Decorin-Induced Proliferation of Avian Myoblasts Involves the Myostatin/Smad Signaling Pathway

MOLECULAR, CELLULAR, AND DEVELOPMENTAL BIOLOGY

Decorin-induced proliferation of avian myoblasts involves the myostatin/Smad signaling pathway

Q. J. Zeng ,* 1 L. N. Wang ,* 1 G. Shu ,* S. B. Wang ,* X. T. Zhu ,* P. Gao ,* Q. Y. Xi ,* Y. L. Zhang ,* Z. Q. Zhang ,† and Q. Y. Jiang * 2

* College of Animal Science, ALLTECH-SCAU Animal Nutrition Control Research Alliance, South China Agricultural University, Guangzhou, Guangdong, 510642, P. R. China; and † Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education), Department of Cell Biology, Peking University Cancer Hospital & Institute, Beijing 100142, P. R. China

ABSTRACT Decorin, a small leucine-rich proteogly- sion of decorin enhanced the proliferation of QM7 myo- can as a component of the extracellular matrix, plays blasts, which was accompanied by the upregulation of an important role in the skeletal muscle development. follistatin and primary muscle regulatory factors (i.e., It has been reported that decorin promoted prolifera- myogenic factor 5, myogenic factor 1, myogenin), and tion and differentiation of muscle cells by restraining downregulation of myostatin expression, as well as the myostatin activity in rodents. However, the effects and decreased phosphorylation level of SMAD family mem- mechanisms of decorin on avian myoblast prolifera- ber 3 (Smad3). In line with expectations, decorin RNAi tion are not understood clearly. Thus, in our research, displayed an opposite effect on the proliferation and decorin overexpressing and knocking-down quail myo- gene expression pattern of QM7 cells. In conclusion, blast-7 (QM7) myoblasts were established to explore our in vitro studies suggested the decorin-mediated the effects of decorin on avian myoblast proliferation myostatin/Smad signaling pathway might be involved by flow cytometry. The results showed that overexpres- in the regulation of avian myoblast proliferation. Key words: QM7 myoblast, decorin , myostatin , cell proliferation, Smad3

2014 Poultry Science 93 :138–146 http://dx.doi.org/10.3382/ps.2013-03300

INTRODUCTION pressed in skeletal muscle during embryonic (chicken), fetal (chicken), and postnatal stages (turkey; Nishimura The growth and development of skeletal muscle is et al., 1997; Velleman et al., 1999; Velleman and Mc- a major concern for animal performance. Generally, Farland, 1999; Zagris et al., 2011). Previous studies re- muscle mass is positively correlated with the number vealed that gene transfer of decorin in vivo promotes of muscle fibers, which was mainly determined by the mice skeletal muscle regeneration and accelerates mus- proliferation of myoblasts in the embryo (Miller et al., cle healing after injury (Li et al., 2007). Furthermore, 1993). Previous research has demonstrated that the ex- decorin could promote the proliferation of C2C12 myo- tracellular matrix (ECM) could interact with growth blasts (Kishioka and Thomas, 2008) due to the interac- factors such as connective tissue growth factor (Vial et tion between decorin and the TGF-β superfamily (Hil- al., 2011), fibroblast growth factor (Rapraeger et al., debrand et al., 1994; Csordás et al., 2000; Schonherr et 1991), hepatocyte growth factor (Allen et al., 1995), al., 2005), and similar results were also found in chicken and transforming growth factor-β (TGF-β; Yamaguchi satellite cell (Li et al., 2008b). However, the effects and et al., 1990), which were involved in the regulation of mechanisms of decorin on avian myoblast proliferation skeletal muscle cell proliferation. have not been understood clearly. Decorin, which is an important component of ECM, Myostatin is a member of the TGF-β superfam- contains a central core protein and a chondroitin/der- ily and a negative regulator of skeletal muscle mass matan sulfate chain and belongs to the small leucine- (McPherron et al., 1997). A lack of myostatin in mice rich proteoglycan gene family (Krusius and Ruoslahti, caused a dramatic and widespread increase in skeletal 1986). It has been reported that decorin is highly ex- muscle mass (Szabó et al., 1998; Lin et al., 2002). Simi- lar to TGF-β1 signaling pathway, myostatin signaling © 2014 Poultry Science Association Inc. requires the phosphorylation of Smad2/3 and any in- Received May 9, 2013. hibition at this step would interrupt myostatin signal- Accepted october 12, 2013. 1 These authors contributed equally to this work. ing (Massagué et al., 2005; Forbes et al., 2006; Li et 2 Corresponding author: [email protected] al., 2008a). Research on mammalian myoblasts proved

138 DECORIN ENHANCES AVIAN MYOBLAST GROWTH 139 that the effects of decorin on the growth of C2C12 cells (Ministry of Education), Department of Cell Biology, were mainly mediated by suppressing myostatin activ- Peking University Cancer Hospital and Institute]. ity, along with the decreased Smad2 phosphate level (Kishioka and Thomas, 2008). However, it remains un- known whether decorin could regulate the myostatin/ Stable Transfection Smad signaling pathway in avian myoblasts. For pcDNA3.1(-)-Decorin and shRNA transfection, 1 Therefore, a myogenic cell line quail myoblast 7 × 104 cells per cm2 were plated in four 6-well plates and (QM7), derived from quail fibrosarcoma cell line QT6 transfected respectively with 2 µg of the pcDNA3.1(-) (Antin and Ordahl, 1991), was used in this study to -Decorin plasmid construct, 2 µg of the pcDNA3.1(-) generate the decorin overexpressing and knocking-down empty vectors, 4 µg of pGPU6/GFP/Neo-sh-Decorin QM7 myoblasts. The cell proliferation and the express- vectors, and 4 µg of pGPU6/GFP/Neo-sh-NC vectors ing level of follistatin, myogenic regulatory factors by GenEscort TMII (Wisegen, Nanjing, China) accord- (myogenic factor 5, Myf-5; myogenic factor 1, MyoD; ing to the manufacturer’s instructions. After 48 h of myogenin), and myostatin, as well as the downstream incubation, cells underwent 2 wk of selection with 800 SMAD family member 3 (Smad3) signaling pathway, µg/mL G418 (Sigma-Aldrich). After maintenance for 2 were detected to reveal the effects and the underlined wk in selection media, 4 types of single colonies were mechanisms of decorin on avian myoblast proliferation. expanded and maintained respectively in growth medium with 400 µg/mL of G418. MATERIALS AND METHODS Plasmid Construct Flow Cytometry The cells were cultured in a 6-well plate with density The decorin open reading frame corresponding to 136 4 2 to 1,209 bp of the chicken entry (NM_001030747.1) was of 1 × 10 cells per cm and collected after 48 and amplified by reverse-transcription PCR with normal 72 h, respectively, as previously described (Cheung et chicken gastrocnemius muscle total RNA as a template. al., 2013) with minor changes. Briefly, cells were de- Polymerase chain reaction was performed as follows: tached with a trypsin-EDTA (0.25% trypsin and 0.02% 94°C for 4 min; 35 cycles of 94°C for 20 s, 58°C for 40 s, EDTA) solution in PBS at 37°C for 3 min and collected and 72°C for 1 min; and 72°C for 10 min. The sequence by centrifugation for 5 min at 200 × g, washed in ice- of the forward primer was 5′-GGATTAAAAGGTTCT- cold PBS and centrifuged. Cells were then resuspended GCCTGGAGTT-3′, and that of the reverse primer was in 300 µL of PBS + 0.1% FBS, and fixed in 0.7 mL of 5′-TGAAATACAACCAAACCC-3′. The PCR product ice-cold 70% ethanol, then incubated for 1 h at 4°C. was cloned into the PCR2.1 vector (Invitrogen, Carls- After that, the fixed cells were carefully centrifuged at bad, CA) according to the manufacturer’s protocol. 200 × g and 4°C for 10 min, washed twice with 1 mL Decorin construct was then ligated into pcDNA3.1(-) of PBS, incubated with 50 µL of 5 g/mL DNase-free, vector (Invitrogen) to enable cell transfection and se- RNaseA at 37°C for 30 min, and stained with 5 mg/mL lection of stable integrants. The pcDNA3.1(-) empty of propidium iodide (keyGEN bioteck, Nanjing, China) vector was used as a control. Chemically synthesized for 30 min in the dark. Samples were analyzed for DNA pGPU6/GFP/Neo vectors containing short hairpin content by flow cytometer (FACS Calibur, BD Biosci- RNAi (sh-Decorin: 5′-GcagacaccaacattactatTCAAGA- ences, Franklin Lakes, NJ). The ModFit LT software GatagtaatgttggtgtctgcTT-3′) against decorin mRNA (Verity Software House, Topsham, ME) was used to (5′-GCAGACACCAACATTACTA-3′) sequence and model the cell cycle data (n = 3). pGPU6/GFP/Neo vectors containing negative control shRNA (sh-NC: 5′-GttctccgaacgtgtcacgtCAAGAGA- Total RNA Extraction and Reverse TTa cgtgacacgttcggagaaTT-3′) were purchased from Transcription Shanghai Genepharma Co. Ltd. (Shanghai, China). Total RNA was extracted from the cultured cells af- Cell Culture ter 24 h using Trizol reagent (Invitrogen, Carlsbad, CA) in accordance with the manufacturer’s protocol. The The myogenic cell line QM7 was cultured with M199 RNA quality was assessed by agarose gel electrophore- medium supplemented with 10% fetal bovine serum sis (1%). The RNA was quantified by a biophotometer (Gibco, Invitrogen, Carlsbad, CA), 0.5% chick embryo (Eppendorf, Hamburg, Germany). The isolated RNA extract, which was prepared according to the procedure has an optical density 260/optical density 280 (OD260/ of Weinstein and Jones (1956), 10% tryptose phosphate OD280) ratio of 1.8 to 2.0 when diluted into RNase-free (Sigma-Aldrich, St. Louis, MO), and 100 U/mL of pen- water. Reverse transcription was performed using 1 µg icillin-streptomycin at 37°C and 5% CO2 in a standard of total RNA and Moloney leukemia virus reverse tran- cell culture incubator (Shellab, Cornelius, OR). The scriptase (MMLV, Promega, Madison, WI) according QM7 cells were a gift from Z. Q. Zhang [Key Labo- to the manufacturer’s instructions. The reverse tran- ratory of Carcinogenesis and Translational Research scription conditions for the cDNA amplification were 140 Zeng et al. 65°C for 5 min, 37°C for 30 min, and 70°C for 15 min. mogenates were centrifuged at 14,000 × g and 4°C for Synthesis of the cDNA first strand was performed with 15 min, and the protein concentration in the superna- oligo-dT primer. tants was determined using a BCA Protein Assay Re- agent Kit (Pierce, Rockford, IL). Prestained molecular Quantitative Real-Time PCR weight markers (Invitrogen, Carlsbad, CA) were used to determine the molecular weight of proteins. The 100 A real-time PCR assay was performed using the µg of protein per sample was mixed with an equal vol- SYBR Green Real-time PCR Kit (Toyobo Co. Ltd., ume of gel loading buffer. The samples were separated Osaka, Japan) with Stratagene Mx3005P multiplex by electrophoresis at 80 V for 20 min and 120 V for quantitative PCR system (Agilent Technologies, Santa 100 min using Tris-glycine running buffer (0.025 mol/L Clara, CA) as described by the manufacturer. The PCR Tris base, 0.192 mol/L glycine, and 0.1% SDS, pH 8.3). reaction volume was 20 μL containing 1 μL of diluted The separated proteins were then transferred to PVDF cDNA, 10 μM of each primer, and 10 μL of SYBR Green membrane. Membranes were blocked with Tris-buffered Real-time PCR Master Mix (Toyobo Co. Ltd., Osaka, saline (20 mM Tris-HCl and 500 mM NaCl, pH 7.5; Japan). Primers were designed specifically for each TBS) containing 5% nonfat milk and 0.1% Tween-20 gene using Primer 5.0 software (Table 1). The 2−ΔΔCt at room temperature for 2 h. After being washed 6 method was used to analyze the quantitative real-time times with TBS containing 0.05% Tween-20 (TBST), (qRT) PCR data (Livak and Schmittgen, 2001). Glyc- the membrane was incubated with primary antibodies eraldehyde-3-phosphate dehydrogenase (GAPDH) overnight at 4°C with gentle agitation, then washed 3 was selected as a reference gene. No marked difference times in TBST for 5 min each. The membrane was of GAPDH mRNA abundance was detected between then incubated in the secondary anti-mouse horserad- groups. Moreover, for generating gene-specific standard ish peroxidase or anti-rabbit horseradish peroxidase curves, each gene’s cDNA product was serially diluted (Bioss, Beijing, China) at a concentration of 1:1,000 from 10−1 to 10−8 and was used as the PCR template for 1 h at room temperature. The primary antibod- for amplification efficiency detection. The primers were ies were the chicken anti-decorin (CB-1, Developmen- designed and optimized to achieve a similar efficiency tal Studies Hybridoma Bank at the University of Iowa, for the target and reference gene, the amplification ef- Iowa City; 1:500 in TBST), anti-MyoD (BD Pharmin- ficiency of both target genes and reference gene is close gen, San Diego, CA; 1:1,000 in TBST), anti-myogenin to 1 (95–99%). The amplification efficiency of all prim- (Santa Cruz Bio, Santa Cruz, CA; 1:500 in TBST), an- ers is in line with the requirements of 2−ΔΔCt method. ti-Smad3 (Millipore, Billerica, MA; 1:1,000 in TBST), anti-phospho-Smad3 (Cell Signaling Technologies, Dan- Western Blot Analysis vers, MA; 1:1,000 in TBST), and mouse anti-β-actin (Bioss, Beijing, China; 1:1,000 in TBST). All of the After cultured for 24 h, the transfected cells were ho- primary antibodies were diluted according to the man- mogenized using radio-immunoprecipitation assay lysis ufacturer’s instructions. Peroxidase activity was deter- buffer (100 mM Na4P2O4, 50 mM Tris-HCl, pH7.5, 150 mined by Super Signal West Pico Chemiluminescence mM NaCl, 1 mM EDTA, 1 mM phenylmethanesulfonyl Western blotting detection reagents (Thermo Scientific fluoride, 0.5% Triton X-100) containing protease and Pierce Protein Research Products, Rockford, IL), and phosphatase inhibitors (Invitrogen, Carlsbad, CA). Ho- the positive bands were detected by Fluorchem System

Table 1. Primer sequences for quantitative real-time PCR

GenBank Tm2 Product size Gene1 Primer sequence accession number (°C) (bp) Decorin 5′ AGTACCTAGTGGGTTGGGTGAAC 3′ (forward) NM_001030747.1 58 100 5′ GCCAAGAGGGCAAAAGTCGT 3′ (reverse) Myf-5 5′ GAGGAGGAGGCTGAAGAAAGTGAA 3′ (forward) NM_001030363.1 59 177 5′ TGTCCCGGCAGGTGATAGTAGTT 3′ (reverse) MyoD 5′ ACAGTGGAGCCCAGATTC 3′ (forward) NM_204214 59 93 5′ GCACTTGGTAGATTGGATTG 3′ (reverse) Myogenin 5′ GGAGAAGCGGAGGCTGAAGA 3′ (forward) NM_204184 60 130 5′ CAGGCGCTCGATGTACTGGAT 3′ (reverse) Follistatin 5′ AAGAACAGCCCGAACTTGAA 3′ (forward) NM_205200 58 90 5′ TTCCCTCGTAGGCTAATCCA 3′ (reverse) Myostatin 5′ TTGGATGGGACTGGATTA 3′ (forward) NM_00100146.1 60 120 5′ TGGGATTTGCTTGGTGTA 3′ (reverse) Smad3 5′ AGAACATCATCCC AGCGTCC 3′ (forward) NM_204475.1 56 197 5′ CGGCAGGTCAGGTCA ACA AC 3′ (reverse) GAPDH 5′ AGAACATCATCCC AGCGTCC 3′ (forward) NM_204305 60 133 5′ CGGCAGGTCAGGTCA ACA AC 3′ (reverse) 1Myf-5: myogenic factor 5; MyoD: myogenic factor 1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase. 2Tm: annealing temperature. DECORIN ENHANCES AVIAN MYOBLAST GROWTH 141

Figure 1. Overexpression and knocking-down of decorin in QM7 myoblasts. Decorin mRNA expression in decorin overexpressing cells and decorin knocking-down cells (A) was detected by quantitative real-time PCR (n = 6); protein level of decorin in decorin overexpressing cells and knocking-down cells (B and C) were measured by Western blot (n = 3). All results are representative of 3 separate experiments. The values are means ± SEM. The bars represent the SEM. Differences were significant at *P < 0.05 and **P < 0.01.

(ProteinSimple, Santa Clara, CA). The density of each (Figure 1A). Conversely, the pGPU6-shDecorin trans- band (n = 3) was measured using Image J software fected QM7 cells had a significantly lower (P < 0.05) (Bethesda, MD). expression level of decorin mRNA than the negative control (Figure 1A). The protein level of decorin, which Statistical Analysis was measured by Western blot analysis, showed the expression pattern was in concordance with that of deco- All cell culture experiments were independently re- rin mRNA (Figure 1B and C). peated at least 3 times. The data are represented as means ± SEM. A Student’s t-test was used to deter- Effects of Decorin Overexpressing mine any significant differences between 2 groups by the SPSS 17.0 statistical software (*P < 0.05; **P < and Knocking Down on the Proliferation 0.01; SPSS Inc., Chicago, IL). of QM7 Myoblasts The FACS analysis confirmed that decorin overex- RESULTS pressing caused a dramatic increase (P < 0.05) in the percentage of cells in the S phase, accompanied by a Generation of QM7 Myoblasts with Decorin significant decrease (P < 0.05) in the percentage of cells Overexpressing and Knocking Down in G0/G1-phase (Figure 2A). In contrast, knockdown of decorin led to a significant decrease (P < 0.05) in The pcDNA3.1(-)-decorin transfected QM7 cells had the percentage of cells in the S phase (Figure 2D), ac- an approximately 10-fold increase (P < 0.01) in the companied by an increase (P < 0.05) in the percentage decorin mRNA expression compared with the control of cells in G2/M-phase (Figure 2F). 142 Zeng et al.

Figure 2. The effects of decorin on the cell cycle of QM7 myoblasts. Statistical analysis of the percentage of cell number in G0/G1, S, and G2/M phase at the 2 time points: (A, C, E), decorin overexpressing cells compared with control cells; (B, D, F), decorin knocking-down compared with control cells. All results are representative of 3 separate experiments. The values are means ± SEM (n = 3). Differences were significant at *P < 0.05.

Effect of Decorin on Expression pressing cells (Figure 3A); western blot analysis demon- of Myogenic Regulatory Factors strated the protein expression of MyoD and myogenin in decorin overexpressing cells was significantly higher The mRNA expression of Myf-5 and myogenin were (P < 0.05) than that in the control (Figure 3B and C). significantly upregulated (P < 0.05) in decorin overex- On the contrary, there was a decrease (P < 0.05) in the DECORIN ENHANCES AVIAN MYOBLAST GROWTH 143 mRNA expression of myogenin (Figure 3A) and protein expression of Myod and myogenin (Figure 3B and C) when decorin was knocked down, whereas no effect was observed on the Myf-5 mRNA level (Figure 3A).

Effect of Decorin on Myostatin Expression and Smad3 Signaling Pathway Decorin overexpressing cells exhibited an increased (P < 0.05) mRNA expression of follistatin that is known to antagonize the function of myostatin (Figure 4A). On the contrary, there was a decrease (P < 0.05) in the mRNA expression of follistatin accompanied by an increased (P < 0.05) mRNA expression of myostatin when decorin was knocked down (Figure 4B). Although there was no change in the mRNA and protein expression of Smad3, the phosphorylation level of Smad3 was decreased (P < 0.05) in decorin overexpressing cells (Figure 4C and E), but increased (P < 0.05) in decorin knocking-down cells (Figure 4C and D).

DISCUSSION Decorin, as a component of ECM, was shown to be required to maintain committed skeletal muscle cell population in vivo (Olguin and Brandan, 2002). Mean- while, the expression of decorin was markedly increased at the regenerative stage of X chromosome-linked muscular dystrophy mice compared with early stages (Abe et al., 2009). Moreover, in vitro study also demonstrated that stable transfection and overexpression of decorin enhanced the proliferation of C2C12 cells, as well as chicken satellite cells (Kishioka and Thomas, 2008). The results of Cell Counting Kit-8 assay (data Figure 3. Effects of decorin on the expression of myogenic genes not shown) and FACS analysis (Figure 2) in our study in QM7 myoblasts. Relative levels of Myf-5, MyoD, and myogenin in were consistent with most previous reports, which con- decorin overexpressing cells and decorin knocking-down cells (A) were firmed that decorin was an important positive regula- measured by quantitative real-time PCR (n = 6). The overexpres- tory factor in the regulation of avian skeletal muscle sion and knocking-down of decorin (C) influenced the protein level of myogenic factors (MyoD, myogenin), as shown by Western blot results (QM7) myoblast proliferation. (n = 3).The band quantitative data were provided (B). All results are Myostatin is one of the most important inhibitor of representative of 3 separate experiments. Bars are the means ± SEM. myoblast proliferation (Thomas et al., 2000). It has been Differences were significant at *P < 0.05 and **P < 0.01. reported that decorin could directly bind to myostatin molecules to block myostatin-mediated inhibition of 2009). It has been shown that Smad3 is the key media- proliferation of C2C12 myoblasts (Miura et al., 2006). tor of myostatin inhibition of myogenesis (Zhu et al., Some reports also indicated that follistatin could an- 2004) and the phosphorylation level of Smad3 was ef- tagonize myostatin by direct protein interaction, which fective to reflect the bioactivity of myostatin in skeletal prevents myostatin from executing its inhibitory effect muscle cells (Li et al., 2008c). Kishioka and Thomas on muscle development (Lee and McPherron, 2001; (2008) found that myostatin induced the Smad2 phos- Amthor et al., 2004). Our study showed that decorin phorylation in C2C12 cells was less in the overexpres- could downregulate the mRNA expression of myostatin sion of decorin. To better understand the effects of and upregulate the mRNA expression of follistatin. decorin on myostatin activity, we further detected the These results suggested that, in addition to direct bind- phosphorylation of Smad3 by Western blot. The results ing to myostatin, decorin-regulated transcription of fol- showed that phosphor-Smad3 was significantly reduced listatin might also participate in decorin-induced avian in decorin overexpressing cells; the reverse is true in myoblast proliferation. decorin knocking-down cells. Therefore, it is reasonable The effects of myostatin require both phosphoryla- to propose that the Smad signaling pathway may be in- tion of Smad2 and Smad3, which block muscle differ- volved in decorin-induced regulation of avian myoblasts entiation during muscle atrophy (Trendelenburg et al., proliferation. 144 Zeng et al.

Figure 4. Effects of decorin on the myostatin signaling pathway. Relative levels of myostatin, follistatin, Smad3 in decorin overexpressing cells (A), and decorin knocking-down cells (B) were measured by quantitative real-time PCR (n = 6). The overexpression and knocking-down of decorin influenced myostatin signal transduction pathway, as shown (C) by Western blot results (n = 3). (D, E): Relative p-Smad3 levels were determined by scanning densitometry of the blots and normalized to total Smad3 levels. All results are representative of 3 separate experiments. Bars are the means ± SEM. Differences were significant at *P < 0.05 and **P < 0.01. DECORIN ENHANCES AVIAN MYOBLAST GROWTH 145 The muscle regulatory factors (MRF) are essential gram of China–the 973 Program (no. 2009CB941601; transcriptional regulatory proteins in regulating myo- Beijing), and the Research Fund for the Doctoral Pro- blast proliferation. Joulia et al. (2003) reported that gram of Higher Education (no. 20114404120001; Bei- myostatin overexpression reduced MyoD and myogenin jing). We specially thank Z. Q. Zhang [Key Laboratory protein levels during proliferation and differentiation of Carcinogenesis and Translational Research (Minis- in C2C12 myoblasts. In our study, decorin enhanced try of Education), Department of Cell Biology, Peking the proliferation of QM7 myoblasts accompanied by University Cancer Hospital and Institute] for kindly upregulated expression of MRF (i.e., Myf-5, MyoD, providing the QM-7 cell line and W. Zhao [Key Labo- myogenin), which might be attributed to the decrease ratory of Carcinogenesis and Translational Research of phospho-Smad3. It has been demonstrated that the (Ministry of Education), Department of Cell Biology, MRF were the targets of Smad signaling (Martin et al., Peking University Cancer Hospital and Institute] for 1992). Myostatin activates Smad2 and Smad3 through his help in cell culture. carboxy-terminal phosphorylation, and then they will bind with Smad4 to form hetero-oligomers. This Smad complex subsequently interacts with the basic helix- REFERENCES loop-helix region of all MRF to decrease their DNA transcriptional activity (Martin et al., 1992; Liu et al., Abe, S., D. Hirose, S. Kado, O. Iwanuma, H. Saka, N. Yanagisawa, and Y. Ide. 2009. Increased expression of decorin during the re- 2001). generation stage of mdx mouse. Anat. Sci. Int. 84:305–311. Interestingly, decorin may also regulate the growth Allen, R. E., S. M. Sheehan, R. G. Taylor, T. L. Kendall, and G. M. of avian myoblasts by several mechanisms. Li et al. Rice. 1995. Hepatocyte growth factor activates quiescent skeletal (2008b) reported that decorin regulated the effect of muscle satellite cells in vitro. J. Cell. Physiol. 165:307–312. Amthor, H., G. Nicholas, I. McKinnell, C. F. Kemp, M. Sharma, R. TGF-β1 on cell proliferation and differentiation of chick- Kambadur, and K. Patel. 2004. Follistatin complexes myostatin en satellites cell by regulating cellular responsiveness to and antagonises myostatin-mediated inhibition of myogenesis. TGF-β1. Thus, TGF-β1 can be considered as another Dev. Biol. 270:19–30. candidate target for decorin in QM7 cells. Furthermore, Antin, P. B., and C. P. Ordahl. 1991. Isolation and characterization of an avian myogenic cell line. Dev. Biol. 143:111–121. Cabello-Verrugio and Brandan (2007) reported that an Cabello-Verrugio, C., and E. Brandan. 2007. A novel modulatory endocytosis receptor protein, low-density lipoprotein mechanism of transforming growth factor-beta signaling through receptor-related protein-1, participates in the regula- decorin and LRP-1. J. Biol. Chem. 282:18842–18850. tion of TGF-β1 response through PI3K pathway, which Cheung, V., S. Bouralexis, and M. T. Gillespie. 2013. PTHrP overexpression increases sensitivity of breast cancer cells to Apo2L/ was dependent on the presence of decorin. Additionally, TRAIL. PLoS ONE 8:e66343. decorin was reported to promote myoblast proliferation Csordás, G., M. Santra, C. C. Reed, I. Eichstetter, D. J. McQuillan, mediated by an endoplasmic reticulum stress-related D. Gross, M. A. Nugent, G. Hajnóczky, and R. V. Iozzo. 2000. pathway in duck myoblasts (Sun et al., 2013). The low- Sustained down-regulation of the epidermal growth factor receptor by decorin a mechanism for controlling tumor growth in vivo. density lipoprotein receptor-related protein-1-mediated J. Biol. Chem. 275:32879–32887. PI3K pathway and endoplasmic reticulum stress-relat- Forbes, D., M. Jackman, A. Bishop, M. Thomas, R. Kambadur, ed pathway may be involved in decorin-dependent in- and M. Sharma. 2006. Myostatin auto-regulates its expression by feedback loop through Smad7 dependent mechanism. J. Cell. hibition of Smad3 phosphorylation. Therefore, further Physiol. 206:264–272. investigation is needed to interpret the precise mecha- Hildebrand, A., M. Romaris, L. Rasmussen, D. Heinegård, D. nisms involved in decorin-mediated signaling pathways Twardzik, W. Border, and E. Ruoslahti. 1994. Interaction of the in the proliferation of avian myoblasts. small interstitial proteoglycans biglycan, decorin and fibromodu- lin with transforming growth factor beta. Biochem. J. 302:527– In summary, the overexpression of decorin in QM7 534. myoblasts significantly increased cell proliferation, Joulia, D., H. Bernardi, V. Garandel, F. Rabenoelina, B. Vernus, simultaneously increased the expressing level of fol- and G. Cabello. 2003. Mechanisms involved in the inhibition of listatin and myogenic regulatory factors (Myf-5, MyoD, myoblast proliferation and differentiation by myostatin. Exp. Cell Res. 286:263–275. myogenin), but downregulated the mRNA expressing Kishioka, Y., and M. Thomas. 2008. Decorin enhances the prolif- level of myostatin, as well as the decreased phosphory- eration and differentiation of myogenic cells through suppressing lation level of Smad3, compared with the control cells. myostatin activity. J. Cell. Physiol. 215:856–867. Consistent with this result, knocking-down decorin ex- Krusius, T., and E. Ruoslahti. 1986. Primary structure of an extracellular matrix proteoglycan core protein deduced from cloned pression decreased cell proliferation, which suggests the cDNA. Proc. Natl. Acad. Sci. USA 83:7683–7687. decorin-mediated myostatin/Smad signaling pathway Lee, S. J., and A. C. McPherron. 2001. Regulation of myostatin ac- might be involved in the regulation of avian myoblast tivity and muscle growth. Proc. Natl. Acad. Sci. USA 98:9306– proliferation. 9311. Li, X., D. C. McFarland, and S. G. Velleman. 2008a. Effect of Smad3-mediated transforming growth factor-beta1 signaling on satellite cell proliferation and differentiation in chickens. Poult. ACKNOWLEDGMENTS Sci. 87:1823–1833. Li, X., D. C. McFarland, and S. G. Velleman. 2008b. Extracellu- This work was supported by the National Natural Sci- lar matrix proteoglycan decorin-mediated myogenic satellite ence Foundation for the Young Scholars of China (no. cell responsiveness to transforming growth factor-beta1 during 31101780; Beijing), the National Basic Research Pro- cell proliferation and differentiation Decorin and transforming 146 Zeng et al.

growth factor-beta1 in satellite cells. Domest. Anim. Endocrinol. Schonherr, E., C. Sunderkotter, R. V. Iozzo, and L. Schaefer. 2005. 35:263–273. Decorin, a novel player in the insulin-like growth factor system. Li, Y., J. Li, J. Zhu, B. Sun, M. Branca, Y. Tang, W. Foster, J. Biol. Chem. 280:15767–15772. X. Xiao, and J. Huard. 2007. Decorin gene transfer promotes Sun, L., K. Lu, H. Liu, H. Wang, X. Li, C. Yang, L. Li, and J. Wang. muscle cell differentiation and muscle regeneration. Mol. Ther. 2013. The effects of endoplasmic reticulum stress response on 15:1616–1622. duck decorin stimulate myotube hypertrophy in myoblasts. Mol. Li, Z. B., H. D. Kollias, and K. R. Wagner. 2008c. Myostatin directly Cell. Biochem. 377:151–161. regulates skeletal muscle fibrosis. J. Biol. Chem. 283:19371– Szabó, G., G. Dallmann, G. Muller, L. Patthy, M. Soller, and L. 19378. Varga. 1998. A deletion in the myostatin gene causes the com- Lin, J., H. B. Arnold, M. A. Della-Fera, M. J. Azain, D. L. Hartzell, pact (Cmpt) hypermuscular mutation in mice. Mamm. Genome and C. A. Baile. 2002. Myostatin knockout in mice increases 9:671–672. myogenesis and decreases adipogenesis. Biochem. Biophys. Res. Thomas, M., B. Langley, C. Berry, M. Sharma, S. Kirk, J. Bass, and Commun. 291:701–706. R. Kambadur. 2000. Myostatin, a negative regulator of muscle Liu, D., B. L. Black, and R. Derynck. 2001. TGF-β inhibits muscle growth, functions by inhibiting myoblast proliferation. J. Biol. differentiation through functional repression of myogenic tran- Chem. 275:40235–40243. scription factors by Smad3. Genes Dev. 15:2950–2966. Trendelenburg, A. U., A. Meyer, D. Rohner, J. Boyle, S. Hatakeya- Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene ma, and D. J. Glass. 2009. Myostatin reduces Akt/TORC1/ expression data using real-time quantitative PCR and the 2 (− p70S6K signaling, inhibiting myoblast differentiation and myo- Delta Delta C(T)) method. Methods 25:402–408. tube size. Am. J. Physiol. Cell Physiol. 296:C1258–C1270. Martin, J. F., L. Li, and E. N. Olson. 1992. Repression of myogenin Velleman, S. G., X. Liu, K. H. Eggen, and K. E. Nestor. 1999. function by TGF-beta 1 is targeted at the basic helix-loop-he- Developmental regulation of proteoglycan synthesis and decorin lix motif and is independent of E2A products. J. Biol. Chem. expression during turkey embryonic skeletal muscle formation. 267:10956–10960. Poult. Sci. 78:1619–1626. Massagué, J., J. Seoane, and D. Wotton. 2005. Smad transcription Velleman, S. G., and D. C. McFarland. 1999. Myotube morphology, factors. Genes Dev. 19:2783–2810. and expression and distribution of collagen type I during nor- McPherron, A. C., A. M. Lawler, and S. J. Lee. 1997. Regulation mal and low score normal avian satellite cell myogenesis. Dev. of skeletal muscle mass in mice by a new TGF-beta superfamily Growth Differ. 41:153–161. member. Nature 387:83–90. Vial, C., J. Gutiérrez, C. Santander, D. Cabrera, and E. Brandan. Miller, J. B., E. A. Everitt, T. H. Smith, N. E. Block, and J. A. 2011. Decorin interacts with connective tissue growth factor Dominov. 1993. Cellular and molecular diversity in skeletal (CTGF)/CCN2 by LRR12 inhibiting its biological activity. J. muscle development: News from in vitro and in vivo. Bioessays Biol. Chem. 286:24242–24252. 15:191–196. Weinstein, P. P., and M. F. Jones. 1956. The in vitro cultivation of Miura, T., Y. Kishioka, J. Wakamatsu, A. Hattori, A. Hennebry, Nippostrongylus muris to the adult stage. J. Parasitol. 42:215– C. J. Berry, M. Sharma, R. Kambadur, and T. Nishimura. 2006. 236. Decorin binds myostatin and modulates its activity to muscle Yamaguchi, Y., D. M. Mann, and E. Ruoslahti. 1990. Negative regu- cells. Biochem. Biophys. Res. Commun. 340:675–680. lation of transforming growth factor-β by the proteoglycan deco- Nishimura, T., K. Ojima, A. Hattori, and K. Takahashi. 1997. De- rin. Nature 346:281–284. velopmental expression of extracellular matrix components in in- Zagris, N., K. Gilipathi, N. Soulintzi, and K. Konstantopoulos. 2011. tramuscular connective tissue of bovine semitendinosus muscle. Decorin developmental expression and function in the early avian Histochem. Cell Biol. 107:215–221. embryo. Int. J. Dev. Biol. 55:633–639. Olguin, H., and E. Brandan. 2002. Decorin is required to maintain Zhu, X., S. Topouzis, L. Liang, and R. L. Stotish. 2004. Myostatin committed skeletal muscle cell population grouped allowing nor- signaling through Smad2, Smad3 and Smad4 is regulated by the mal differentiation in vivo. Mol. Biol. Cell 13:341a. inhibitory Smad7 by a negative feedback mechanism. Cytokine Rapraeger, A. C., A. Krufka, and B. B. Olwin. 1991. Requirement of 26:262–272. heparan sulfate for bFGF-mediated fibroblast growth and myoblast differentiation. Science 252:1705–1708.