ERRα Antagonist Suppresses Breast Cancer Growth
SUPPLEMENTARY DATA
An Estrogen-Related Receptor α-Specific Antagonist Inhibits Breast Tumor Growth in Both ER-positive and ER-negative Mouse Xenografts
Michael J. Chisamore1,2, Hilary A. Wilkinson1¶, Osvaldo Flores1, J. Don Chen2¶
1Department of Molecular Endocrinology, Merck Research Laboratories, West Point, Pennsylvania, 2Department of Pharmacology, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey
Fig. S1
Gene Symbol Description Public Ref Seq ACADM acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain NM_000016.2 ACSL5 acyl-CoA synthetase long-chain family member 5 NM_203379.1 ACSS2 acyl-CoA synthetase short-chain family member 2 NM_018677.2 ACTB actin, beta NM_001101.2 ADCYAP1 adenylate cyclase activating polypeptide 1 (pituitary) NM_001117.2 ADRB3 adrenergic, beta-3-, receptor NM_000025.1 ALAD aminolevulinate, delta-, dehydratase NM_001003945.1 ANKRD11 ankyrin repeat domain 11 NM_013275.4 APC adenomatosis polyposis coli NM_000038.3 APOA4 apolipoprotein A-IV NM_000482.3 B2M beta-2-microglobulin NM_004048.2 BCAR1 breast cancer anti-estrogen resistance 1 NM_014567.2 BCAR3 breast cancer anti-estrogen resistance 3 NM_003567.2 BRCA1 breast cancer 1, early onset NM_007294.2 BRMS1 breast cancer metastasis suppressor 1 NM_015399.3 CARM1 coactivator-associated arginine methyltransferase 1 NM_199141.1 CASP8 caspase 8, apoptosis-related cysteine peptidase NM_033355.2 CCL7 chemokine (C-C motif) ligand 7 NM_006273.2 CD44 CD44 antigen (Indian blood group) NM_000610.3 CD82 CD82 antigen NM_001024844.1 CDH1 cadherin 1, type 1, E-cadherin (epithelial) NM_004360.2 CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) NM_058195.2 CEBPB CCAAT/enhancer binding protein (C/EBP), beta NM_005194.2 CEBPG CCAAT/enhancer binding protein (C/EBP), gamma NM_001806.2 CH25H cholesterol 25-hydroxylase NM_003956.3 CKMT2 creatine kinase, mitochondrial 2 (sarcomeric) NM_001825.1 CRAT carnitine acetyltransferase NM_144782.1 CREM cAMP responsive element modulator NM_181571.1 CTBP1 C-terminal binding protein 1 NM_001328.2 CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa NM_001903.2 CTSK cathepsin K (pycnodysostosis) NM_000396.2 CXCL12 chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) NM_199168.1 CXCR4 chemokine (C-X-C motif) receptor 4 NM_001008540.1 CYCS cytochrome c, somatic NM_018947.4 CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1, aromatase NM_031226.1 1 ERRα Antagonist Suppresses Breast Cancer Growth
Gene Symbol Description Public Ref Seq CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 NM_000104.2 DAPK1 death-associated protein kinase 1 NM_004938.1 DCC deleted in colorectal carcinoma NM_005215.1 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 NM_024072.3 EBAG9 estrogen receptor binding site associated, antigen, 9 NM_198120.1 ECH1 enoyl Coenzyme A hydratase 1, peroxisomal NM_001398.2 EGF epidermal growth factor (beta-urogastrone) NM_001963.2 ELF3 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) NM_004433.3 ELOVL3 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 NM_152310.1 EPHB2 EPH receptor B2 NM_017449.2 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 NM_001005862.1 ERG v-ets erythroblastosis virus E26 oncogene like (avian) NM_182918.2 ESR1 estrogen receptor 1, (ER alpha) NM_000125.2 ESR2 estrogen receptor 2 (ER beta) NM_001437.1 ESRRA estrogen-related receptor alpha, (ERR alpha) NM_004451.3 ESRRG estrogen-related receptor gamma, (ERR gamma) NM_206594.1 ETV4 ets variant gene 4 (E1A enhancer binding protein, E1AF) NM_001986.1 FASN fatty acid synthase NM_004104.4 FAT FAT tumor suppressor homolog 1 (Drosophila) NM_005245.2 FGF2 fibroblast growth factor 2 (basic) NM_002006.3 FGFR4 fibroblast growth factor receptor 4 NM_213647.1 FN1 fibronectin 1 NM_212474.1 FOLH1 folate hydrolase (prostate-specific membrane antigen) 1 NM_001014986.1 FOLR2 folate receptor 2 (fetal) NM_000803.2 FOS v-fos FBJ murine osteosarcoma viral oncogene homolog NM_005252.2 FOXO1A forkhead box O1A (rhabdomyosarcoma) NM_002015.2 FSHB follicle stimulating hormone, beta polypeptide NM_001018080.1 FSHR follicle stimulating hormone receptor NM_181446.1 FXYD5 FXYD domain containing ion transport regulator 5 NM_144779.1 GABARAPL1 GABA(A) receptor-associated protein like 1 NM_031412.2 GAMT guanidinoacetate N-methyltransferase NM_000156.4 GAPDH glyceraldehyde-3-phosphate dehydrogenase NM_002046.2 GHRH growth hormone releasing hormone NM_021081.3 GNL3 guanine nucleotide binding protein-like 3 (nucleolar) NM_206825.1 GNRH1 gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) NM_000825.2 GTF2H1 general transcription factor IIH, polypeptide 1 NM_005316.2 GUSB glucuronidase, beta NM_000181.1 HDAC6 histone deacetylase 6 NM_006044.2 HDAC9 histone deacetylase 9 NM_178423.1 HGF hepatocyte growth factor (hepapoietin A; scatter factor) NM_001010931.1 HIST1H1C histone cluster 1, H1c NM_005319.3 HMBS hydroxymethylbilane synthase NM_000190.3 HMGA1 high mobility group AT-hook 1 NM_145904.1 HMGB1 high-mobility group box 1 NM_002128.3 HMGB2 high-mobility group box 2 NM_002129.2 HPSE heparanase NM_006665.2 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog NM_005343.2 HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 NM_002153.1 HSD17B8 hydroxysteroid (17-beta) dehydrogenase 8 NM_014234.3 HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NM_000862.2 HSPB8 heat shock 22kDa protein 8 NM_014365.2
2 ERRα Antagonist Suppresses Breast Cancer Growth
Gene Symbol Description Public Ref Seq HTATIP2 HIV-1 Tat interactive protein 2, 30kDa NM_006410.3 IGF1 insulin-like growth factor 1 (somatomedin C) NM_000618.2 IL18 interleukin 18 (interferon-gamma-inducing factor) NM_001562.2 IL1A interleukin 1, alpha NM_000575.3 IL1B interleukin 1, beta NM_000576.2 INHA inhibin, alpha NM_002191.2 ISG20 interferon stimulated exonuclease gene 20kDa NM_002201.4 ISGF3G interferon-stimulated transcription factor 3, gamma NM_006084.4 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) NM_000212.2 KISS1 KiSS-1 metastasis-suppressor NM_002256.2 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog NM_004985.3 LAMB1 laminin, beta 1 NM_002291.1 LHCGR luteinizing hormone/choriogonadotropin receptor NM_000233.1 LTF lactotransferrin NM_002343 LYPD3 LY6/PLAUR domain containing 3 (C4.4A) NM_014400.1 MCAM melanoma cell adhesion molecule NM_006500.2 MET met proto-oncogene (hepatocyte growth factor receptor) NM_000245.2 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase NM_002410.2 MKNK2 MAP kinase interacting serine/threonine kinase 2 NM_199054.1 MMP1 matrix metallopeptidase 1 (interstitial collagenase) NM_002421.2 MMP10 matrix metallopeptidase 10 (stromelysin 2) NM_002425.1 MMP14 matrix metallopeptidase 14 (membrane-inserted) NM_004995.2 MMP2 matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) NM_004530.1 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) NM_002422.2 MMP7 matrix metallopeptidase 7 (matrilysin, uterine) NM_002423.2 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) NM_004994.1 MORF4L2 mortality factor 4 like 2 NM_012286.1 MPG N-methylpurine-DNA glycosylase NM_002434.2 MTA1 metastasis associated 1 NM_004689.2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate MTHFD2 NM_001040409.1 cyclohydrolase MTSS1 metastasis suppressor 1 NM_014751.2 MYC v-myc myelocytomatosis viral oncogene homolog (avian) NM_002467.3 NCAM1 neural cell adhesion molecule 1 NM_181351.1 NCOA1 nuclear receptor coactivator 1, (SRC-1) NM_147223.2 NCOA2 nuclear receptor coactivator 2 NM_006540.2 NCOA3 nuclear receptor coactivator 3, (AIB1), (RAC-3) NM_181659.1 NCOA5 nuclear receptor coactivator 5 NM_020967.2 NCOA6 nuclear receptor coactivator 6 NM_014071.2 NCOA7 nuclear receptor coactivator 7 NM_181782.2 NCOR1 nuclear receptor co-repressor 1 NM_006311.2 NCOR2 nuclear receptor co-repressor 2 NM_001077261.1 NF2 neurofibromin 2 (bilateral acoustic neuroma) NM_181832.1 NFATC4 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 NM_004554.3 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) NM_003998.2 NME1 non-metastatic cells 1, protein (NM23A) expressed in NM_198175.1 NOS3 nitric oxide synthase 3 (endothelial cell) NM_000603.3 NR0B2 nuclear receptor subfamily 0, group B, member 2 NM_021969.1 NR1I3 nuclear receptor subfamily 1, group I, member 3 NM_005122.2 NR2C2 nuclear receptor subfamily 2, group C, member 2 NM_003298.2 NR4A3 nuclear receptor subfamily 4, group A, member 3 NM_173198.1
3 ERRα Antagonist Suppresses Breast Cancer Growth
Gene Symbol Description Public Ref Seq NR6A1 nuclear receptor subfamily 6, group A, member 1 NM_033334.2 NRG1 neuregulin 1 NM_013956.1 NRIP1 nuclear receptor interacting protein 1 NM_003489.2 OVGP1 oviductal glycoprotein 1, 120kDa (mucin 9, oviductin) NM_002557.3 PDK4 pyruvate dehydrogenase kinase, isozyme 4 NM_002612.3 PECAM1 platelet/endothelial cell adhesion molecule (CD31 antigen) NM_000442.2 PELP1 proline-, glutamic acid-, leucine-rich protein 1 NM_014389.1 PGR progesterone receptor, (PR) NM_000926.2 PHB2 prohibitin 2 NM_007273.3 PLAGL1 pleiomorphic adenoma gene-like 1 NM_002656.2 PLG plasminogen NM_000301.1 PNN pinin, desmosome associated protein NM_002687.2 POU2AF1 POU domain, class 2, associating factor 1 NM_006235.1 POU4F1 POU domain, class 4, transcription factor 1 NM_006237.2 POU4F2 POU domain, class 4, transcription factor 2 NM_004575.1 PPARA peroxisome proliferative activated receptor, alpha, (PPAR alpha) NM_032644.3 PPARGC1A peroxisome proliferative activated receptor, gamma, coactivator 1, alpha, (PGC-1 alpha) NM_013261.2 PPARGC1B peroxisome proliferative activated receptor, gamma, coactivator 1, beta, (PGC-1 beta) NM_133263.2 PPID peptidylprolyl isomerase D (cyclophilin D) NM_005038.2 PSCA prostate stem cell antigen NM_005672.2 PTEN phosphatase and tensin homolog (mutated in multiple advanced cancers 1) NM_000314.2 PTGDS prostaglandin D2 synthase 21kDa (brain) NM_000954.5 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) NM_000963.1 RB1 retinoblastoma 1 (including osteosarcoma) NM_000321.1 RBM9 RNA binding motif protein 9 NM_001031695.1 RERG RAS-like, estrogen-regulated, growth inhibitor NM_032918.1 ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung RET NM_020630.3 disease) RHOC ras homolog gene family, member C NM_175744.3 RLN1 relaxin 1 NM_006911.2 S100A4 S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) NM_002961.2 SAFB scaffold attachment factor B NM_002967.2 SAFB2 scaffold attachment factor B2 NM_014649.1 SCD5 stearoyl-CoA desaturase 5 NM_024906.1 SERPINB5 serpin peptidase inhibitor, clade B (ovalbumin), member 5 NM_002639.2 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 NM_000602.1 SET SET translocation (myeloid leukemia-associated) NM_003011.1 SMAD2 SMAD, mothers against DPP homolog 2 (Drosophila) NM_001003652.1 SMAD4 SMAD, mothers against DPP homolog 4 (Drosophila) NM_005359.3 SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 NM_003072.2 SNCG synuclein, gamma (breast cancer-specific protein 1) NM_003087.1 SPP1 secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1) NM_001040058.1 SRD5A2 steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2) NM_000348.2 SREBF1 sterol regulatory element binding transcription factor 1 NM_004176.3 SSTR2 somatostatin receptor 2 NM_001050.2 STS steroid sulfatase (microsomal), arylsulfatase C, isozyme S NM_000351.3 SULT1E1 sulfotransferase family 1E, estrogen-preferring, member 1 NM_005420.2 SULT2A1 sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 NM_003167.2 SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) NM_003169.2 SYK spleen tyrosine kinase NM_003177.3 TACSTD1 tumor-associated calcium signal transducer 1 NM_002354.1
4 ERRα Antagonist Suppresses Breast Cancer Growth
Gene Symbol Description Public Ref Seq TADA3L transcriptional adaptor 3 (NGG1 homolog, yeast)-like NM_133480.1 TAF10 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa NM_006284.2 TCF20 transcription factor 20 (AR1) NM_181492.1 TCF7 transcription factor 7 (T-cell specific, HMG-box) NM_201633.1 TFF1 trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in), pS2 NM_003225.2 TFRC transferrin receptor (p90, CD71) NM_003234.1 TG thyroglobulin NM_003235.4 TGFB1 transforming growth factor, beta 1 (Camurati-Engelmann disease) NM_000660.3 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) NM_001024847.1 THRA thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) NM_199334.2 THRB thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian) NM_000461.2 TIAM1 T-cell lymphoma invasion and metastasis 1 NM_003253.1 TIMP1 TIMP metallopeptidase inhibitor 1 NM_003254.1 TIMP2 TIMP metallopeptidase inhibitor 2 NM_003255.3 TIMP4 TIMP metallopeptidase inhibitor 4 NM_003256.2 TMPRSS4 transmembrane protease, serine 4 NM_019894.2 TNF tumor necrosis factor (TNF superfamily, member 2) NM_000594.2 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 NM_003810.2 TOB1 transducer of ERBB2, 1 NM_005749.2 TP53 tumor protein p53 (Li-Fraumeni syndrome) NM_000546.2 TPBG trophoblast glycoprotein NM_006670.3 TRIM16 tripartite motif-containing 16 NM_006470.3 TRIM25 tripartite motif-containing 25 NM_005082.4 TSHR thyroid stimulating hormone receptor NM_000369.2 TSKU tsukushin NM_015516.3 TWIST1 twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila) NM_000474.3 UBC ubiquitin C NM_021009.3 UCP1 uncoupling protein 1 (mitochondrial, proton carrier) NM_021833.3 UGT1A3 UDP glucuronosyltransferase 1 family, polypeptide A3 NM_019093.2 UGT1A8 UDP glucuronosyltransferase 1 family, polypeptide A8 NM_019076.4 UGT2A1 UDP glucuronosyltransferase 2 family, polypeptide A1 NM_006798.1 UGT2B15 UDP glucuronosyltransferase 2 family, polypeptide B15 NM_001076.1 UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4 NM_021139.1 UGT2B7 UDP glucuronosyltransferase 2 family NM_001074.1 VEGFA vascular endothelial growth factor A NM_001025366.1 VEGFC vascular endothelial growth factor C NM_005429.2 VIP vasoactive intestinal peptide NM_194435.1 WISP1 WNT1 inducible signaling pathway protein 1 NM_080838.1 XDH xanthine dehydrogenase NM_000379.3 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide NM_003406.2
Fig. S1. Gene symbols, descriptions, and accession numbers (Public Ref. Seq.) of 226 genes known to be involved in ER, cancer, and ERR〈 signaling that were assayed using Low Density Arrays (Applied Biosystems). Genes that were also assayed in mouse xenograft uteri (see Fig. S2) are shown in bold.
5 ERRα Antagonist Suppresses Breast Cancer Growth
Fig. S2
Fig. S2. Relative gene expression and ERRα signaling in mouse uteri treated with the ERRα antagonist Compound A. (A) Relative gene fold expression from MCF-7 xenograft mouse uterine treated with 15 MPK Compound A for 9 weeks or BT-20 xenograft mouse uterine treated with 30 MPK Compound A for 12 weeks are reported. The 46 genes known to be involved in ERRα signaling (shown in bold in Fig. S1) were assayed using TaqMan Low Density Custom Array cards (Applied Biosystems). Comparison of relative gene expression (vehicle vs. treatment for both MCF-7 and BT-20 xenograft experiments) was done using ANOVA followed by a student t-test with a 0.05 significance level. Relative gene expression values (18 genes in total) that were down-regulated > -1.2 and had a P value < 0.05 are reported. (B) Signaling pathway affected by Compound A in uterus. Ingenuity Pathway Analysis (Ingenuity® Systems) was used to model a potential signaling network involving ERRα in the xenograft mouse uteri. Genes that were differentially expressed in both MCF-2 and BT-20 xenograft models when treated with Compound A were analyzed. Turquoise blue solid line indicates direct interaction with ERRα while dotted line indicates indirect interaction. Genes that were down-regulated by Compound A are shaded green. (For more information, see also www.Ingenuity.com).
6 ERRα Antagonist Suppresses Breast Cancer Growth
Fig. S3
Fig. S3. Stable knock-downs of ERRα by RNAi inhibits MCF-7 breast cancer cell proliferation. (A) Proliferation curves of MCF-7 ERRα stable knock-down cells grown in E2-free medium treated with vehicle (DMSO) alone. MCF-7 cells were stably transfected with shGFP vector (control shRNA) or vector containing shRNA against the human ERRα (ERRα shRNA2 and shRNA3). Transfected cells were selected through multiple runs of Flow cytometry sorting. The core sequences of ERRα shRNA2 and shRNA3 are GAGAGGAGTATGTTCTACTAA and AGAGGAGTATGTTCTACTAAAA, respectively. (B) Proliferation curves of MCF-7 ERRα stable knock-down cells grown in medium containing 3 pM E2. Differences in mean total cell number between groups were measured by ANOVA followed by a student t-test with a 0.05 significance level. Proliferation rate was determined as outlined in Material and Methods. Results are reported as total cell number + SE (bars) for each point. *, P = 0.001, **, P < 0.001.
7