL CYCLASE TYPE I AND II

Modulation by Calmodulin and G

SYNOPSIS

Mammalian adenylyl cyclases are integrating effector molecules in signal transduction regulated by a plethora of molecules in either additive or synergistic or antagonistic manner. Out of nine different isoforms, each adenylyl cyclase subtype uses an individual set of regulators. Here, we use chimeric constructs, point mutations, and peptide competition studies with adenylyl cyclases to show for the regulatory molecules G and calmodulin a common mechanism of multiple contact sites. Despite their chemical, structural, and functional variety and different target motifs on adenylyl cyclase, G and calmodulin share a two-site-interaction mechanism with G s and forskolin to modulate adenylyl cyclase activity. Forskolin and G s are known to interact with both cytosolic domains of adenylyl cyclase – from

inside the catalytic cleft as well as at the periphery. An individual interaction site located at C1 of the specifically regulated adenylyl cyclase subtype had been ascribed for both G and calmodulin. We now show for these two regulators of adenylyl cyclase that a second isoform- and regulator-specific contact site in C2 is necessary to render enzyme activity susceptible to G or calmodulin modulation: In addition to the PFAHL-motif in C1b of ACII, G contacts the KF-loop in C2, while calmodulin requires not only the 2+ 2+ Ca -independent AC28-region in C1b but also a Ca -dependent domain in C2a of ACI with the VLG-loop to stimulate this adenylyl cyclase isoform.

1ABBREVIATIONS: AA – alanyl-alanine; AC – adenylyl cyclase; AC28-region– sequence motif located in the

C1b domain of ACI; pAC28 – peptide comprising amino acids of the AC28-region; CaM – calmodulin; cAMP – THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

cyclic adenosine-3',5'-monophosphate; KF – sequence motif located in the C2a domain of ACII; NAAIRS –

asparagyl-alanyl-alanyl-isoleucyl-arginyl-serine; PFAHL – sequence motif located in the C1b domain of ACII;

VLG – sequence motif located in the C2a domain of ACI; wt – wild type

Stage 2(a) POST-PRINT1

Licenced copy. Copying is not permitted, except with prior permission and as allowed by law. © 2008 The Authors Journal compilation © 2008 Biochemical Society Biochemical Journal Immediate Publication. Published on 14 Jan 2008 as manuscript BJ20071204

INTRODUCTION

Adenylyl cyclases (AC1) catalyze the conversion of ATP into the universal second messenger cAMP. Class III ACs comprise a family of structurally similar enzymes (1) with a catalytic centre composed of

two pseudosymmetric domains, C1 and C2. Mammalian ACs contain those domains on a single polypeptide chain that is folded into two membrane regions each built up by six transmembrane helices; - C1 follows transmembrane region M1 and proceeds transmembrane region M2,C2 follows trans

membrane region M2 (Fig. 1A). On the basis of sequence similarity both cytosolic domains C1 and C2

comprise subdomains Ca and Cb. The C1a subdomain shares roughly 60% identity to C2a at amino acid level, and both subdomains heterodimerize to form the pseudosymmetrical catalytic core (2). Mammalian ACs are represented by at least nine different isoforms (ACI-ACIX) that have been cloned and analyzed (1). They are grouped into three subclasses (3) according to their regulatory molecules: ACI represents the prototype of calmodulin (CaM)-stimulated ACs, ACII belongs to the subgroup of ACs that are stimulated by G (G complex of the heterotrimeric G proteins), and ACV and ACVI 2+ are inhibited by submicromolar concentrations of Ca .G s ( subunit of the stimulatory heterotrimeric G protein) and forskolin are common stimulators of all those ACs, while inhibition by G i ( subunit of the inhibitory heterotrimeric G protein) is restricted to ACI as well as ACV and ACVI (4). Based on crystal structures of the catalytic domains of ACs, binding sites for forskolin and G s are

known. One molecule of forskolin binds to the C1+C2 heterodimer (5) at sites that are distinct to that for G s (6). Contacts between forskolin and both catalytic halves of AC occur at multiple amino acids

(K896, I940, G941, and S942 in C2 of ACII; F394, W507, V511, Y443 in C1 of ACV). When bound to

the domain interface, forskolin stabilizes the interaction between C1 and C2. Two structural elements of G s form the interface, primarily through contacts with C2. The most prominent interaction is the insertion of the G s switch II helix (residues 225 to 240) into the groove formed by 2' and the 3'- 4' loop of AC. The second contact surface is formed by the 3- 5 loop of G s, which interacts with both

C1 and C2 (6). THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Obviously, domain association is a prerequisite for AC activity. However, C1+C2 assembly alone is clearly not sufficient to achieve the high level of AC activity displayed in the presence of forskolin, G s or both activators (7). Hence, it is assumed that the binding of forskolin or G s facilitates cAMP synthesis by altering the conformation of the active site. The 3D structure suggests one way such activation could occur: the 2'- 3' loop of C2 contacts K436 and L438 of the 2- 3 loop of C1, thereby linking residues that form the forskolin binding site with structural elements carrying residues important

for catalysis. In this model, the regulator contacts allosteric sites in C1 and C2 thereby rearranging

Stage 2(a) POST-PRINT2

residues at the C1/C2 cleft that positively impacts cAMP catalysis. Besides forskolin and G s, no other crystal structures are solved for AC complexed to regulatory proteins. Binding of G i was implicated to take place within the cleft formed by the 2and 3 helices of C1 (8), analogous but pseudosymmetric to the G s binding in C2. For both, CaM and G ,asingle

regulator-specific contact site was deduced so far: a) For CaM binding, an AC sequence in C1b (stretch of 28 amino acids forming the AC28-region) with high affinity for CaM had been identified (9). The AC28-region comprises a hydrophobic sequence containing basic amino acids as expected for CaM effector sites, and is located centrally in the cyclase. The corresponding peptide efficiently interferes with the stimulation of AC by CaM, but exhibits a higher affinity for CaM binding (2 nM) than does AC (Kd for CaM-mediated AC stimulation 15-20 nM; (9, 10)). b) G is a conditional regulator of ACs, i.e. both activation of ACII and inhibition of ACI are best observed at the pre-stimulated ACs (11). Recently, the PFAHL-motif in the variable C1b domain of ACII was shown to be indispensable for G - stimulation of the ACII (12). In the present work we show that G-, and also CaM-regulation of adenylyl cyclase isoforms required a second regulator-specific site in the other catalytic domain, C2.ForG the KF-loop in ACII between the 2' helix and the 2' sheet was identified, for CaM the VLG-loop at the C2a/C2b boundary of ACI. While the general adenylyl cyclase stimulators forskolin and G s contact conserved amino acids in C1 and C2, motifs of the isoform-specific regulators G and CaM were not conserved but rather showed subgroup specificity according to the different regulatory patterns of ACs. THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINT3

EXPERIMENTAL

Generation of AC constructs ACI with a N-terminal MYC-tag was generated by PCR using bovine cDNA (accession number P19754) encoding ACI as a template and primer myc-IM1C1 (5’-GGAGGAACTAGTACCATGGAA- CAAAAACTGATATCGGAAGAAGACCTCGCGGGGGCGCCGCGCGGCCGAGGC-3’). The PCR product was ligated into pBSKII+ (Stratagene) using SpeI and HindIII. Activity and regulation of this ACI (denoted ACI wt) was indistinguishable from untagged wild type ACI and was used as control throughout this work. The generation of constructs (Fig. 1B) encoding N- and C-terminal halves of ACI

(I-M1C1 and I-M2C2), ACII (II-M2C2), and ACV (V-M1C1) was performed by PCR-based mutagenesis

and has been described previously (13). Construction of ACII.IC1b was described (12). For generation of

ACI.IIC2 the oligonucleotides 5'- GCCGTCTCAGCAGAGTGAATATTACTGTAGGTTAG-3' and 5'- CCAAGCTTATTCAGGATGCCAAGTTGCTCTG-3' were applied in an analogous strategy using the endogenous restriction sites Bsu36I and HindIII. ACI-deletion mutant ACI.1057 was constructed using 5'-CTACACATCACCCGGGTCCAGTG-3' and 5'-CGAAAGCTTAGAAGTATGTCAGCATC- 3, and ACI. 1094 was constructed using 5'-CTACACATCACCCGGGTCCAGTG-3' and 5'-CGAAA- GCTTAGGGGTGACCCGC-3'; cloning was performed by the ACI-endogenous sites XmaI and

HindIII. Quick-Change Site-Directed Mutagenesis using PfuTurbo Cx Hotstart DNA Polymerase (Stra- tagene) was used according to manufacturer's instructions to generate NAAIRS1 and AA1 mutants. ACII.928 was generated analogously to the described procedure (12) using 5'-TGATGATCTGCTTT- CTAATGCTGCTATACGATCGGTTGAAAAGATCAAG-3' and the corresponding reverse complementary oligonucleotide as primers. The ACII.AAxxx mutants were generated using primers: 5'-GCTG- ACTTTGATGATGCTGCTTCTAAGCCAAAGTTC-3' (ACII.AA925), 5'-TTTGATGATCTGCTTGC- TGCTCCAAAGTTCAGTGGT-3' (ACII.AA927), 5'- CTGCTTTCTAAGCCAGCTGCTAGTGGTGT- TGAAAAG-3' (ACII.AA930), and 5'-TCTAAGCCAAAGTTCGCTGCTGTTGAAAAGATCAAG-3' (ACII.AA932) in combination with their respective reverse complementary pendants. ACI-G mutants i THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 were generated using primers 5'-CCACGTTGCCCAGCACGCCCTAATGTCCAACCCTCG- 3'(ACI.F852A), 5'-GCACTTCCTAATG-TCCGCCCCTCGCAACATGGACC-3' (ACI.N856A), 5'-CC- TAATGTCCAACCCTGCCAACATGGA-CCTGTATTACC-3', (ACI.R858A), and 5'-CCTAATGTC- CAACCCTCGCGCCATGGACCTGTATT- ACC-3' (ACI.N859A).

Stage 2(a) POST-PRINT4

Synthetic peptides

pAC28: NH2-IKPAKRMKFKTVCYLLVQLMHCRKMFKA-COOH, derived from sequences located

in IC1b; pVLG: NH2-TEEVHRLLRRGSYRFVCRGKV-COOH, derived from sequences located in IC2a;

pAAG: NH2-TEEAHRLARRGSYRFVCRGKV-COOH, identical to pVLG except for two alanine

mutations at the CaM-critical residues V and L (underlined); pTT: NH2-TQPKTDHAHCCVEMGLDM-

IDT-COOH, derived from sequences located in IC1a.

Preparation of AC All AC constructs were expressed in Sf9 cells using the baculovirus expression system; purified plasma membranes were the sources for AC assays. Baculovirus encoding the AC was generated from the pFastBac1-AC construct in Sf9 insect cells (Invitrogen). Cells (106/ml) were then infected with the baculovirus (1 plaque-forming unit/cell), harvested 48-52 h later, and lysed by nitrogen cavitation. After removal of nuclei by centrifugation, membranes were collected, washed, and resuspended.

Regulators of AC G was expressed in Sf9 insect cells using baculoviruses encoding G 1 and G 2, detergent extracted and purified by affinity chromatography as described using the G-attached N-terminal His-tag (14). G s was expressed in bacteria and purified using the C-terminal attached His-tag (16). Purified G s was activated in vitro with guanosine 5´-[thio]triphosphate (GTPS) by incubation for 30 min at 30 °C and 1 h on ice. The activated G s-GTP S was purified by subsequent size exclusion chromatography to remove the free nucleotide. The concentration of the activated G s was determined by inclusion of radiolabeled [35S]-GTPS during activation. CaM was purchased from Calbiochem.

Dansyl-CaM

Equimolar amounts of dansylchloride and N-hydroxysuccinimide were mixed in dimethylformamide THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 and activated by addition of 1 equivalent of triethylamine. Activated dansylester was incubated with 1/4 equivalent CaM at pH 7.5 over night at room temperature before the formed dansyl-CaM was purified by size exclusion chromatography. This procedure was dissimilar to protocols used by others and Sigma in the past, but allowed the preferred dansylation of just the N-terminal amino acid of CaM, rather than an uncontrolled number of internal hydroxyl or amino groups.

Stage 2(a) POST-PRINT5

Dansyl-CaM binding A volume of 800 µl Dansyl-CaM (80 nM) was adjusted to the indicated concentrations of Ca2+ ions, peptides and/or EGTA; dilution effects were maintained below 3%. Fluorescence emission spectra were recorded from =450 nm to =550 nm ( ex=334 nm, 20 nm/min) at 27 °C with the Luminescence Spectrometer LS50B (Perkin Elmer).

Enzyme assays AC activity was determined based on the conversion of [32P]-ATP to 32P-cAMP with subsequent purification of cAMP by sequential chromatography using cation exchange (Dowex 50) and neutral alumina resins. All samples contained pyruvate kinase and phosphoenol pyruvate as ATP generating system and Ro 20-1724 as inhibitor of cAMP-specific phosphodiesterases. Assays were performed for 7-10 min at 30 °C in a final volume of 100 µl with the indicated amounts of recombinant Sf9

membranes in the presence of 10 mM MgCl2 and 0.5 mM ATP. To determine CaM-regulation, AC containing membranes were washed with 1 mM EGTA to remove

Sf9-endogenous CaM, then AC activity was determined in the presence of 100 µM CaCl2. After a 2-min pre-incubation at 30 °C the AC assay was started by addition of the substrate and stopped after another 7 min incubation period. For peptide competition studies, peptides were pre-incubated for 60 min on ice in the presence of CaM. CaMkinase assays were performed according to the manufacturer's instructions (SignaTECT from Promega).

Miscellaneous Membrane proteins were quantified by dye binding using acidic Coomassie Brilliant Blue (BioRad) with bovine serum albumin as standard. Immunodetection of AC constructs was performed with commercially available antibodies anti-c-MYC: 9E10 (Santa Cruz), anti-ACII: C20 (Santa Cruz) and

anti-HA: 12CA5 (Roche). THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINT6

Results and Discussion

A second CaM site in ACI

Amino acids 495-522 (denoted as AC28-region) in the C1b domain of ACI were shown to be necessary for stimulation of this AC subtype by CaM and were represented by the synthetic peptide pAC28 (9). To

test if the AC28-region in the context of the intact C1b domain of ACI was able to transfer CaM-

stimulation to the CaM-insensitive ACII, we generated the ACII.IC1b chimera (see Fig. 1). The data shown in Fig. 2 revealed that the presence of the AC28-region was not sufficient to turn ACII into a

CaM-stimulated ACII.IC1b. Another chimera indicated a second site located in C2 necessary for CaM to

stimulate the catalytic activity of type I AC. This second chimera, ACI.IIC2, was a type I like AC with

IC2 substituted by the homologous C2 domain of the CaM-insensitive ACII. ACI.IIC2 was no longer regulated by CaM, although it was still stimulated by G s and forskolin; indeed, G s- and forskolin

stimulated activities of ACI.IIC2 by far exceeded those of parent wild type ACs, type I and type II (data not shown).

In order to localize the missing CaM motif in either C2a or C2b of ACI, two deletion mutants of ACI were generated (see Fig. 1). In ACI. 1094 the 44 C-terminal residues of the C2b domain were removed; ACI. 1057 was devoid of all amino acids assigned to C2b. Both deletion mutants were active and

stimulated by Ca/CaM as well as ACI (Fig. 3). These results provided evidence that the C2a of ACI domain was necessary for CaM to stimulate ACI.

In order to define the amino acids in C2a responsible for mediating the CaM-stimulatory signal to ACI,

the catalytic C2a subdomain was checked for regions matching the rules for putative CaM interaction sites described by Rhoads et al. (17). Although no universal CaM binding motif had been defined and CaM interaction sites were difficult to predict, we could identify one stretch of 14 amino acids in the C-

terminus of the C2a subdomain of ACI that obeys the 1-5-8 rule (Fig. 4A): This domain contained hydrophobic residues at positions 1, 5, and 8 (valine V, leucine L, glycine G) and was therefore called the VLG-loop. The VLG-homologous region in the ACII crystal showed a helix-loop-helix structure THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 and was located in the periphery of the catalytic heterodimer (Fig. 4B). To show the involvement of the VLG-loop in CaM-stimulation of ACI, two amino acids at the key positions 1 and 5 of the motif, V1027 and L1031, were mutated to alanine. The resulting mutant was not catalytically active under basal, G s- or forskolin-stimulated conditions (not shown). The fact that point mutations within the VLG-region were sufficient to completely abolish the catalytic activity of the enzyme lead to the conclusion that this region was crucial for the integrity of the catalytic core. Its impact on AC's enzymatic function already became obvious when truncation immediately C-terminal to

Stage 2(a) POST-PRINT7

the VLG-region resulted in a mutant (ACI.1057) with reduced catalytic activity (see Fig. 3). To date

the crystal structure of the IC2a domain is not known. All structural data rely on sequence alignments of

IC2a with the IIC2a subdomain the structure of which had been resolved in complex with VC1a (6). In

ACII, lacking a C2b subdomain, the VLG-homologous sequence is assigned to the C-terminal part of the enzyme (see Fig. 4B) and has not been reported to be involved in catalysis. In contrast, the VLG-motif

of ACI is followed by the variable C2b subdomain, thereby forming the C2a/C2b boundary that might be crucial for the correct orientation of the two subdomains and thereby for the integrity of the catalytic core. As we had identified the key amino acids of the VLG-loop, V1027 and L1031, to be indispensable for the catalytic activity of ACI, peptide studies were applied to show indirect evidence for the involvement of that loop in CaM regulation. The peptide pVLG, comprising all amino acids of the VLG-loop, was synthesized and analyzed for direct CaM interaction and for competition with the CaM effectors ACI and the cyclase-unrelated CaM-dependent kinase II. The peptide corresponding to the VLG-loop did bind CaM as shown by fluorescence-changes of dansyl- CaM (Fig. 5A). Whereas the fluorescence intensity stayed unaltered in the presence of a non-binding peptide (pTT), increasing concentrations of pVLG lead to increasing intensity of the dansyl-CaM fluorescence. Similar fluorescence-changes were obtained using the peptide pAC28 covering the amino

acids of C1b, already known to be necessary for ACI stimulation by CaM. Obviously, the concentration

of 80 nM dansyl-CaM used in this experiment exceeded the Kd of pAC28 and pVLG for CaM as shown by the linear relation between fluorescence-change and peptide concentration below the equimolar ratio peptide/CaM indicating a 1:1 binding stochiometry. A minimum of 80 nM dansyl-CaM was necessary to obtain precise fluorescence data. When the key amino acids V and L of pVLG were changed to alanine (pAAG), fluorescence changes caused by the peptide were reduced, pointing to a sequence dependence of the VLG-region for binding to CaM. The peptide pVLG did not only bind CaM, but obviously occupied the effector-interacting epitope of CaM, as the CaM-pVLG complex could no longer stimulate the CaM effectors ACI (Fig. 5C ) and THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 CaM-dependent kinase II (Fig. 5D). Again, the importance of amino acids V1027 and L1031 in ACI (position 1 and 5 in the VLG-motif, respectively) for CaM binding became evident as pAAG competed less efficiently than pVLG with both effectors for CaM. Surprisingly, ACI inhibition was not exclusively mediated by peptide binding to CaM, but also by a direct peptide effect on ACI as depicted in the insert of Fig. 5C. Nevertheless, the calculated peptide net effect on CaM stimulation – corrected by the peptide effect on basal AC activity - was still more pronounced for pVLG than for pAAG. The phenomenon that pVLG and pAAG also inhibited the basal

Stage 2(a) POST-PRINT8

activity of ACI corroborated our earlier hypothesis evolved from the inactive point mutations in ACI that integrity of the VLG-region was a prerequisite for overall enzymatic activity of ACI. Due to read-out dependent differences in assay sensitivity, higher CaM concentrations were applied for peptide competitions with ACI than for dansyl-CaM binding (200 nM versus 80 nM; see Fig. 5C versus 5A). No differences between pAC28 and pVLG were detected in the fluorescence assay as 80 nM

dansyl-CaM was well above the Kd of pAC28 binding to CaM (9). In contrast, the AC readout with the coupled reaction scheme, involving CaM binding and AC interaction at two sites (see below), revealed

for pAC28 (IC50 500 nM) higher affinity in binding CaM than for pVLG (IC50 10 µM; not shown). This would point to a minor role of the VLG-motif in transmitting CaM-stimulation to ACI compared to the

AC28-region. However, despite its relatively high affinity for CaM, C1b harbouring the AC28-region could not be the relevant CaM-sensitive region of ACI for the following reasons: a) In the context of

chimera ACII.IC1b the AC28-region did not transmit the stimulatory Ca/CaM signal onto a Ca/CaM- insensitive AC isoform; b) while ACI activity modulation by CaM is known to be strongly Ca2+- dependent (10), pAC28 bound to CaM in a Ca2+-independent manner: Figure 5B shows that pAC28 binding was detected also in the absence of free calcium ions (“+EGTA”), a hitherto unappreciated phenomenon. In contrast, pVLG derived from the newly detected second CaM-site in ACI exhibited Ca2+-dependent binding to CaM (see Fig. 5B). Thereby, CaM-regulation became both highly potent by the AC28-region and Ca2+-sensitive by the VLG-region, establishing a molecular basis by which ACI activity can be changed during cytosolic calcium oscillations (24). A similar scenario was already described for the second CaM-stimulated AC isoform, ACVIII, with the

2+ N-terminus pre-assembling CaM and the C2 domain enabling both Ca -sensitivity and the stimulatory action of CaM (25). ACI and ACVIII do not provide identical signal transfer motifs for CaM, but their mechanistic modulation is based on the same two-site scheme. The pre-recruitment of CaM by the AC28-region and the N-terminus of ACI and ACVIII, respectively, is highly beneficial - if not essential - in the intact cell. In living cells, the majority of the total of 10 µM CaM is sequestered, tethered or compartmentalized, so the concentration of potential CaM binding proteins in the cytosol or cytoplasma THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 facing membranes exceeds that of the free, available CaM (ca. 45 nM) about 2-fold (26). In the resting cell, CaM-tethering is important to advance complex formation between the three partners Ca2+,CaM, and effector. Following an increase in intracellular calcium concentration, the AC-pre-associated CaM

might change its conformation and activate the AC involving the catalytic AC-domain C2a, supposingly by stabilizing structural elements like the VLG-loop. Similar activation schemes have already been described for the two AC exotoxins of Bordetella pertussis and Bacillus anthracis. CaM in an extended conformation binds to several loops close to the catalytic centre of the bacterial AC and activates the enzyme through subtle changes in the surroundings of the active cleft (27). Stage 2(a) POST-PRINT9

A second G-site in ACII The structural basis of ACII regulation by G showed strong analogy to stimulation of ACI by CaM. Also for G , an obligatory motif in C1b had been described to observe ACII stimulation. Like the

AC28-region in ACI, amino acids of the PFAHL-motif in C1b of ACII had been identified as an essential G signal transfer site of ACII because substitution of IIC1b or just the PFAHL-motif by IC1b or irrelevant amino acids, respectively, completely abolished G-stimulation (12). Here, we showed that besides the PFAHL-motif on C1b, also domain C2 of ACII was important to mediate G -stimulation to sensitive ACs.

In a first step, AC was cut into halves comprising M1C1 and M2C2 (see Fig. 1). Both halves together

lined up to the bisected ACI (AChalvesI+I) and ACII (AChalvesII+II), and - after coexpression - functionally rebuilt the G-inhibited ACI (Fig. 6) and G-stimulated ACII (14). This proved that the G-

regulatory pattern was preserved even in the bisected AC. However - in a second step - IIM2C2 was co- expressed with IM1C1, the N-terminal half of the G -inhibited AC type I, or VM1C1, the N-terminal half of the G -insensitive canine AC V (18). Both resulting bisected chimeras AChalvesI+II and AChalvesV+II, respectively, were still stimulated by G (1.5-2-fold) indicating a G -stimulating feature

of IIM2C2. This stimulatory effect was even observed when only IIC2 was introduced into an ACI background (ACI.IIC2) pointing to a second G -site located in C2 of ACII. The inverse chimera ACII.IC2 was catalytically inactive under basal, G s- and forskolin-stimulated conditions (not shown). To define amino acids in C2 responsible for mediating the G -stimulatory signal to ACII, the catalytic

C2 domain was screened by NAAIRS-substitutions. The hexapeptide NAAIRS is a flexible linker adopting various secondary structures in different proteins. It therefore had been applied in different

substitution experiments, for example leading to the identification of the PFAHL-motif in the C1b domain of the ACII (12). Although all amino acids that were known from the literature to be involved in catalysis, in G s or in forskolin interaction were excluded from this screen, 50% of the generated mutants were not catalytically active; the remaining eight mutants that functionally could be tested were

all stimulated by G (not shown). THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 In a next screen we substituted only two instead of six amino acids. The alanyl-alanine substitutions

were introduced into a short loop (named KF-loop according to its central amino acids) in IIC2 that showed significant similarity for all three G-stimulated ACs (type II, IV, and VII; Fig. 7A), but none for the G-inhibited ACI or the G-insensitive canine ACV. Additionally the loop appeared an ideal target for regulators like G as it is located dorsal to the catalytic cleft, thereby supposed to be easily accessible for regulators (Fig. 7B). Moreover, the KF-loop connects the two major structural elements of C2a that form the interface sites with C1a,i.e.the 2' sheet of C2a that stacks on top of the 4- 5 loop

Stage 2(a) POST-PRINT10

of C1a, and the 2' helix of C2a that contacts the N-terminal segment of 2 and the C-terminal end of 4 of C1a (6). Consequently, a conformational change of the KF-loop - caused by the docking of G - should have a direct effect on the AC activity. The consecutive substitution of two amino acids from this nine-residue motif resulted in four mutants (Fig. 7C) that were catalytically active (Fig. 7D). In contrast, NAAIRS-substitution in this region starting at amino acid residue 928 had generated the catalytically inactive ACII.928 mutant. One reason might be the detrimental substitution of P929 as a structurally relevant amino acid in the NAAIRS screen, while P929 was not exchanged in the alanyl-alanine screen. The potential impact of P929 on intrinsic enzyme activity was underlined by the diminished activity of ACII.AA930 with the two amino acids substituted adjacent to P929. Fig. 8 depicts the G-responses of the four ACII alanyl-alanine mutants. Substitution of the KF-pair by two alanine residues resulted in ACII.AA930 that was no longer stimulated by G. This mutant defined K930 and F931 of ACII as key residues for G-stimulation. Alanyl-alanine substitutions preceding the central KF-spot and adjacent to P929 (ACII.AA927) showed diminished G-stimulation while substitutions more distant to the KF-pair did not significantly change G-regulation of the resulting mutants ACII.AA925 or ACII.AA932. These data provided clear evidence that the KF-loop was an essential motif in ACII to observe G-mediated stimulation.

The QEHA-motif (amino acids 956-982) was another region in IIC2 that had been described in the past to interact with the G-complex (28); however, domain swaps and substitutions in that region revealed that - in contrast to the PFAHL-motif and KF-loop - the QEHA-motif was not necessary as a mediator of the stimulatory effect of G to ACII (14). Hence, we assumed that the QEHA-motif as a neutral G-tether provided local concentration of G, without playing a role in the regulatory signal transfer to the AC. During the course of manuscript preparation Gao et al. published solid data about the G-stimulation of the human ACV and ACVI (18) while canine ACV was G-insensitive. Interestingly, the human

ACV amino acid sequence is identical to canine ACV in the PFAHL-motif as well as the KF-loop and THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 dissimilar to the orthologous ACVI as well as ACII sequences. Furthermore, Gao et al. identified a G interaction site at the N-terminus of human ACV and human ACVI. We concluded that the PFAHL- and the KF-motif were specific G-regulatory hot spots for type II-like ACs (including ACIV and ACVII, all providing identical motifs), while other AC subgroups provided different motifs to result in analogous modulation.

In summary, the presented data show a minimum of two sites being necessary for AC isoforms to be

Stage 2(a) POST-PRINT11

regulated by G or Ca/CaM. Analogously to the already described contact sites for G s and forskolin (6,19-22), they are located on both halves of AC. For the general stimulators (G s and forskolin)

interaction sites have been described at the highly conserved C1a and C2a domains, while the isoform- specific regulators (G , Ca/CaM) used sites in C2a plus the less conserved C1b region specifying the individual isoform regulation (see Fig. 1A). A similar scenario was also observed concerning the G i-

mediated inhibition of the isoform ACI (unpublished data). The substitution of the cytosolic domain IC2, resulting in the chimera ACI.IIC2, was sufficient to completely abolish G i-inhibition. This clearly indicated that besides the G i-binding site in the C1a domain (8), also the C2 domain was essential for G i-inhibition on ACI. Preliminary data based on single alanine substitutions in full length ACI to define a point-symmetric residue to the G s–specific F379 (ACV numbering; see above) in IC2 for G i- interaction showed that neither F852 nor N856, nor R858, nor N859 were involved in G i inhibition (not shown). Two schemes for the regulatory signal transfer via motives on both AC halves are conceivable: Either a concerted action takes place where binding of the multifaceted regulator to AC and modulation of AC

activity occurs almost simultaneously at the C1- and C2-contact sites of AC thereby rearranging the

catalytic C1/C2-interface for more effective (activation) or diminished (inhibition) cAMP catalysis. Alternatively, a sequential mechanism takes course: First, the regulator binds with reasonably high

affinity at a general binding region of AC, potentially on the variable C1b domain; second, the pre- assembled regulator induces a signal transfer cascade within the AC involving the second regulatory

site, potentially on the catalytic domain C2a. The sequential model offers the advantage that the second regulatory region like the VLG-motif may afford relatively low affinities for the regulator because in the pre-assembled complex the local concentration of the regulator exceeds overall cytosolic concentrations by orders of magnitude. At least for CaM-regulation of ACI and ACVIII, the sequential mechanistic model fitted best to the data and seemed plausible with respect to multiple effector molecules in the cell. In general, the existence of multiple AC hot spots for one regulator appears to be a key feature of ACs

in their function as multifaceted detectors and integrators of various regulatory signals that are then THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 translated into one common, easily-decoded, intracellular signal, the cAMP molecule.

Stage 2(a) POST-PRINT12

ACKNOWLEDGMENT We thank Dr. Alfred G. Gilman for cDNAs encoding ACI and ACII, and baculoviruses encoding G 1 (M13236), tagged G 2 (K02199) and -galactosidase. We appreciate the work of Kathrin Klass who contributed dansyl-CaM. The work was initially supported by the Deutsche Forschungsgemeinschaft (DFG KL773/5). THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINT13

References

1. Linder, J. U., and Schultz, J. E. (2003) The class III adenylyl cyclases: multi-purpose signalling modules, Cell. Signal. 15, 1081-1089.

2. Sunahara, R. K., Dessauer, C. W., and Gilman, A. G. (1996) Complexity and diversity of mammalian adenylyl cyclases, Annu. Re.v Pharmacol. Toxicol. 36, 461-480.

3. Sunahara, R. K., and Taussig, R. (2002) Isoforms of mammalian adenylyl cyclase: multiplicities of signaling, Mol. Interv. 2, 168-184.

4. Taussig, R., Iniguez-Lluhi, J. A., and Gilman, A. G. (1993) Inhibition of adenylyl cyclase by Gi , Science 261, 218-221.

5. Zhang, G., Liu, Y., Ruoho, A. E., and Hurley, J. H. (1997) Structure of the adenylyl cyclase catalytic core, Nature 386, 247-253.

6. Tesmer, J. J., Sunahara, R. K., Gilman, A. G., and Sprang, S. R. (1997) Crystal structure of the catalytic domains of adenylyl cyclase in a complex with Gs .GTP S, Science 278, 1907-1916.

7. Sunahara, R. K., Dessauer, C. W., Whisnant, R. E., Kleuss, C., and Gilman, A. G. (1997) Interaction of Gs with the cytosolic domains of mammalian adenylyl cyclase, J. Biol. Chem. 272, 22265-22271.

8. Dessauer, C. W., Tesmer, J. J. G., Sprang, S. R., and Gilman, A. G. (1998) Identification of a Gi binding site on type V adenylyl cyclase, .J Biol. Chem. 273, 25831-25839.

9. Vorherr, T., Knopfel, L., Hofmann, F., Mollner, S., Pfeuffer, T., and Carafoli, E. (1993) The calmodulin binding domain of nitric oxide synthase and adenylyl cyclase, Biochemistry 32, 6081-6088.

10. Tang, W. J., Krupinski, J., and Gilman, A. G. (1991) Expression and characterization of THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 calmodulin-activated (type I) adenylylcyclase, J. Biol. Chem. 266, 8595-8603.

11. Taussig, R., Quarmby, L. M., and Gilman, A. G. (1993) Regulation of purified type I and type II adenylylcyclases by G protein subunits, J. Biol. Chem. 268,9-12.

12. Diel, S., Klass, K., Wittig, B., and Kleuss, C. (2006) G activation site in adenylyl cyclase type II. Adenylyl cyclase type III is inhibited by G, J. Biol. Chem. 281, 288-294.

13. Weitmann, S., Würsig, N., Navarro, J. M., and Kleuss, C. (1999) A functional chimera of

Stage 2(a) POST-PRINT14

mammalian guanylyl and adenylyl cyclases, Biochemistry 38, 3409-3413.

14. Weitmann, S., Schultz, G., and Kleuss, C. (2001) Adenylyl cyclase type II domains involved in G stimulation, Biochemistry 40, 10853-10858.

15. Kozasa, T., and Gilman, A. G. (1995) Purification of recombinant G proteins from Sf9 cells by hexahistidine tagging of associated subunits. Characterization of 12 and inhibition of adenylyl cyclase by z, J. Biol. Chem. 270, 1734-1741.

16. Kleuss, C., and Gilman, A. G. (1997) Gs contains an unidentified covalent modification that increases its affinity for adenylyl cyclase, Proc. Natl. Acad. Sci. U. S. A. 94, 6116-6120.

17. Rhoads, A. R., and Friedberg, F. (1997) Sequence motifs for calmodulin recognition, Faseb J. 11, 331-340.

18. Gao, X., Sadana, R., Dessauer, C. W., and Patel, T. B. (2007) Conditional stimulation of type V and VI adenylyl cyclases by G protein subunits, J. Biol. Chem. 282, 294-302.

19. Tang, W. J., Stanzel, M., and Gilman, A. G. (1995) Truncation and alanine-scanning mutants of type I adenylyl cyclase, Biochemistry 34, 14563-14572.

20. Tesmer, J. J., and Sprang, S. R. (1998) The structure, catalytic mechanism and regulation of adenylyl cyclase, Curr. Opin. Struct. Biol. 8, 713-719.

21. Tesmer, J. J., Sunahara, R. K., Fancy, D. A., Gilman, A. G., and Sprang, S. R. (2002) Crystallization of complex between soluble domains of adenylyl cyclase and activated Gs , Methods Enzymol. 345, 198-206.

22. Zhang, G., Liu, Y., Qin, J., Vo, B., Tang, W. J., Ruoho, A. E., and Hurley, J. H. (1997) Characterization and crystallization of a minimal catalytic core domain from mammalian type II

adenylyl cyclase, Protein Sci. 6, 903-908. THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

23. Dessauer, C. W., Tesmer, J. J., Sprang, S. R., and Gilman, A. G. (1998) Identification of a Gi binding site on type V adenylyl cyclase, J. Biol. Chem. 273, 25831-25839.

24. Nakahashi, Y., Nelson, E., Fagan, K., Gonzales, E., Guillou, J. L., and Cooper, D. M. (1997) Construction of a full-length Ca2+-sensitive adenylyl cyclase/aequorin chimera, J. Biol. Chem. 272, 18093-18097.

Stage 2(a) POST-PRINT15

25. Simpson, R. E., Ciruela, A., and Cooper, D. M. (2006) The role of calmodulin recruitment in Ca2+ stimulation of adenylyl cyclase type 8, J. Biol. Chem. 281, 17379-17389.

26. Persechini, A., and Cronk, B. (1999) The relationship between the free concentrations of Ca2+ and Ca2+-calmodulin in intact cells, J. Biol. Chem. 274, 6827-6830.

27. Guo, Q., Shen, Y., Lee, Y. S., Gibbs, C. S., Mrksich, M., and Tang, W. J. (2005) Structural basis for the interaction of Bordetella pertussis adenylyl cyclase toxin with calmodulin, Embo J. 24, 3190- 3201.

28. Chen, J., DeVivo, M., Dingus, J., Harry, A., Li, J., Sui, J., Carty, D. J., Blank, J. L., Exton, J. H., Stoffel, R. H., Inglese, J., Lefkowitz, R. J., Logothetis, D., Hildebrandt, J. D., and Iyengar, R. (1995) A region of adenylyl cyclase 2 critical for regulation by G protein subunits, Science 268, 1166-1169. THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINT16

FIGURE CAPTIONS

Fig. 1: AC topology and constructs generated. (A) Topology of ACs. Arrows indicate the regulatory domains for stimulation by G s and forskolin (all AC isoforms), Ca/CaM (ACI) and G (ACII). N:

cytosolic N-terminus; M1: first transmembrane domain; C1a: first conserved cytosolic domain; C1b:first

variable cytosolic domain; M2: second transmembrane domain; C2a: second conserved cytosolic domain;

C2b: second variable cytosolic domain. Isoform ACII lacks the C2b domain. AC28 and VLG: already known and newly detected target sites of Ca/CaM, respectively; PFAHL and KF: already known and newly detected target sites of G, respectively. (B) Scheme of AC domain mutants generated in this work by exchange of domains (ACII.IC1b, ACI.IIC2), deletion of subdomains (ACI. 1094, ACI. 1057),

or co-expression of N- and C-terminal halves (AChalves M1C1 +M2C2). ACI domains are dark coloured, ACII white, ACV grey. Point mutants of AC are explained by name and not included in this scheme.

µ Fig. 2: Importance of C1b and C2 domains for CaM-stimulation of ACI. Membranes (10 g protein) from Sf9 cells expressing ACI or mutant ACII.IC1b or ACI.IIC2 were incubated with 80 nM G s plus 100 µM 2+ Ca in the presence of increasing concentrations of CaM. Data were normalized to G s-stimulated

activities in the absence of CaM: 2.5 (ACI wt), 0.6 (ACII.IC1b), and 5 (ACI.IIC2) nmol cAMP/min/mg protein after correction for the Sf9-endogenous AC activities. Data are representative of three similar assays performed in duplicates; the mean SEM was below 2%.

Fig. 3: Calmodulin-regulation of ACI deletion constructs. Membranes (10 µg protein) from Sf9 cells 2+ expressing the indicated ACI constructs were incubated with 80 nM G s plus 100 µM Ca in the presence of increasing concentrations of CaM. Data were normalized to G s-stimulated activities in the absence of CaM: 2.5 (ACI wt), 2.3 (ACI.1094), and 0.1 (ACI.1057) nmol cAMP/min/mg protein after correction for the Sf9-endogenous AC activities. Data are representative of three similar assays performed in duplicates; the mean SEM was below 2%. THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Fig. 4: The VLG-loop in C2a of ACI. (A) The C-terminal domain of IC2a harbours a classical CaM binding motif (grey box) comprising hydrophobic amino acids at position 1, 5, and 8 (arrows), aromatic residues, and a positive net charge. (B) 3D-structure of the catalytic centre modelled in ACI based on

the VC1a+IIC2 structure. The VLG-loop in C2 is coloured dark pointing rightward.

Fig. 5: Functional analysis of the VLG-region.(A)Peptide binding to CaM. Relative fluorescence- changes of 80 nM dansyl-CaM in the presence of 0.5 mM Ca2+ when incubated with increasing 2+ concentrations of the indicated peptides; excitation=334 nm, emission=490 nm. (B) Ca -dependence of Stage 2(a) POST-PRINT17

peptide binding to CaM. Fluorescence (AU: arbitrary units) of 80 nM dansyl-CaM alone, with 200 nM of the indicated peptide, with 200 nM peptide in the presence of 0.5 mM Ca2+, or with 200 nM peptide in the presence of 0.5 mM Ca2+ plus 5 mM EGTA. Data are representative of two assays performed in triplicates; error bars indicate SEM. (C) Peptide competition with CaM-stimulated AC. Increasing amounts of the indicated peptides in the presence of 200 nM CaM and 100 µM Ca2+ were incubated with 10 µg membranes from Sf9 cells expressing ACI. The direct peptide effects on basal activity of AC are depicted in the insert at a 40% scale. All data had been corrected for endogenous AC activities of Sf9 cells exhibited under identical conditions. Mean AC activities without peptide were 2.5 (CaM- stimulated) and 0.6 (basal) nmol cAMP/min/mg protein. Data are representative of two independent experiments performed in duplicates, SEM was below 2%. (D) Peptide competition with CaM- stimulated kinase. The activity of 5 ng CaM kinase II was determined alone or in the presence of 50 µM of the indicated peptide. Data are representative of three independent experiments performed in duplicates, error bars show SEM.

Fig. 6: Regulation of AC chimeras by G. Membranes (20 µg protein) from Sf9 cells expressing ACII

or mutant ACI.IIC2 or N- and C-terminal halves of the indicated AC isoforms were incubated with 80 nM G s in the absence (grey bars) or presence (black bars) of 300 nM G . Shown are data from four independent experiments normalized to G s stimulated activity: 5.8 (ACII wt), 5 (ACI.IIC2), 1.7

(AChalvesI+II), 0.4 (AChalvesI+I), 5.7 (AChalvesV+II) nmol cAMP/min/mg protein. SEM was below 2%.

Fig. 7: KF-loop of ACII. (A) AlignmentofC2 domains from different AC isoforms. Positions of the first amino acids of the isotype specific AC sequences are indicated left. Residues identical to ACII are boxed grey; residues defining the KF-loop or KF-homologeous regions are big lettered. (B) 3D

structure of ACV-C1a (dark) and ACII-C2 (grey) according to (6). The KF-loop is located at the right periphery and painted black. (C) Expression of KF-loop mutants. Mutants were constructed by alanyl- alanine substitutions of the amino acids 925-926 (ACII.AA925), 927-928 (ACII.AA927), 930-931 (ACII.AA930), and 932-933 (ACII.AA932) or by NAAIRS substitution of the amino acids 928-933 THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 (ACII. 928) in IIC2 as illustrated. Two µg membrane proteins of Sf9 cells that had been infected with baculovirus encoding the indicated mutants were electrophoretically separated on a 9% polyacrylamide gel, blotted onto nitrocellulose and detected with a MYC-specific antibody. (D) Basic functional characterization of KF-loop mutants. AC activity of 20 µg membranes of Sf9 cells that expressed ACII, the indicated alanyl-alanine mutants, or the NAAIRS mutant ACII.928 were detected in the absence of any stimulator (basal), in the presence of 100 µM forskolin, or 80 nM G s. Listed values represent the average of three independent experiments performed in duplicate and corrected for endogenous Sf9

Stage 2(a) POST-PRINT18

activities detected under identical experimental conditions. Error bars indicate SEM.

Fig. 8: G-modulation of KF-loop mutant activities. (A) Membranes (5 µg protein) from Sf9 cells expressing the indicated alanyl-alanine mutants or ACII were incubated with increasing concentrations of G in the presence of 80 nM G s. Data were corrected for endogenous Sf9 activities, normalized to G s-stimulated values, and are representative of at least three similar experiments performed in duplicates on independent membrane preparations, mean SEM is below 2%. G s-stimulated activities were 7.3 (ACII), 7.9 (ACII.AA925), 5.5 (ACII.AA927), 2.1 (ACII.AA930), and 5.2 (ACII.AA932) nmol cAMP/min/mg protein. (B) Summary of the maximal G-stimulation displayed by each mutant or ACII at saturating concentrations of G (300 nM) as depicted in part A. THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINT19

ACI ACII M1 M2 M1 M2

plasma- membrane

b b b a AC28 a a PFAHL N VLG N KF

C1 C2 C1 C2

Gs, forskolin Ca/CaM Gs, forskolin G

ACI wt N M1 C1a C1b M2 C2a C2b

ACII wt N M1 C1a C1b M2 C2

ACII.IC1b N M1 C1a C1b M2 C2

ACI.IIC2 N M1 C1a C1b M2 C2

ACI.1094 N M1 C1a C1b M2 C2a C2b THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 ACI.1057 N M1 C1a C1b M2 C2a

AChalves I+II N M1 C1a C1b + M2 C2

AChalves I+I N M1 C1a C1b M2 C2a C2b

AChalves V+II N M1 C1a C1b + M2 C2 Stage 2(a) POST-PRINTFigure 1

800 ACI wt 700 ACII.IC1b ACI.IIC2 600

500 400

300

200

100 0 0 0.011 100 µM CaM THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINTFigure 2

800 ACI wt 700 ACI.1094 ACI.1057 600

500 400

300

200

100 0 0 0.011 100 µMCaM THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINTFigure 3

VLG - loop I C2a 1024 TEEVHRLLRRGSYRFVCRGKVSV

hydrophobic positions (1-5-8) net charge +4

B THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINTFigure 4

A B CaM 24 +peptide pAC28 330 pVLG +calcium 20 +EGTA pAAG 310 pTT 16 290

12 270

8 250

4 230

0 210 0 0.6 1.1 1.6 2.1 2.6 peptide/CaM (mol/mol) C D

1200 100 1000 80 pVLG 800 pAAG 60 pTT 600 40 400

20 200

0 0 0 0.22 20 200 2000 µM peptide THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINTFigure 5

1200 1000 G s Gs + G 800

600

400

200

0 THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINTFigure 6

A B KF - loop

IIC2 916 NEIIADFDDLLSKPKFSGVEKIKTIGS

IVC2 892 NEIIADFDELLSKPKFSGVEKIKTIGS VIIC2 925 NEIIADFDELLLKPKFSGVEKIKTIGS VC2 1024 NEIIADFDEIISEDRFRQLEKIKTIGS IC2 901 NEIIADFDELMDKDFYKDLEKIKTIGS

C AAAA AAAA

LLSKPKFSG KF-loop (ACII 925-933) AA- mutants ACII AA925 AA927 AA930 AA932

kDa

118

D 8 basal 7 forskolin 6 Gs THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204 5

0 Stage 2(a) POST-PRINT Figure 7

1200 ACII wt ACII.AA925 1000 ACII.AA927 ACII.AA930 800 ACII.AA932 600

400

200

0 0 1 10 100 1000 nM G B

1200

1000

800

600

400

200 THIS IS NOT THE FINAL VERSION - see doi:10.1042/BJ20071204

Stage 2(a) POST-PRINT Figure 8