THE ROLE OF BAG3 IN THE FAILING HEART
______
A Dissertation Submitted to the Temple University Graduate Board ______
In Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY ______
By Valerie D. Myers May 2018
Examining Committee Members:
Arthur Feldman, Advisory Chair, Department of Medicine Eman Hamad, Examining Committee Chair, Temple Heart and Vascular Institute Walter Koch, Committee Member, Department of Pharmacology, Center for Translational Medicine Douglas Tilley, Committee Member, Department of Pharmacology, Center for Translational Medicine Kamel Khalili, External Member, Department of Neuroscience
© Copyright 2018
by
Valerie D. Myers
ii
I dedicate this work to my parents Samuel and Cindy Myers, and to my siblings Andrew, Elizabeth, Sanaa,
Adam and Amanda for their constant support. And to Ryan, for wanting me to achieve
my goals and understanding what that entails.
This dissertation is a result of their confidence in me throughout the years.
iii
ACKNOWLEDGMENTS
First, I would like to acknowledge my advisors Dr. Arthur Feldman, Dr. Eman
Hamad, Dr. Walter Koch, Dr. Douglas Tilley and Dr. Kamel Khalili for their guidance, input, and support during my graduate studies. I am deeply appreciative of their interest in my project and their enthusiasm for translational research, which gave me a window of experience to view my project through.
I would like to thank Dr. Feldman for bringing passion to each aspect of my project that helped me focus on the areas of importance. Also, for supporting me to develop autonomy in the lab that I will carry with me for the rest of my career, as well as shaping my critical thinking and my ability to develop ideas independently.
I would like to express my gratitude to Dr. Hamad who was there for me not only as a thesis advisor, but also as a confidant through life.
I would also like to thank Dr. Tilley for, in addition to being a committee member, helping me through the qualifying exam process and taking the time to read my papers and listen to and give feedback on my practice presentations.
Additionally, I would like to thank Dr. Khalili for being my external reader. And
Dr. Koch for his thoughts throughout this process that helped my project develop as it did.
Special thanks former lab member Feifei Su, who helped with animal experiments and made the lab a brighter place with his disposition. And thanks to all the students who have gone through the lab while I was focusing on my thesis, especially Kristen Weiner and Raffiu Mohammed for their technical assistance and positive attitudes.
iv
Finally, I would like to thank all my friends and family. Special thanks goes to my friend Amanda Donley for reading every paper I’ve ever written. To my friend Julianne
Malone for remembering every significant deadline and for traveling from NC for my defense. To the McPeaks, for understanding my busy schedule. And again, my gratitude to my family for believing in me, listening to me, and supporting me throughout. None of this would be possible without their encouragement and understanding.
v
TABLE OF CONTENTS
Page
DEDICATION………………………………………………………………………....…iii
ACKNOWLEDGMENTS……………………………………………………………...... iv
LIST OF TABLES……………………………………………………………………...viii
LIST OF FIGURES………………………………………………………………………ix
LIST OF ABBREVIATIONS………………………………………………………...…..xi
CHAPTERS
1. INTRODUCTION……………………………………………………………….. 1
Heart disease………………..………………………………...………….. 1
Etiologies of dilated cardiomyopathy……………………………..3
The biology of Bcl-2 associated athanogen 3 (BAG3)…………...... 6
Protein quality control and regulation in the heart……………………….10
Apoptosis in the Heart…………………………………………...... 15
BAG3 protein levels in the Heart……………………………...... 15
Hypotheses and approach……………………………...... 16
2. MATERIALS AND METHODS……………………………………..………… 18
Animals protocols…………………………………………...... 18
vi
Tissue collection and pathologic evaluation…………………………..... 19
Echocardiography……………………………..…………………………19
In vivo gene delivery of BAG3 to animals…………………..…………..20
Isolation of adult cardiomyocytes………………………...……………...20
Single cell contractility and calcium transients………………………….21
Protein extraction and immunoblotting from tissue……………...………21
BAG3 variant plasmid construction…..………………………………….22
Measurement of autophagic flux………………….……………………..23
Measurement of apoptosis………………….……………………………24
RNA extraction and qRT-PCR analysis………….……………………...24
Cell culture………….……………………………………………….…...25
Patient populations…………………….………….……………………...26
Sequencing……...………………………………………………....……. 27
Genotyping of patient DNA…….………………………………....……. 29
Determination of linked variants…………………….…………....……. 30
Statistical analysis………………………………………………....……. 31
3. RESULTS……………………………………………………………………..... 33
4. DISCUSSION……………………………………………………………….….. 81
REFERENCES…………………………………………………………………..92
vii
Tables
Table 1: Partial list of chaperone proteins shown to associate with BAG3……………….…..…..7
Table 2: Primary antibodies used……………………………………………...………...……….22
Table 3: Primers used to create BAG3 variant plasmids………………………..……………….23
Table 4: Primers used for sequencing each exon of BAG3…………………...…………………28
Table 5: Summary of echocardiography of BAG3+/+ and cBAG3fl/+ mice………..……………..39
Table 6: BAG3 variants found to be present in an African American patient population……….49
Table 7: Patient demographics between groups are equivalent………………………………….53
Table 8: BAG3 variant frequencies in patient populations………………………………………55
Table 9: Summary of echocardiography with expression of BAG3 variants…………………….80
viii
Figures
Figure 1: Statistics on causes of death in the US………………………………..………….……..2
Figure 2: Genes in which mutations are commonly associated with heart disease……….………3
Figure 3: Representation of BAG3 protein………………………………………………………..9
Figure 4: Different types of autophagy……………………………..……………………………10
Figure 5: Steps of mammalian macroautophagy…………………………………………………12
Figure 6: Pictoral abstract of rescue of cardiac function in mice……………….………………..13
Figure 7: Functional rescue after MI with BAG3 restoration……………………………………13
Figure 8: Decreased infarct size in mouse hearts post ischemia/reperfusion…………………….15
Figure 9: Methods used to determine configuration of P63A and P380S SNPs……………...….31
Figure 10: Generation of BAG3 heterozygous knockout mice……………………..……………34
Figure 11: Heart Weight, Body Weight and Tibia Length in cBAG3+/- mice……...……………36
Figure 12: Cardiac function in BAG3+/+ and cBAG3fl/+ mice……………………………………38
Figure 13: Contractility and calcium responsiveness in BAG3+/+ and BAG3fl/+ mice………..….41
Figure 14: Measurement of autophagic flux using GFP-RFP-LC3B construct……………...…..43
Figure 15: Isolated adult cardiomyocytes from BAG3+/+ and cBAG3fl/+ mice…………..………44
Figure 16: Increased apoptosis in cBAG3fl/+ mice when compared to BAG3+/+...………………46
Figure 17: BAG3 conservation across mammals………………………………………………...51
Figure 18: Event free survival in all patients…………………………………………………….57
Figure 19: Event free survival in non-ischemic HF patients……………………………………..58
ix
Figure 20: Event free survival in IDC patients…………………………………………………..59
Figure 21: BAG3 protein and mRNA in patient ventricle……………………………………….61
Figure 22: BAG3 variant plasmid expression in AC16 cells…………………………………….63
Figure 23: Autophagy with BAG3 variant expression in AC16 cells……………………………64
Figure 24: Apoptosis with BAG3 variant plasmid expression in AC16 cells…………………...65
Figure 25: Contractility and calcium responsiveness with BAG3 variant expression…………...67
Figure 26: Autophagy in BAG3+/+ and BAG3fl/+ cardiomyocytes……………………………….69
Figure 27: Autophagy in BAG3+/+ and BAG3fl/+ cardiomyocytes expressing WtBAG3………...70
Figure 28: Autophagy in BAG3+/+ and BAG3fl/+ cardiomyocytes expressing 63/380BAG3……71
Figure 29: Autophagy in BAG3+/+ and BAG3fl/+ cardiomyocytes expressing A479VBAG3……72
Figure 30: Quantification of autophagy in isolated cardiomyocytes expressing variants……….73
Figure 31: Apoptotic cell death with expression of BAG3 variants……………………………..75
Figure 32: Functional effect of BAG3 variant expression in vivo……………………………….79
x
Abbreviations used
. BAG3 - Bcl2-associated Athanogene 3
. HF - Heart Failure
. DCM - Dilated Cardiomyopathy
. IDC - Ideopathic Dilated Cardiomyopathy
. %EF - Percent Ejection Fraction
. LV - Left Ventricular
. SNP or SNV - Single Nucleotide Polymorphism or Variant
. CASA - Chaperone Assisted Autophagy
. HSP - Heat Shock Protein
. LC3 - Microtubule-associated protein 1A/1B-Light Chain 3
. I/R - Ischemia/Reperfusion
. PS - Phosphatidylserine
. MI - Myocardial Infarction
. Wt or WT - Wild Type
. cBAG3fl/+, cBAG3+/- or +/- - BAG3 haplo-insufficient
. BAG3+/+ or +/+ - Carrying full complement of BAG3
. LVEF - Left Ventricular Ejection Fraction
. LV Vol d - Left Ventricular Volume during Diastole
. LV Vol s - Left Ventricular Volume during Systole
. HR - Heart Rate
. %FS - Percent Fractional Shortening
. LVPWd - Left Ventricular Posterior Wall thickness during Diastole
. LVPWs - Left Ventricular Posterior Wall thickness during Systole
. LVIDd - Left Ventricular Interior Diameter during Diastole
xi
. LVIDs - Left Ventricular Interior Diameter during Systole
. CO - Cardiac Output
. SV - Stroke Volume
. GFP - Green Fluorescent Protein
. RFP - Red Fluorescent Protein
. AAV - Adeno-Associated Virus
. GRAHF - Genetic Risk Assessment of African Americans with Heart Failure
. AHeFT - African American Heart Failure Study
. IMAC-2 - Intervention in Myocarditis and Acute Cardiomyopathy Trial-2
. GRACE - Genetic Risk Assessment of Cardiac Events study
. gnomAD - Genome Aggregation Database
. PCR - Polymerase Chain Reaction
xii
CHAPTER 1
INTRODUCTION
1.1 Heart Disease
Heart disease has been the leading cause of death in the United States for more than 90 years (Mensah & Brown, 2007). The leading cause of death in individuals aged 65 and older has remained diseases of the heart from 1950 to the current time (Figure 1A) (CDC report 2015). According to the CDC, once diagnosed with heart disease, individuals have an approximately 50% chance of dying within 5 years, regardless of race (CDC report
2015). Mortality related to heart disease increased dramatically from the start of the 1900s to 1921, but subsequently experienced a steady decline from the mid-1960’s to 2000.
However, when the decrease in heart disease is examined at the level of race it is clear that the decrease is not equally shared. While the leading cause of death among both Caucasian
American men and women and African American men and women remains heart disease, the decrease in incidence of coronary heart disease among African American men was only half of the decrease in incidence among Caucasian American men (CDC report 2015)
(Figure 1B).
Heart failure (HF) is a collection of signs and symptoms that include shortness of breath, edema and overwhelming fatigue. Over six million Americans have symptoms of HF.
Similar to the incidence and prevalence of cardiovascular disease, there is a higher incidence of HF in young African American women when compared to women of the same age of European ancestry. Fatality rates due to HF in both African American men and
African American women are also higher when compared to age-matched Caucasian
Americans (Figure 1B). African Americans are two times more likely to experience
[1] sudden cardiac death due to HF than Caucasian Americans (Figure 1C) (Carnethon et al.,
2017).
Figure 1: Statistics on causes of death in the US A) Graphical representation of the top 10
leading causes of death in the total population as of 2015. B) Age adjusted death rates (per
100,000 people) in White/Caucasian populations and in Black/African American populations
from 1950 to 2015. C) Years of life lost in White/Caucasian and Black/African American
populations overall and specifically related to cardiac diseases. This figure is modified from
(CDC report 2015).
Heart Failure:
HF is a disease of epidemic proportions affecting over 6 million individuals in the U.S., causing over one million hospitalizations each year and represents the most common discharge diagnosis for patients over the age of 65. A collection of signs and symptoms of cardiovascular disease that include shortness of breath, edema and fatigue, affects an
[2] estimated 6.5 million Americans twenty years or older (Benjamin et al., 2017). The signs and symptoms of HF are caused by four distinct cardiovascular diseases: 1) dilated cardiomyopathy (DCM); 2) hypertrophic cardiomyopathy; 3) constrictive cardiomyopathy; and 4) restrictive cardiomyopathy. Some experts would argue that there is a fifth form of disease – arrhythmogenic right ventricular dysplasia; however, this disease is often included within the dilated cardiomyopathies (Carnethon et al., 2017).
1.2 Etiologies of dilated cardiomyopathies (DCM)
Idiopathic dilated cardiomyopathy (IDC) can also be caused by chronic increases in afterload or, less commonly, in chronically elevated pre-load, which can be due to diseases
Figure 2: Genes in which mutations are commonly associated with heart disease (Figure
from: Hershberger, Hedges, & Morales, 2013) of the valves (both stenotic and regurgitant). Patients with DCM have reduced percent
[3] ejection fraction (%EF), increased end diastolic and systolic left ventricular (LV) volumes, increased LV internal diameter both during diastole and systole, and often develop HF over time (Braunwald, 2017). The most common cause of DCM is ischemic heart disease which occurs in 70% of individuals presenting with their first signs and symptoms of disease.
Historically, the disease in the remaining 30% of patients was attributed to IDC. Causes of
IDC include infections (myocarditis), toxins (eg. cobalt), allergic reactions to medications, pheochromocytoma, rheumatologic disease, etc. However, over the past decade it has become increasingly recognized that between 40 and 60% of patients with IDC had a genetic cause for their disease. In fact, 40% of individuals with IDC are found to have at least one first degree relative with IDC and mutations in over 40 genes have been attributed to be causative in the development of this disease (Cuenca et al., 2016). The sequencing of the human genome and the increasing availability and lowering cost of next generation sequencing has increased our ability to link genetic variants with IDC in individual families; however, linking genetic variants with “causation” has remained challenging. For example, large deletions or truncations, intuitively, alter the function of the resulting protein; however, identifying the relevance of a single nucleotide polymorphism (or variant) – SNP (or SNV) – often requires further investigation (Riera, Lois, & de la Cruz,
2014). Many consensus panels posit that the definitive identification of a “causative” mutation requires: 1) the SNP must be in a highly conserved region of the gene; 2) the SNP alters the function of the gene; and 3) the SNP segregates with family members who have the phenotype (Hayashi, Shimizu, & Albert, 2015).
Mutations tend to be present in genes for sarcomeric, cytoskeletal, musculoskeletal, mitochondrial, nuclear envelope, heat-shock, potassium or calcium-handling proteins
[4]
(Hershberger, Hedges, & Morales, 2013) (Figure 2). The inheritance of these genes is generally autosomal dominant, with occasional recessive and sex-linked disease promoting mutations. Bcl2-associated athanogene 3 (BAG3) is among the genes screened as probable causal genes of DCM (Braunwald, 2017). A complicating problem in identifying mutations and ascribing disease to new mutations is that mutations in the same gene can result in very different phentoyes. For example, mutations in the myosin gene can result in both hypertrophic and dilated cardiomyopathy (Seguchi et al., 2007).
As with other forms of cardiovascular disease, the prevalence of HF differs by race and ethnicity. Americans of African descent have the highest incidence and prevalence of
DCM (Loehr, 2008; Yancy, 2000), and the etiology is predominantly idiopathic (IDC) as compared with patients of European ancestry who most commonly have cardiac dilatation secondary to ischemic heart disease (Bahrami et al., 2008; Dries et al., 1999; Echols et al.,
2006; Yeboah et al., 2012). Consistent with the epidemiology of dilated cardiomyopathy in Americans of African ancestry, IDC is far more common (Sliwa et al., 2008) and the age at which IDC is first recognized is substantially lower in Sub-Saharan Africa than in the U.S. or in Europe (Bibbins-Domingo et al., 2009; Carnethon et al., 2017; Sliwa et al.,
2008).
The high incidence and prevalence of IDC in African Americans have been attributed to an elevated burden of traditional cardiovascular risk factors: diabetes mellitus, hypertension, cholesterol, smoking status, and left ventricular hypertrophy. However, several observations suggest they may be attributed to genetic factors. IDC hot spots, a characteristic feature of genetic differences, have been identified in geographic regions across the Sub-Saharan Africa (Damasceno et al., 2012). There is not a correlation between
[5] the presence of hypertension and the prevalence of IDC in Sub-Saharan Africans (Ntusi &
Mayosi, 2009). Furthermore, truncating variants in TTN, the gene most commonly associated with dilated cardiomyopathy (Herman et al., 2012), are more prevalent in women of African ancestry than in women of European ancestry (Ware et al., 2016).
1.3 The Biology of Bcl2-associated athanogene 3
Genetic variants in BAG3 (Bcl-2 associated athanogene 3), a highly evolutionarily conserved gene that has recently emerged as a major dilated cardiomyopathy locus (Maria
Franaszczyk et al., 2014), are prevalent in isolated populations (Fernlund et al., 2017). This led us to hypothesize that variants in BAG3 might contribute to the increased prevalence of IDC in individuals of African ancestry. Expressed predominantly in the heart, the skeletal muscle and in many cancers, BAG3 has pleotropic effects in the heart (Myers
Valerie D., Tomar Dhanendra, Madesh Muniswamy, Wang Jufang, Song Jianliang, Zhang
Xue-Qiang, Gupta Manish K, Tahrir Farzenah G, Gordon Jennifer, McClung Joseph M.,
Kontos Christopher D., Khalili Kamel, Cheung Joseph Y. Feldman Arthut, 2018). It inhibits apoptosis by binding to Bcl-2, facilitates protein quality control by binding to both large and small heat shock proteins, mediates adrenergic responsiveness by coupling the
β-adrenergic receptor and the L-type Ca2+ channel (Feldman et al., 2016), and maintains the integrity of the sarcomere by anchoring actin filaments to the Z disc (Hayashi et al.,
2015). However, a paucity of subjects of African ancestry have been included in cohorts of probands with familial dilated cardiomyopathy whose exomes or genomes have been sequenced.
BAG3 is a 575 amino acid protein which is one of 6 proteins in the BAG protein family
(Shinichi Takayama, Zhihua Xie, & John C. Reed, 1999). The BAG protein family have
[6] in common at least one BAG domain at the carboxy-terminal end (Kabbage & Dickman,
2008; Takayama & Reed, 2001). BAG3 was first cloned and sequenced in 1999, and has been shown to be highly conserved between many species (J. Lee et al., 1999; Shinichi
Takayama et al., 1999). Because BAG3 is so highly conserved, mutations in BAG3 are becoming increasingly recognized as one of the principal causes of DCM leading to HF.
Additionally, BAG3 protein, while universally present in mammalian tissue types, is predominantly expressed in cardiac and skeletal muscle and
in many types of cancer cells (McCollum, Casagrande, & Kohn, 2009; Rosati, Graziano,
De Laurenzi, Pascale, & Turco, 2011). Recent studies have shown that genetic or familial
DCM is due to mutations in BAG3 somewhere between 2.8% and 15% of the time, depending on the population studied (Arimura, Ishikawa, Nunoda, Kawai, & Kimura,
2011; Chami et al., 2014a). To this point, most HF populations studied carrying BAG3 mutations are either families or geographically discrete populations (Arimura et al., 2011;
Chami et al., 2014a; Janin et al., 2017; Ulrike Esslinger, et al., 2017). BAG3 has 4 distinct types of protein binding domains; the WW domain, two IPV domains, a proline rich domain, and a BAG domain outlined below (Behl, 2016). Owing to these many distinct
[7] binding domains, BAG3 has an abundance of chaperone proteins with which it interacts.
Some of the known chaperone proteins are outlined in Table 1.
The primary role of the WW domain in BAG3 is in chaperone-assisted autophagy (CASA)
(Arndt et al., 2010; Ulbricht & Hohfeld, 2013). Normally functioning CASA in the heart is essential under pathological conditions such as HF. Mechanical stress on cardiac cells can lead to improperly folded proteins which need to be cleared via CASA. If this mechanism is impaired and there is a buildup of these proteins, cardiac cell death will be observed as a result (Tarone & Brancaccio, 2014) (Figure 3).
Both of the IPV domains are highly conserved and have been indicated in interactions between BAG3 and small heat shock proteins HSPB6 and HSPB8 to support autophagy
(Behl, 2011; Hishiya, Salman, Carra, Kampinga, & Takayama, 2011). There are several mechanisms by which proteostasis is modulated in the cell, autophagy is one of these. Heat shock proteins support proper protein folding and repair as well as clearance of misfolded proteins via autophagy (Dokladny, Myers, & Moseley, 2015). Mutations in the IPV domains of BAG3 were identified in 2008 as significant sites for mutations that lead to muscular diseases due to impaired macroautophagy and concomitant protein aggregation
(Carra, Seguin, & Landry, 2008; Fuchs et al., 2009). All of these studies highlighted the importance of clearance of damaged, misfolded, or old proteins from the cell (Figure 3).
The PXXP domain interacts with proteins that contain WW or SH3 domains. Through these interactions, BAG3 regulates cell migration and adhesion to matrix proteins, as well as cell-cell junction formation by interacting with CCN (extracellular matrix proteins) and
PDZGEF2 (Rap guanine nucleotide exchange factor 6) specifically (Rosati et al., 2011)
(Figure 3). Cell-cell junctions are critical in cardiomyocytes. Abnormal formation or loss
[8] of integrity of cell-cell junctions lead to faulty conduction systems in the heart and abnormal signaling (Mezzano & Sheikh, 2012). This makes mutations in the PXXP domain another probable contributor to development and progression of DCM.
The BAG domain is shared by each of the 6 BAG family proteins. In each of the family members there is at least one BAG domain present at the C terminal end of the protein, while some family members contain multiple BAG domains throughout the protein (Rosati et al., 2011). The BAG domains interaction with Bcl-2 are well characterized. For example, increasing levels of BAG3 lead to a concomitant increase in Bcl-2 protein levels.
BAG3 has been shown, via immunoprecipitation assay, to interact directly with Bcl-2, and cells with increased levels of BAG3 or BAG3 and Bcl-2 are protected from apoptotic cell death (Zhang, Wang, Lu, & Wang, 2012).
The interaction of the BAG domain of BAG3 with HSP70 has been thoroughly characterized in numerous types of cancer cells, as their interactions promote cell survival
(Li et al., 2015). The BAG3-HSP70 complex is involved in trafficking of protein substrates
Figure 3: Representation of BAG3 protein showing established interactions of each of the 5
domains (WW, IPV, IPV, PXXP and BAG).
[9] to lysosomes for autophagic degradation by recognizing a pentapeptide motif. Impaired macroautophagy is indicated in a wide variety of diseases including neurodegeneration, muscular dystrophies and cancers (Rosati et al., 2011) (Figure 3).
1.4 Protein Quality Control and Regulation in the Heart
Intact protein quality control is essential in the heart as cardiomyocytes are not replaced and regulation of cellular proteins must be normal to prevent accumulation and aggregation of proteins and resulting toxicity (Wang & Hill, 2015). BAG3 is heavily involved in several types of autophagy as mentioned above (chaperone mediated autophagy and macroautophagy) and is thereby necessary in maintenance of cellular homeostasis.
Figure 4: Different types of autophagy A) Macroautophagy B) Chaperone mediated
autophagy and C) Microautophagy (Figure from: Patricia Boya, Fulvio Reggiori, & Patrice
Codogno, 2013).
[10]
Autophagy is a complicated process. The etymology of the term is apt: ‘self-eating’. The autophagic process consists of the cell clearing misfolded, old, or aggregated proteins from the cell (Tanida, 2011). The three main types of autophagy are 1) macroautophagy, 2) microautophagy, and 3) chaperone mediated autophagy (CMA) (Patricia Boya, Fulvio
Reggiori, & Patrice Codogno, 2013) (Figure 4).
Macroautophagy (or simply autophagy) is the most common and, consequently, the most thoroughly studied form of autophagy. Macroautophagy is characterized by formation of double membraned vesicles, which then engulf dysfunctional and misfolded proteins for degradation by the lysosome. The steps of autophagy are 1) initiation, 2) elongation, 3) maturation of the membrane and finally 4) fusion of the double membrane with the lysosome (Tanida, 2011). Proteins that are present during each of these steps have been well characterized. During the initiation process Beclin1, Vps34, and AMBRA proteins are necessary for assembly of the double membrane which encloses the autophagic vesicles. Elongation of this double membrane leads to formation of the phagophore which surrounds the cellular debris. Once the initiation and elongation phases have completed and the contents to be degraded have been surrounded by the phagophore, the double membrane closes (maturation), forming an autophagosome. Finally, the autophagosome fuses with the lysosome (regulated by SNARE proteins) and the contents of the newly formed autophagolysosome are degraded by hydrolases down to their basic components, which are then returned to the cell for reuse (Tanida, 2011) (Figure 5). Throughout this process there is also a protein called microtubule-associated protein 1A/1B-light chain 3
(LC3) that is useful for measurement of autophagic flux. When the autophagosome engulfs the misfolded or degraded proteins, it also recruits a phospholipidated form (LC3-II) of the
[11] cytoplasmic protein LC3-I onto the autophagosome. As a result, measuring the turnover of LC3 levels when autophagic flux is being regulated is an excellent indicator of the autophagic process (Tanida, Ueno, & Kominami, 2008).
As previously mentioned, because of the constant mechanical stress and resultant formation and degradation of structural proteins, normally functioning autophagy is extremely important for cardiac structure and homeostasis (Pedro, Kroemer, & Galluzzi,
2017).
Figure 5: Steps of mammalian macroautophagy (initiation, elongation, maturation
and fusion/degradation) in a cell. Modified from (Figure from: Klionsky & Yang,
2010).
[12]
Autophagy is altered and/or impaired in different types of HF. For example, in aging hearts autophagy levels are decreased, in cardiac pressure overload autophagy is increased, and in ischemic/reperfused HF autophagy initially decreases and then restores back to normal levels during reperfusion. However, whether increases and decreases in autophagy are beneficial or detrimental seems to depend on the type of HF to which they are tied (Sasaki,
Ikeda, Iwabayashi, Akasaki, & Ohishi, 2017). This emphasizes the fact that the effects of alterations in autophagy must be assessed in addition to the actual changes in autophagic flux themselves.
Figure 6: Pictoral abstract of rescue of cardiac function in mice post-myocardial
infarction by reconstitution of wild-type BAG3 protein levels via adeno-associated
virus injection (Knezevic and Myers et al., 2016)
[13]
1.5 Apoptosis in the heart
As mentioned above, BAG3 also plays a role in regulation of Bcl-2 and thereby has anti- apoptotic influences (Zhang et al., 2012). Apoptosis is a regulated method through which cell death occurs after a pathway, which requires energy to complete, is fulfilled (Kerr,
Wyllie, & Currie, 1972). It
has been shown that after an
ischemic cardiac event,
when there is left ventricular
remodeling, significant
apoptotic cell death in the
region of the heart
surrounding the infarct is
observed (Olivetti et al.,
1996). Studies have shown
that increasing levels of an
inhibitor of apoptosis (Bcl-
2) leads to decreased infarct Figure 7: Functional rescue after MI with BAG3 restoration size after A) Percent ejection fraction is decreased post MI with ischemia/reperfusion (I/R) AAV9-GFP expression. AAV9-BAG3 reconstitution post MI (Brocheriou et al., 2000). rescues this decrease in cardiac function. B) BAG3 levels Additionally, when BAG3 are significantly decreased in MI mice and partially restored levels are increased there is a with administration of AAV9-BAG3. (Knezevic and Myers concomitant increase in Bcl- et al., 2016)
[14]
2 levels (Zhang et al., 2012). All of this supports the hypothesis that a decrease in BAG3 protein leads to increased apoptosis, an imbalance between apoptosis and autophagy, and the development of HF. Measurement of apoptosis in cardiomyocytes can easily be done by visualizing cells expressing phosphatidylserine (PS) on the cell surface (van Heerde et al., 2000).
1.6 BAG3 Protein Levels in the Heart
We have found that a truncation mutation in BAG3 led to a decrease in protein levels of
BAG3 in the heart, as well as development of DCM (Feldman et al., 2014a). Additionally, individuals with end-stage HF have decreased levels of BAG3 protein in left ventricular cardiac tissue (Feldman et al., 2014a), which has now been confirmed by an independent study (Fang et al., 2017). This decrease in cardiac BAG3 levels in HF patients is made more interesting by the resultant HF in patients carrying BAG3 variants (Arimura et al.,
2011; Chami et al., 2014a; Fang et al., 2017). This led us to a hypothesis that restoration
Figure 8: Decreased infarct size in mouse hearts post ischemia/reperfusion with
reconstitution of BAG3 using AAV9-BAG3. (Su et al., 2016)
[15] of BAG3 levels in failing hearts could restore cardiac function. To this end, we used an adeno-associated virus to reconstitute BAG3 levels in mice post myocardial infarction (MI)
(Figure 6). In a mouse model of HF secondary to a myocardial infarction we found that there was a significant decrease in cardiac function (Figure 7A) alongside a decrease in
BAG3 protein levels (Figure 7B). However, when we restored BAG3 protein levels in MI mice via retro-orbital injection of AAV9-BAG3 there was a significant increase in cardiac function (Knezevic et al., 2016) (Figure 7A and 7B).
Additionally, we looked at signaling and infarct size post ischemia-reperfusion (I/R) in mice. This model also showed a significant decrease in cardiac BAG3 protein levels and cardiac function post I/R, but again, these decreases were rescued by restoration of BAG3 protein levels using AAV9-BAG3. Additionally, restoration of BAG3 levels decreased infarct size in hearts post I/R (Su et al., 2016) (Figure 8).
Hypotheses and approach
Based on our previous observations and reports from other groups we postulated: 1) that mice with haploinsufficiency of BAG3 will re-capitulate disease seen in humans and serve as a model for studying the pathogenesis of BAG3. 2) The prevalence or identification of specific BAG3 variants will differ by race and/or ethnicity. 3) Single nucleotide variants
(SNVs) of BAG3 may contribute to disease progression and thereby be pathogenic.
To this end, we took a multi-pronged approach.
- We generated a mouse model of heterozygous cardiac-specific knockdown of
BAG3 and measured cardiac function over time to determine if a 50% decrease
in BAG3 expression would lead to the HF phenotype seen clinically.
[16]
Furthermore, we pursued studies to document the pathobiology of HF in these
animals.
- To investigate the role of genetic mutations in BAG3 in subjects of African
Ancestry with IDC, we sequenced the four BAG3 coding exons in genomic
DNA acquired from subjects who participated in one of three HF clinical trials
or who contributed heart tissue to one of two heart tissue repositories at the time
of heart transplant.
- We assessed the pathogenicity of BAG3 variants identified through sequencing
of the Genetic Risk of Heart Failure in African Americans (GRAHF) cohort by
evaluating the effects of a defined group of BAG3 variants on each of the
known mechanisms of BAG3: excitation-contraction coupling, autophagy, and
apoptosis in cells harboring BAG3 variants.
- Finally, we assessed the ability of BAG3, as well as BAG3 variants, to alter the
development of LV dysfunction in the mice with BAG3 haplo-insufficiency.
[17]
CHAPTER 2 MATERIALS AND METHODS 2.1 Animal protocols Targeting vector of BAG3 (HEPD0556_7_B06), obtained from International
Mouse Phenotyping Consortium (IMPC; Oxfordshire, UK), was used to target BAG3 in
EUCOMM/KOMP-CSD embryonic stem (ES) cells after introduction by electroporation.
This targeting produced a “knockout first” allele with both a PGK-neomycin cassette and a LacZ reporter gene. loxP sites flank the promoter/neomycin cassette and were removed by action of cre recombinase, thereby ‘knocking out’ BAG3 (William C Skarnes et al.,
2011). BAG3 single allele floxed (BAG3fl/+) mice were crossed with αMHC-Cre mice
(Agah et al., 1997a) leading to cardiac specific knockdown of BAG3. All mice were housed in an animal facility with constant airflow, controlled humidity and temperature
(21-23°C) on a 12 hour light/dark cycle and supplied with food and water ad-libitum.
Animals were randomly assigned to either 1) Uninjected, 2) AAV9-GFP injected, 3)
AAV9-BAG3Wt injected, 4) AAV9-BAG363/380, or 5) AAV9-BAG3A479V. The control mice were a mix of cre positive without BAG3 floxed (cBAG3+/+) and cre negative BAG3 floxed (BAG3fl/fl or BAG3fl/+). Experimental mice were all heterozygous floxed, cre positive mice (cBAG3fl/+). All procedures were performed according to the National
Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Temple University Institutional Animal Care and Use Committee (ACUP #4740).
Genotyping of mice was done using gel based genotyping on DNA extracted from tails with primers for a WT band (F: TCTGAAGATGCACAGGGGTG, R:
TGAGCGGCACTTTAAGGTTT) and primers for floxed allele (F:
TCTGAAGATGCACAGGGGTG, R: GAACTTCGGAATAGGAACTTCG) with
[18] resulting WT band at 300 and mutant band at 139 base pairs respectively. All animal generation was accomplished in a background of C57BL/6 strain.
2.2 Tissue collection and Pathologic Evaluation Body weight of each mouse was recorded, the mice were then deeply anesthetized with isoflurane, and an incision was made in the abdomen. The inferior vena cava was cannulated, and 30 mmol/L KCl in an isotonic and pH buffered solution was rapidly infused. The heart was then excised, weighed and rinsed in ice-cold 30 mmol/L KCl.
Small portions of the left ventricular free wall were removed and placed in ice-cold 10% neutral buffered formalin and the remaining heart tissue was flash-frozen in liquid nitrogen and stored at -70oC for subsequent analysis.
2.3 Echocardiography Global LV function was evaluated in all mice after light sedation (2% isoflurane) using a
VisualSonics Vevo 2100 imaging system and a MS550D scan head (Miami, FL) as described previously (12). The left ventricular ejection fraction (LVEF) was calculated using the formula EF% = [(LV Vol d – LV Vol s)/LV Vol d]×100; where LV Vol d and
LV Vol s are left ventricular end-diastolic volume and left ventricular end-systolic volume, respectively. Fractional shortening (FS) was calculated as
FS%=[(LVIDd−LVIDs)/LVIDd]×100.], where LVIDd and LVIDs are left ventricular end- diastolic dimension and end-systolic dimension, respectively. Other measurements recorded during echocardiography were heart rate (HR), and left ventricular posterior wall thickness (LVPW) during diastole and during systole.
[19]
2.4 In Vivo Gene Delivery of BAG3 to Animals
When mice were 4 to 6 weeks old they were randomly assigned to receive either a control-AAV9-GFP, AAV9-hBAG3Wt, AAV9-hBAG363/380, AAV9-hBAG3A479V construct (All AAV constructs were made at Vector Biolabs, Malvern PA). Each AAV9- hBAG3 vector was constructed from myc-tagged human BAG3 (NCBI accession
#NM_004281.3), BAG3H83Q, BAG363/380 and BAG3A479V were constructed from plasmids containing mutations at their respective sites (rs numbers: P63A rs144041999, P380S rs144692954, and A479V rs34656239) prior to insertion into a pAAV vector containing a cytomegalovirus (CMV) promoter. These were then packaged into AAV type 9 by transfection of HEK293 cells, and viral particles were purified by CsCl2 centrifugation
(Vector Biolabs, Malvern PA). Recombinant AAV9-hBAG3 also expresses green fluorescent protein (GFP) in cells that are infected with AAV9. Fidelity of the clones and the final vectors were confirmed by sequencing. Both control mice and cBAG3+/- mice were randomly assigned to receive either AAV9-hBAG3Wt, AAV9-hBAG363/380, AAV9- hBAG3A479V (5.0-6.5 X 1013 total viral particles) or AAV9-GFP in 60-80 ul of sterile PBS at 37oC by injection into the retro-orbital venous plexus as described previously
(Hoogstraten-Miller, Yardeni, Huizing, Eckhaus, & Morris, 2011).
2.5 Isolation of adult cardiac myocytes Cardiac myocytes were isolated from the septum and LV free wall of cBAG3+/- mice (10-
12 weeks old) as previously described (Ying-Ying Zhou et al., 2000) and plated on laminin- coated glass coverslips (Amy L. Tucker et al., 2006). Coverslips were then mounted in a
Dvorak-Stotler chamber and bathed in fresh media before measurements.
[20]
2.6 Single Cell Contractility and Calcium Transients
2 + Measurements of contraction and [Ca ]i in adult cardiac myocytes were obtained as described previously (Feldman, Gordon, Wang, Song, Zhang, Myers, Tilley, Gao,
Hoffman, Tomar, Madesh, Rabinowitz, Koch, Su, Khalili, & Cheung, 2016a). In brief, myocyte contraction was recorded using a charge coupled device video camera and myocyte motion was analyzed offline with an edge detection algorithm (Jianliang Song et al., 2008). For measurement of calcium transients, Fura-2 loaded myocytes adherent to
2 + laminin-coated coverslips were incubated in buffered (1.8 mM [Ca ]o) and field stimulated to contract (2 Hz; 37 °C). Myocytes were exposed to excitation light (360 and
380 nm) only during data acquisition. Epifluorescence (510 nm) was measured in steady- state twitches both before and after addition of isoproterenol (Iso; 1 μM) (Amy L. Tucker et al., 2006; Jianliang Song et al., 2012; JuFang Wang et al., 2009; JuFang Wang et al.,
2010; JuFang Wang et al., 2011).
2.7 Protein Extraction and Immunoblotting from Tissue
Frozen tissue was lysed in lysis buffer from Cell Signaling Technologies (CST) and homogenized with 0.5mm diameter zirconium oxide beads (Thomas Scientific) in a Bullet
Blender BBX24 according to manufacturer’s instructions. After tissue homogenization the suspension was centrifuged at 13,000g for 5 min at 4°C and supernatant containing protein was collected into a new pre-chilled tube. Protein concentration was determined by colorimetric Bradford assay from Bio-Rad according to manufacturer’s protocol and samples with equal amount of protein were used for analysis by Western Blot.
Immunoblots were performed as described previously (Chan et al., 2002). In brief, snap frozen left ventricles were lysed in buffer and homogenized in a Bullet Blender. 25μg
[21] of reduced protein lysates were separated on SDS-PAGE and transferred to Odyssey nitrocellulose membrane (LiCor, Lincoln, NE) by wet transfer (Bio-Rad, Philadelphia,
PA). Membranes were blocked in Odyssey blocking buffer (LiCor, Lincoln, NE) for 1 hour at room temperature before incubation with primary antibodies overnight at 4°C. After primary antibody incubation the membrane was washed with 1X TBST (0.1% Tween 20 in TBS) 3 times for 15 minutes and probed with appropriate fluorescently labeled secondary antibody for 1 hour at room temperature. Membrane was washed with 1X TBST
3 times for 15 min and the signal was detected by an Odyssey scanner and quantification was performed using Image Studio software. For a list of primary antibodies see Table 2.
Secondary antibodies were LiCor goat-anti-mouse 680 and goat-anti-rabbit 800 (LiCor,
Lincoln, NE).
Table 2: Primary antibodies used
2.8 BAG3 Variant Plasmid Construction
Plasmid pTU31, generated by Joseph Rabinowitz at Temple University, was used as the backbone for cloning of the BAG3 variants. Wild type BAG3 was inserted under a CMV promoter and each of the variants, p.Pro63Ala, p.His83Gln, p. Pro380Ser, p.Pro63Ala + p.Pro380Ser, and p. Ala479Val, were made using the QuikChange Site-Directed
Mutagenesis Kit (Agilent Technologies, Santa Clara CA) according to manufacturer instructions with the primers listed in table 1. p.Pro63Ala + p.Pro380Ser was made by
[22] sequential mutations of each site. p.160Aladup was synthesized by GenScript (Piscataway
Township, NJ) in pcDNA3.1 plasmid.
Table 3: Primers used to create BAG3 variant plasmids
2.9 Measurement of Autophagic Flux An adenovirus expressing RFP-GFP-LC3 was constructed using the BD Adeno-X
Expression System 2PT3674-1 and BD knockout RNAi Systems PT3739 (BD
Biosciences-Clontech, Palo Alto, CA) as previously described (Tomar et al., 2016).
Isolated adult myocytes from cBAG3+/- and Cre-/-BAG3fl/+ controls were infected 24 hours after isolation with Adv-RFP-GFP-LC3 and either ad-null, ad-BAG3P63A, ad-BAG3P380S, ad-BAG363/380, or ad-BAG3A479V. Confocal imaging was subsequently performed 48 hours later, as described in detail previously (mRFP -red--594 nm ex, 667 nm em: GFP–green-
488 nm ex, 543 nm em) (Su et al., 2016). Experiments were performed with and without
BafilomycinA1 to inhibit fusion of the lysosome with the autophagasome and thereby allow for buildup of LC3 puncta in cells with robust autophagic flux. The puncta of seven to 10 cells in each experimental group were counted after obtaining digital images and each experimental condition was replicated three times. When a lysosome fuses with the autophagasome to form an autolysosome, the increased acidity in the autophagasome quenches the fluorescence of GFP (green) resulting in predominantly red/yellow puncta. If autophagy is active, the number of puncta increases after BafilomycinA1 treatment because the autophagasomes cannot transition to autophagalysosomes and LC3 will not be degraded (Papini et al., 1993).
[23]
2.10 Measurement of Apoptosis Apoptosis was measured in control and cBAG3+/- isolated adult cardiomyocytes using a
Detection Kit (Abcam, Cambridge, UK #ab176750) according to manufacturer’s instructions. In brief, cells were stained with a red dye that identifies apoptotic cells by binding to phosphatidylserine that has flipped from the inner to the outer surface of the myocyte (Ex/Em = 630/660 nm). Membrane-impermeable DNA Nuclear Green DCS1
(Ex/Em = 490/525 nm) was able to enter compromised nuclei, thereby demonstrating late stage apoptosis (cells that were both red and green) or necrosis (cells that were green alone).
Cells were stained with CytoCalcein Violet 450 (Ex/Em = 405/450 nm) in order to identify viable cells (blue) with intact sarcolemma. Live cells were imaged on a Carl Zeiss 510
Confocal Microscope. The percentage of apoptotic cells per field was recorded by an investigator blinded to experimental group to avoid bias, and a minimum of 200 cells were counted per condition. Results are presented as percentage of total apoptotic cells per field.
2.11 RNA Extraction and qRT-PCR Analysis
Total RNA was extracted using the ThermoFisher Scientific mirVana RNA isolation kit according to manufacturer’s instructions. Complementary DNA was generated using a reverse transcription protocol previously described (Eman A Hamad et al., 2012).
Generation of cDNA product was verified using primers for the housekeeping gene
GAPDH. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of BAG3
(F: 5’caccctttccatgtctatccc3’, R: 5’ttatctggctgagtggtttctg3’) genes was normalized to
GAPDH (F: 5’ccttcattgacctcaactaca3’, R: 5’atgacaagcttcccgttctc3’). LightCycler 480
SYBR Green I Master Mix with specific primers and cDNA was used for qRT-PCR 20ul total reaction mixture. The qRT-PCR reaction was performed as previously described (Xue
[24]
Li et al., 2011) in a 96-well plate on an Applied Biosystems StepOne Real Time PCR
System. All samples were in triplicates, and amplification curves and Ct values were obtained for analysis. Results were expressed as mean ± SEM.
2.12 Cell Culture
AC-16 cells are human ventricular cells that have been fused with SV40 transformed fibroblasts (Davidson et al., 2005). Culture of these cells was performed at 37οC with 5%
CO2 in dulbecco’s modified eagle medium (DMEM) with 5% FBS and 0.1% antibiotics.
When cells are 60-70% confluent they are either transfected using the lipofectamine 3000 system (Thermo Scientific, Waltham, MA), or infected with adenovirus (Vector Biolabs,
Malvern PA) of the following constructs: GFP, BAG3Wt, BAG3P63A, BAG3P380S,
BAG363/380, BAG3A479V, BAG3H83Q. Each transfection or infection was carried out for 48 hours followed by either normoxic conditions (5% CO2) and 50nM BafilomycinA1 for 2 hours, or 4 hours of hypoxia (5% CO2/95% N2) followed by 2 hour treatment with 50nM
BafilomycinA1.
Cell Harvest and Protein Extraction
Two days post-infection or transfection cells were washed in 1X PBS and lysed in lysis buffer supplemented with mammalian protease inhibitor cocktail. Suspension was collected in Eppendorf tubes and in order to reach complete lysis, cells were vortexed every
2 minutes for 10 minutes, remaining on ice in between. After vortexing, samples were centrifuged at 13,000g for 5 min. The supernatant was collected and used for protein analysis. Protein concentration was determined by colorimetric Bradford assay from Bio-
[25]
Rad according to manufacturer’s protocol and samples with equal amount of protein were used for analysis by Western Blot.
2.13 Patient populations Genomic DNA was obtained from the repository of samples acquired from patients with
DCM who enrolled in three U.S. clinical trials: the Genetic Risk Assessment of African
Americans with Heart Failure (GRAHF) trial,(cohort A) a sub-study of the African
American Heart Failure Study (AHeFT) (McNamara et al., 2006; McNamara et al., 2009;
McNamara et al., 2014; Taylor et al., 2004); the Intervention in Myocarditis and Acute
Cardiomyopathy Trial-2 (IMAC-2’ cohort B) (Dennis M McNamara et al., 2011a); and the
Genetic Risk Assessment of Cardiac Events (GRACE) study (cohort C) (McNamara et al.,
2001; McNamara et al., 2004). DNA was also acquired from the left ventricular (LV) myocardium of subjects of African ancestry who underwent heart transplantation or received a left ventricular assist device and who agreed to have tissue stored in the human heart tissue repositories at the University of Colorado (cohort D) or at the University of
Pittsburgh (cohort E). Lastly, DNA was obtained from non-failing control human heart tissue (6 samples) that could not be used for transplant and was stored in the heart tissue repository at the University of Colorado (Bristow et al., 1993). Informed consent was obtained from all patients who contributed DNA or tissue to the aforementioned study repositories and the protocols were approved by the IRBs at each of the participating institutions.
We used three reference populations. First, we sequenced DNA from individuals of
African ancestry with ischemic cardiomyopathy who were enrolled in the studies that populated cohorts A-C. Second, we obtained BAG3 sequence data from a cohort of
[26] individuals of European ancestry with both familial and sporadic dilated cardiomyopathy collected at the Brigham and Women’s Hospital, Boston from individuals of European ancestry who had been recruited as research study subjects at numerous heart failure clinics throughout the U.S. (Ulrike Esslinger et al., 2017). Third, population genetic data were taken from the Genome Aggregation Database (gnomAD) comprising data from 123,136 exome sequences and 15,496 whole-genome sequences from unrelated individuals. Of these, 7,509 whole genomes and 55,860 exomes (63,369 total) are from individuals of Non-
Finnish European ancestry and 4,368 whole genomes and 7,652 exomes (12,020 total) sequences are from individuals of African ancestry (Lek et al., 2016). The data are readily accessible on-line (gnomad.broadinstitute.org).
2.14 Sequencing
Genomic DNA from each patient was PCR amplified using primers designed using NCBI’s primer Blast algorithms (https://www.ncbi.nlm.nih.gov/tools/primer- blast/index.cgi?LINK_LOC=BlastHome) and were optimized for amplification and sequencing performance. PCR products are analyzed by agarose gel electrophoresis and purified using Exonuclease III and Shrimp Alkaline Phosphatase (Promega, Madison, WI) prior to Sanger sequencing. Products were sequenced with the PCR primers using fluorescent dideoxy terminator method of cycle sequencing (ABI Prism BigDye
Terminator v3.1 Cycle Sequencing kits using 1/16 of the “standard” protocol). Reaction clean up was carried out using Applied Biosystems XTerminator purification system, following Applied Biosystem’s protocols. Sequencing reactions were run on a 3730xl
DNA Analyzer (Applied Biosystems Division, Foster City, CA) following Applied
Biosystems' protocols. Sequence data was analyzed using Sequencher Software, version
[27]
5.4.6 (Gene Codes, Ann Arbor, MI). SNPs were identified using the software’s “Call
Secondary Peaks” function. All data was manually inspected.
Primer Primer Base Name Primer Sequence 5'-3' Name Primer Sequence 5'-3' Pairs BAG BAG3 3 CCGGGAACACTCACTCGG Exon CACTCCCCGCCGCCT 831 Exon 1-R 1-F BAG BAG3 3 TGCTGCAGGCTAGACCC CAATGCCAAGCGCCACAG Exon 550 Exon A 2-R 2-F BAG BAG3 3 GAGGAGGTGCACAGCAGA CTCCTGCACCCCTGGAG Exon 551 Exon A A 3-R 3-F BAG BAG3 3 GGGGTGATCAATGGAAGC AGTGTTTTGCCTCCACC 117 Exon Exon CT CA 9 4-R 4-F
Table 4: Primers used for sequencing each exon of BAG3
BAG Exon 2 and BAG Exon 3 Primers were synthesized by Integrated DNA Technologies (Coralville, IA). Amplification was carried out in 10µl reaction containing 40ng DNA, 0.15µM each primer, 0.15mM each dNTPs (Life Technologies, Rockville, MD), 1X Buffer II (10 mM Tris-HCl pH 8.3, 50 mM KCl), 1.5mM MgCl2, and 0.5U AmpliTaq DNA Polymerase (Perkin Elmer, Foster
City, CA). Thermocycling was carried out in a Veriti thermocycler (Applied Biosystems).
Samples were denatured for 2 minutes at 96ºC followed by 40 cycles of 94ºC for 20 seconds, 61ºC for 20 seconds, and 72ºC for 20 seconds, then a final extension at 72ºC for
10 minutes.
[28]
BAG Exon 1 and BAG Exon 4 Primers were synthesized by Integrated DNA Technologies (Coralville, IA). Amplification was carried out in 10µl reaction containing 40ng DNA, 0.15µM each primer, 0.15mM each dNTPs (Life Technologies, Rockville, MD), HotStar1X PCR buffer (Tris-HCl pH 8.7,
KCl, 1.5 mM MgCl2, (NH4)2SO4), and 0.5U HotStarTaq DNA Polymerase (Qiagen,
Valencia, CA) Thermocycling was carried out in a Veriti (Applied Biosystems). Samples were denatured for 15 minutes at 95ºC followed by 45 cycles of 94ºC for 20 seconds, 63ºC
(BAG Exon 1) or 61ºC (BAG Exon 4) for 30 seconds, and 72ºC for 30 seconds, then a final extension at 72ºC for 10 minutes.
GRCF Sanger Sequencing protocol: The GRCF Sanger sequencing master mix formula is the following: 110 ul BigDye v3.1;
500 ul 5x Sequencing buffer; 100 ul of distilled water. Reactions are set up with 8 ul of mastermix, 2 ul of template/primer combination and cycled following Applied Biosystems cycling recommendations, but for 35 cycles instead of the recommended 25 cycles, in a
Life Technologies Veriti 96W Thermal Cycler 0.2 Ml version.
2.15 Genotyping of Patient DNA
Targeted single nucleotide polymorphism (SNP) genotyping was performed to confirm the results of the GRAHF cohort and for assessment of each of the identified SNPs in cohorts
A-E using an Applied Biosystems QuantStudio 7 real-time PCR System (Applied
Biosystems, Foster City, CA) and SNP-specific reagents obtained from Applied
Biosystems (rs144041999, Assay ID: C_160577079_10; rs144692954, Assay ID:
C_160606790_10; rs34656239, Assay ID: C__25628833_10). All reactions were carried out according to the manufacturer’s protocol and the output was analyzed using Applied
[29]
Biosystems QuantStudio Real-Time PCR Software. PCR products were analyzed by agarose gel electrophoresis and purified using Exonuclease III and Shrimp Alkaline
Phosphatase (Promega, Madison, WI) prior to Sanger sequencing. Products were sequenced using the fluorescent dideoxy terminator method of cycle sequencing (ABI
Prism BigDye Terminator v3.1 Cycle Sequencing kits using 1/16 of the “standard” protocol). Reaction clean-up was carried out using Applied Biosystems XTerminator purification system, following Applied Biosystem’s protocols. Sequencing reactions were run on a 3730xl DNA Analyzer (Applied Biosystems Division, Foster City, CA) following
Applied Biosystems' protocols. Sequence data was analyzed using Sequencher Software, version 5.4.6 (Gene Codes, Ann Arbor, MI). SNPs were identified using the software’s
“Call Secondary Peaks” function. All data was manually inspected.
2.16 Determination of linked variants
To determine whether two BAG3 SNVs (P63A - rs144041999 and P380S - rs144692954) were arranged in cis on the same chromosome or in trans, the BAG3 locus from exons 2-4 was amplified, cloned and sequenced using methods as shown in figure 8. In brief, primers were designed to PCR out from patient DNA the portion of BAG3 containing both the
P63A and P380S SNP (Figure 9A and 9B). The 7345 nucleotide PCR product was then inserted into a plasmids for sequencing (Figure 9C). Sequencing primers were then used on each amplified PCR product specific to where the P63A and the P380S mutations occurred (Figure 9D).
[30]
Figure 9: Methods used to determine configuration of P63A and P380S SNPs. A)
Representation of primer recognition sites for PCR of BAG3 B) Image of gel purified BAG3
and PCR parameters to get 7345 nucleotide product between primers shown in previous
2.17 Statistical Analysis Experimental data are presented as mean ± SEM for continuous variables. One-way
ANOVA with Tukey multiple comparisons adjustments were used to assess differences across the investigational groups. A Two-way ANOVA was also used for analysis of
[Ca2+]i transient and contraction amplitudes as a function of group and Isoproterenol. A commercially available software package (JMP version 12; SAS Institute, Cary, NC) was used for analysis of Ca2+ transients and contraction amplitudes. In all analyses, p < 0.05 was taken to be statistically significant. The control for each experiment was set as 1.0.
Data was analyzed using Graph Pad Prizm 6.
Statistical analyses on patient populations were conducted based on stratification/partitioning by BAG3 mutation (mutation versus no mutation), ischemia
(ischemic versus non-ischemic), and the concomitant interaction. Continuous variables were assessed using the Student’s t-test or ANOVA, as appropriate, and categorical variables were assessed using Chi-square or Fisher’s Exact tests. For the time-to-event analyses, an event was defined as death, transplant, or HF-related hospitalization. Survival
[31] was assessed using Kaplan-Meier method; the resulting curves were assessed using the log-rank test. Hazard ratios were estimated using Cox proportional-hazards models. All statistical analyses were conducted using SAS® 9.4 (SAS Institute). Statistical significance was defined as p<0.05. All reported p-values are two-sided where applicable and have not been adjusted for multiple comparisons unless otherwise noted.
[32]
CHAPTER 3
RESULTS
3.1 BAG3 haplo-insufficiency leads to impaired cardiac function
Generation of heterozygous BAG3 knockout mice
BAG3 floxed mice (Figure 10A), from the European Conditional Mouse Mutagenesis
Program (EUCOMM), crossed with αMHC driven Cre recombinase carrying mice had a
51% decrease in LV BAG3 protein expression as seen via western blot (Figure 10B).
Quantification of 8 BAG3+/+ LV samples and 6 cBAG3fl/+ samples confirmed this observation (Figure 10C, P<0.0001). Results of gel based genotyping for these mice
(Figure 10D) show in lane 1 a mouse which is not floxed (wild type band alone), in lane 2 a mouse which is heterozygously floxed (both a wild type and KO or floxed band) and the mouse in lane 3 is homozygously floxed (no wild type band but positive for KO or floxed band).
[33]
Figure 10: Generation of BAG3 heterozygous knockout mice A) Representation of floxing strategy for gene knockout B) Representative western blot of left ventricular BAG3 protein levels in BAG3+/+ and cBAG3fl/+ mice. C) Graphical representation of quantitation of BAG3 protein levels in left ventricles from BAG3+/+ and cBAG3fl/+ mice. D) Gel based genotyping of BAG3 floxed mice for wild type and floxed bands. ***P<0.0001 (t-test)
[34]
Heart Weight, Body Weight and Tibia Length in cBAG3+/- mice
Measurements of heart weight, body weight and tibia length reported no major differences between BAG3+/+ and cBAG3fl/+ mice. When the ratio of heart weight to body weight was taken, we noted a mean of 0.005 ± 0.0005 in the BAG3+/+ mice (N=3) and a mean of 0.004 ± 0.0002 in the cBAG3fl/+ mice (N=4) (Figure 11A). The ratio of heart weight to tibia length reflects the same trend with a mean of 0.006 ± 0.0003 in the
BAG3+/+ mice and a mean of 0.005 ± 0.0006 in the cBAG3fl/+ mice (Figure 11B). At 12 weeks of age there were no significant differences in heart weight/body weight or heart weight/tibia length between the two groups of mice.
[35]
Figure 11: Heart Weight, Body Weight and Tibia Length in cBAG3+/- mice A) Heart weight to body weight ratio in control (BAG3+/+) and cBAG3fl/+ mice at 12 weeks of age. B) Heart weight to tibia length weight in control BAG3+/+) and cBAG3fl/+ mice at 12 weeks of age. (t-test)
[36]
Serial measures of cardiac function in cBAG3+/- mice by echocardiography show
Functional Effect of Heterozygous Knockout of BAG3
Cardiac function was assessed in both BAG3+/+ and cBAG3fl/+ mice using echocardiography (Figure 12A). At 4 and 8 weeks of age there were no differences between the two groups in percent ejection fraction (%EF) or percent fractional shortening (%FS). However, beginning at 10 weeks of age we saw significant decreases in both %EF and %FS in BAG3fl/+ mice when compared to BAG3+/+ mice (Figure 12B and 12C).
Additionally, measured via echocardiography were heart rate (HR, no significant differences), left ventricular interior diameter at diastole and systole (LVIDd and LVIDs), left ventricular posterior wall thickness at diastole and systole (LVPWd and LVPWs), left ventricular volume at diastole and systole (LV Vol d and LV Vol s), stroke volume (SV) and cardiac output (CO) (Table 5).
[37]
Figure 12: Cardiac function in BAG3+/+ and cBAG3fl/+ mice A) Representative M-mode images from BAG3+/+ and BAG3fl/+ mice at 4, 8, 10 and 12 weeks of age B) Quantification of percent ejection fraction at 4, 8, 10 and 12 weeks of age C) Quantification of percent fractional shortening at 4, 8, 10 and 12 weeks of age. *P=0.0004, **P<0.0001 (one way ANOVA)
[38]
Table 5: Summary table of echocardiographic analysis of BAG3+/+ and cBAG3fl/+ mice at 4, 8,
10 and 12 weeks of age. HR=Heart Rate (bpm), CO=Cardiac Output (mL/min), LVIDd and
LVIDs=Left Ventricular Interior Diameter during diastole and systole respectively (mm),
LVPWd and LVPWs=Left Ventricular Posterior Wall during diastole and systole respectively
(mm), %FS=Percent Fractional Shortening, %EF=Percent Ejection Fraction, LV Vol d and LV
Vol s=Left Ventricular Volume during diastole and systole respectively (µL), SV=Stroke
Volume (µL). *P=0.02, **P=0.01, #P=0.03 (one way ANOVA)
[39]
Single cell measures of Contractility and Calcium Handling in cBAG3+/- mice
Contractility (% cell shortening) in adult myocytes isolated from 10 to 12 week old cBAG3fl/+ mice did not differ from that seen in myocytes isolated from BAG3+/+ control mice (Figure 13A). By contrast, in the presence of isoproterenol (1 µM), single cell contractility was significantly lower (p=0.046) in cBAG3fl/+ mice than in myocytes isolated from cBAG3+/+ mice (Figure 13B). Similarly, Ica amplitudes did not differ between cBAG3+/+ and cBAG3+- mice at baseline (Figure 13C) but were significantly lower
(p<0.0001) in myocytes isolated from cBAG3+/- mice in the presence of isoproterenol
(Figure 13D).
[40]
Figure 13: Contractility and calcium responsiveness in isolated cardiomyocytes from
BAG3+/+ and BAG3fl/+ mice A) % cell length in cells at baseline B) % cell length with isoproterenol treatment (ISO) C) Intracellular calcium concentrations at baseline D)
Intracellular calcium concentrations with ISO treatment (two way (ANOVA)
[41]
Measure of Autophagic Flux in cBAG3+/- mice by GFP-RFP-LC3 reporter construct and autophagy by western blot shows increased autophagy in cBAG3+/- myocytes
Upon treatment with BafilomycinA1 there is an increase in LC3B puncta in control cells expressing the GFP-RFP-LC3B construct (Figure 14). Cardiomyocytes from cBAG3fl/+ mice, when treated with Bafilomycin did not have a significant increase in LC3B puncta
(Figure 14). We next measured LC3 levels by western blot in order to confirm the findings using the GFP-RFP-LC3 reporter construct. Western blot of adult cardiomyocytes isolated from cBAG3fl/+ and control mice treated with BafilomycinA1 for 2 hours confirmed the findings of cells with expression of the reporter construct.
Figure 15A shows a representative western blot of LC3, BAG3 and GAPDH levels in isolated cells. BAG3 levels were significantly reduced in cBAG3fl/+ cells when compared to control cells (Figure 15B). LC3 protein is significantly increased in control cells upon treatment with BafilomycinA1 (Figure 15C). However, in cBAG3fl/+ cells there is no significant difference in LC3 expression levels following treatment with BafilomycinA1
(Figure 15D).
[42]
Figure 14: Measurement of autophagic flux using GFP-RFP-LC3B construct. Representative confocal images of adult cardiomyocytes from control (top panels) and cBAG3fl/+ (lower panels) mice, untreated (left panels) and BafilomycinA1 treated (right panels). The graph shows quantification of LC3B puncta per cell. BAG3+/+ untreated N = 10, BAG3+/+ treated N
= 11, cBAG3fl/+ untreated N = 12 and cBAG3fl/+ treated N = 14. *P = 0.03, **P = 0.007,
***P<0.0001. (Two way ANOVA)
[43]
Figure 15: Isolated adult cardiomyocytes from BAG3+/+ and cBAG3fl/+ mice. A)
Representative image of western blot showing BAG3, LC3 and Gapdh in BAG3+/+ and cBAG3fl/+ cardiomyocytes with and without BafilomycinA1 treatment. B) Quantification of
BAG3 protein expression in BAG3+/+ and cBAG3fl/+ cardiomyocytes. C) Quantification of LC3 expressiom levels in BAG3+/+ cardiomyocytes with and without BafilomycinA1 treatment. D)
Quantification of LC3 expression levels in cBAG3fl/+ cardiomyocytes with and without
BafilomycinA1 treatment. *P = 0.0006, ***P<0.0001 (Two way ANOVA)
[44] cBAG3+/- myocytes demonstrate increased apoptosis by confocal microscopy when compared with controls
Staining for apoptotic cell death in isolated adult cardiomyocytes from BAG3+/+ and cBAG3fl/+ mice showed an increase in apoptotic cell death in the cBAG3fl/+ cardiomyocytes
(Figure 16A). Quantification of these differences showed less than 8% of the cell population in the control (BAG3+/+) cardiomyocytes were undergoing apoptotic cell death, while 24% of the cell population in the cBAG3fl/+ cardiomyocytes were undergoing apoptotic cell death (Figure 16B).
[45]
Figure 16: Increased apoptosis in cBAG3+/- mice when compared to BAG3+/+ A)
Representative confocal images of cBAG3+/+ and cBAG3+/- stained for phosphatidylserine
(red), compromised nuclei (green) and a cytoplasm dye for viable cells (blue). B)
Quantification of percent apoptotic cells per field in cBAG3+/+ and cBAG3+/- cardiomyocytes. n= at least 10 fields from 3 separate isolations. **P=0.006. (One way
ANOVA)
[46]
3.2 Identification of BAG3 variants enriched in African American patient populations
Sequence analysis of BAG3 in DNA accrued from individuals of African ancestry enrolled in the Genetic Risk Assessment of Heart Failure in African Americans (GRAHF) study identifies novel variants
In total, Genomic DNA from a total of 509 African Americans with DCM was accrued from three independent studies. Sanger sequencing of the GRAHF cohort revealed 18 variants (Table 6), eight of which were synonymous. Initially, we examined the Genetic
Risk Assessment of Heart Failure in African Americans (352 patients; GRAHF, cohort A) cohort (McNamara et al., 2006; McNamara et al., 2009). In cohort A we found 4 individuals carrying the p.Pro63Ala variant, these same individuals were also carrying the p.Pro380Ser variant. Following this discovery we determined that these two variants occur on the same allele and can therefore be classified as linked (Figure 9). Additionally, in cohort A we observed 4 individuals carrying the p.Ala479Val variant of BAG3.
Interestingly all of these carriers were classified as having IDC. Because of this we examined two additional IDC and ischemic CM patient populations of African ancestry for
BAG3 variants.
Genetic Risk Assessment of Cardiac Events study (GRACE; 111 patients, cohort B)
(McNamara et al., 2001; McNamara et al., 2004); and the Myocarditis and Acute
Cardiomyopathy Trial-2 (71 patients; IMAC-2, cohort C) (Dennis M McNamara et al.,
2011b) comprised the remaining two cohorts. Patients were excluded from analysis if they had acute myocarditis, peri-partum cardiomyopathy or any potentially reversible cause for
DCM (Dennis M McNamara et al., 2011b). Patients in GRAHF and GRACE were followed
[47] to an endpoint of freedom from death or HF hospitalization. Subjects in IMAC-2 were followed to the endpoint of HF hospitalization, heart transplantation or death.
Ultimately, four SNVs met the criteria for inclusion in this study: p.Pro63Ala
(10:121429369 C/G; rs133031999); p.His83Gln (10:151331972; rs151331972);
Pro380Ser (10:121436204 C/T; rs144692954); and Val479Ala (10:121436502 C/T, rs34656239). We also identified a 3 nucleotide in-frame insertion that added an alanine to the protein at position 160 (p.Ala160dup;10:121429647 A/AGCG). The Sanger results were confirmed by targeted sequencing. The linked SNVs are designated as p.Pro63Ala+Pro380Ser for the remainder of this study.
[48]
Table 6: BAG3 variants found to be present in African American patient population from
GRAHF, GRACE and IMAC2 studies. NS=Non-Synonymous, S=Synonymous, II=Inframe
Insertion, AA=African American, EA=European American
[49]
BAG3 variants identified in African ancestry occur in highly conserved regions of BAG3
Alignment of Homo sapiens (Human), Mus musculus (Mouse), Rattus norvegicus (Rat),
Rhesus macaque (Macaque), Canis familiaris (Dog) and Gallus gallus (Chicken) BAG3 protein sequences shows the p.His83Gln, p.Pro380Ser and p.Ala479Val BAG3 variant regions are highly conserved across mammals (Figure 17).
[50]
Figure 17: Protein sequence alignment of human, mouse, rat, macaque and chicken shows high conservation across the mammals (human, mouse, rat and macaque) at the variant sites. While chicken is conserved only at the A479V locus.
[51]
Demographics of subjects with and without BAG3 variants were equivalent Table 7 shows that there were no significant differences between patients with BAG3 variants and patients without BAG3 variants in the following: sex (presented as percent males), heart rate, systolic blood pressure, diastolic blood pressure, baseline ejection fraction, changes in ejection fraction when assessed 6 months after baseline, left ventricular end diastolic dimension at baseline or 6 months later, New York Heart Association
(NYHA) classification, presence of a pacemaker (ICD), diagnosis of diabetes, or medications being taken.
[52]
BAG3 SNV No BAG3 SNV Parameter p-Value (N=51) (N=458)
Age 55.6 ± 13.4 54.5 ± 13.6 0.578 Sex (% Male) 58.8 61.1 0.748 Heart Rate 72.4 ± 12.9 75.5 ± 13.3 0.119 Systolic BP 126.6 ± 15.3 124.1 ± 18.5 0.348 Diastolic BP 76.8 ± 10.9 76.7 ± 11.2 0.930 EF at Baseline 30.6 ± 9.5 30.4 ± 10.2 0.918 Change in EF at 6 Months 4.6 ± 9.8 4.3 ± 10.2 0.851 LVEDD at Baseline 6.3 ± 1.3 6.4 ± 1.2 0.594 Change in LVEDD at 6 Months -0.2 ± 1.1 -0.2 ± 1.0 0.897 NYHA III or IV (%) 80.4 80.3 0.983 ICD (%) 35.7 34.0 0.896 Diabetes (%) 24.4 37.5 0.083 Medications: Beta Blockers (%) 88.2 82.3 0.287 ACE Inhibitors or ARBs (%) 98.0 92.8 0.234 Aldosterone Antagonists (%) 33.3 35.4 0.773 Hydralazine and Isosorbide 54.1 44.9 0.292 Dinitrate (%)
Table 7: Comparison of demographics between patients carrying BAG3 variants and patients
without BAG3 variants. BP=Blood Pressure, EF=percent Ejection Fraction, LVEDD=Left
Ventricular End Diastolic Dimension, NYHA=New York Heart Association Classification,
ICD=Implantable Cardioverter Defibrillator (pacemaker) (One way ANOVA)
[53]
Prevalence of BAG3 Variants in African American and European American Heart Failure and Control Populations The prevalence of the four BAG3 variants in the 418 patients with IDC in cohorts A, B, and C (49 of 418 subjects; 11.62%) was greater than the prevalence of the four variants in patients with ischemic HF from cohorts A, B, and C (8 of 104 subjects; 7.56%) when adjusted for multiple alleles; however, the difference was not statistically significant (Table
8A). Similarly, the proportion of patients in cohorts A, B and C with IDC and one of the four BAG3 variants was not significantly different than the proportion of subjects with a
BAG3 variant in the sum of the corresponding gnomAD dataset for each variant (10.09%).
By contrast, the proportion of subjects in the three cohorts who harbored a BAG3 variant
(11.71%) was significantly higher (p < 0.0001) than the prevalence of the four BAG3 variants among over 60,000 subjects of European ancestry in the gnomAD European data set (0.022%; p<0.0001) and was significantly greater than in a reference population of 394 individuals with European ancestry and IDC that in fact had no BAG3 variants. (Boston cohort; 0.000% BAG3 variants; p<0.0001) (Table 8B).
[54]
Table 8: BAG3 variant frequencies in patient populations A) Frequencies of each BAG3 variant in patients of African ancestry, a European reference population, and gnomAD populations of both African and European ancestry. B) Statistical comparison of probabilities of BAG3 variant occurrence in each population. (Fisher’s Exact Test)
[55]
Analysis of effects of carrying a BAG3 variant and heart failure outcomes (event free survival) We next sought to determine whether the presence of any one of the four BAG3 variants was associated with a worse outcome as reflected by the combined outcome variable of a
HF hospitalization, heart transplantation or death. As seen in Figure 18, when compared with HF subjects with both ischemic and non-ischemic disease who did not carry one of the four BAG3 variants, subjects having a BAG3 variant had a significantly higher
(p=0.010) incidence of an adverse event. Similarly, individuals with non-ischemic HF who carried a BAG3 variant had a worse outcome when compared with patients who did not have a BAG3 variant (Figure 19; p=0.018). In subjects with ischemic HF and a BAG3 mutation, there was a trend towards a worse outcome; however, the difference was not statistically significant (Figure 20; p=0.177). Using the Cox proportional hazard analysis, we determined that the risk of a carrier of one of the four BAG3 variants having an adverse event was 1.906 times higher than for an individual with HF who did not have a BAG3 variant (95% CL: 1.157-3.141, p=0.011).
[56]
Figure 18: Kaplan Meier curve shows event-free survival in all patients with or without a
BAG3 variant.
[57]
Figure 19: Kaplan Meier curve shows event-free survival in patients with non-ischemic HF with or without a BAG3 variant.
[58]
Figure 20: Kaplan Meier curve shows event-free survival in patients with ischemic dilated cardiomyopathy.
[59]
BAG3 Protein and mRNA in HF Patients With and Without BAG3 Variants We performed western blot analysis of BAG3 expression and qPCR, to quantify BAG3 mRNA, in failing human heart and non-failing control hearts obtained from subjects of
African ancestry. As seen in figure 21A and quantified in figure 21B, BAG3 protein levels were significantly reduced in hearts extracted from transplant recipients who had
IDC (p=0.0001, n=23) or ischemic HF (p<0.0001, n=16) when compared with non- failing controls (n=4). As we reported previously, BAG3 mRNA levels from IDC hearts
(n=18) and from DCM hearts (n=13) with ischemic heart disease were not different from
BAG3 mRNA levels in non-failing controls (n=4) (Figure 21C). Importantly, targeted sequence analysis of each heart found that one heart harbored the p.His83Gln variant, two harbored the p.Pro63Ala+Pro380Ser variant, and one harbored the p.Ala160dup insertion. Despite each heart coming from a patient with severe LV dysfunction requiring heart transplant, BAG3 protein levels were supra-normal in the two p.Pro63Ala+Pro380 (p=0.01, T-test compared to control) hearts suggesting that expression of the BAG3 variant had a dominant-negative effect which over-came the inherent regulatory mechanism governing BAG3 expression. By contrast, BAG3 expression levels were unchanged in the p.His83Gln heart and could not be appreciated in a heart harboring the p.Ala160dup, making them potential targets for gene therapy.
[60]
Figure 21: BAG3 protein and mRNA levels in patient ventricle A) Representative western blot of protein isolated from human hearts with severe left ventricular dysfunction secondary to dilated cardiomyopathy. Samples obtained from hearts that were found to carry a BAG3 variant are indicated by the red squares, labeled a thru c. B) Quantification of BAG3 protein expression levels: Control n=4, Ischemic n=16, IDC n=23. *P=0.01, **P=0.0001, ***P<0.0001.
C) Quantification of qPCR for BAG3 in the failing and non-failing human hearts with GAPDH as internal control. Control n=4, Ischemic n=13, IDC n=18 (One way ANOVA or t-test)
[61]
Pathogenicity of BAG3 Variants Assessed in AC16 Cells We next undertook studies to assess the effects of BAG3 variants on the two primary actions of BAG3 in the cell: autophagy and apoptosis. As seen in figure 22, expression levels of each BAG3 variant are equal to expression of wild type BAG3 in AC16 cells transfected with either GFP, Wt-BAG3 or a BAG3 variant.
AC16 cells were transfected with either an empty plasmid or with a plasma containing wild-type BAG3, c.187C>G+c.1138C>T (p.Pro63Ala+p.Pro380Ser), c.249C>A
(p.His83Gln), c.474_476dupGGC (p.Ala160dup), or c.1436C>T (p.Ala479Val) and co- transfected with Adv-RFP-GFP-LC3. When the cells were stressed with hypoxia, there was a significant increase in LC3 in cells that had been transfected with either the empty plasmid or with wild-type BAG3; however, the response to hypoxia was significantly diminished in AC16 cells over-expressing each of the four BAG3 variants as there was no significant increase in LC3 (Figure 23A and 23B).
Cells transfected with BAG3 variants showed significantly more Annexin-V/PI positive cells in response to hypoxic stress than did cells transfected with a plasmid containing wild-type BAG3 (Figure 24A and 24B). Thus, by contrast with wild-type BAG3, the
BAG3 variants were unable to impede hypoxia-induced apoptosis.
[62]
Figure 22: AC16 cells transfected for 48 hours with c.GFP, c.WtBAG3, c.187C>G + c.1138C>G, c.249C>A or c.1436C>T plasmids.
[63]
Figure 23: A) Representative confocal images from AC16 cells transfected with either empty plasmid, a plasmid containing wild-type BAG3 or c.187C>G+c.1138C>T
(p.Pro63Ala+p.Pro380Ser), c.249C>A (p.His83Gln), c.474_476dupGGC
(p.Ala160dup), or c.1436C>T (p.Ala479Val) and co-transfected with Adv-RFP-GFP-
LC3. Red puncta represent increased LC3 in autophagolysosomes in which the GFP has been quenched by the increased acidity after lysosomal-autophagasome fusion.
B) Quantification of images (8-42 cells/condition). **P=0.0002, ***P<0.0001 (Two way ANOVA) [64]
Figure 24: A) is a representative confocal image of AC16 cells stained with Annexin-
V/PI in order to distinguish viable cells from apoptotic cells. Apoptotic cells appear green and red, viable cells are blue. B) Quantification of images from approximately
200 cells per condition. **P=0.0002, ***P<0.0001 (Two way ANOVA)
[65]
Calcium Handling and Contractility in Isolated Adult Cardiomyocytes Expressing BAG3 Variants As we previously demonstrated, percent contractility in response to isoproterenol stimulation is decreased with haplo-insufficiency of BAG3. This decrease can be rescued however, with restoration of WtBAG3 levels using adenovirus. To examine whether the
BAG3 variants were capable of restoring the cardiomyocytes response to isoproterenol we expressed either Ad-63/380BAG3 or Ad-A479VBAG3 in isolated adult cardiomyocytes from both BAG3+/+ and cBAG3fl/+ mice. We found that, while A479VBAG3 was able to increase contractility above that of +/-GFP cells in response to isoproterenol neither variant was able to restore contractility to levels of WtBAG3 (Figure 25A and 25B).
We also examined time it took for intracellular calcium to decrease by 50% in isolated adult cardiomyocytes expressing BAG3 variants. There were no significant differences with expression of either BAG3 variant, however, with expression of WtBAG3 there was an increase in time when treated with isoproterenol (Figure 25C-25E).
[66]
Figure 25: Contractility and calcium transients with BAG3 variant expression A) Percent cardiomyocyte length without and with isoproterenol stimulation with expression of
63/380BAG3. B) Percent cardiomyocyte length without and with isoproterenol stimulation with expression of A479VBAG3. C) Calcium transient time with and without isoproterenol treatment with expression of WtBAG3. D) Calcium transient time with and without isoproterenol treatment with expression of 63/380BAG3. E) Calcium transient time with and without isoproterenol treatment with expression of A479VBAG3. #P=0.02, *P=0.0007,
**P=0.0002, ***P<0.0001 (Two way ANOVA)
[67]
Autophagy in Isolated Adult Cardiomyocytes with BAG3 Variant Expression The same trend in autophagy is seen in control and cBAG3fl/+ cells infected with an ad- null adenovirus when expression of the GFP-RFP-LC3B construct is assessed with and without BafilomycinA1 treatment. There is an increase in LC3B puncta in control cells expressing the GFP-RFP-LC3B construct, which is not seen in cardiomyocytes from cBAG3fl/+ mice, when treated with Bafilomycin (Figure 26). Cardiomyocytes infected with adWt-BAG3 show an increase in LC3B puncta with BafilomycinA1 treatment in both control and cBAG3fl/+ cells (Figure 27). This rescue of autophagic flux is not seen with expression of either p.Pro63Ala + Pro380Ser or p.Ala479Val BAG3 (Figures 28 and 29).
Quantification of controls and p.Pro63Ala + Pro380Ser is seen in figure 30A and p.Ala479Val is seen in figure 30B.
[68]
Figure 26: Representative confocal images of adult cardiomyocytes isolated from BAG3+/+
(top two panels) and cBAG3fl/+ (cBAG3+/-) (bottom two panels) mice expressing ad-null and the GFP-RFP-LC3B reporter construct with (panels 2 and 4) and without (panels 1 and 3)
BafilomycinA1 treatment. From left to right, RFP, GFP, merge and bright field. Scale bar =
5µm
[69]
Figure 27: Representative confocal images of adult cardiomyocytes isolated from BAG3+/+
(top two panels) and cBAG3fl/+ (cBAG3+/-) (bottom two panels) mice expressing ad-WtBAG3 and the GFP-RFP-LC3B reporter construct with (panels 2 and 4) and without (panels 1 and 3)
BafilomycinA1 treatment. From left to right, RFP, GFP, merge and bright field. Scale bar =
5µm
[70]
Figure 28: Representative confocal images of adult cardiomyocytes isolated from BAG3+/+
(top two panels) and cBAG3fl/+ (cBAG3+/-) (bottom two panels) mice expressing ad-null and the GFP-RFP-LC3B reporter construct with (panels 2 and 4) and without (panels 1 and 3)
BafilomycinA1 treatment. From left to right, RFP, GFP, merge and bright field. Scale bar =
5µm
[71]
Figure 29: Representative confocal images of adult cardiomyocytes isolated from BAG3+/+
(top two panels) and cBAG3fl/+ (cBAG3+/-) (bottom two panels) mice expressing ad-null and the GFP-RFP-LC3B reporter construct with (panels 2 and 4) and without (panels 1 and 3)
BafilomycinA1 treatment. From left to right, RFP, GFP, merge and bright field. Scale bar =
5µm
[72]
Figure 30: Quantification of autophagic flux as measured by increased LC3 in response to bafilomycinA1 treatment. There was a significant increase in LC3 levels in control cells with bafilomycin treatment. However, in cBAG3fl/+ cells expressing ad-null (+/-Ad-Null) there was no significant increase in LC3 expression even with bafilomycinA1 treatment. This impairment of autophagic flux was rescued by expression of Ad-WtBAG3. Neither p.AlaA479Val or p.Pro63Ala + Pro380Ser BAG3 was able to rescue the impaired autophagic flux. ***P<0.0001, *P=0.002 when compared to +/+Ad-null cardiomyocytes. (Two way
ANOVA)
[73]
Apoptotic Cell Death with Expression of BAG3 Protein Domain Variants Adult cardiomyocytes infected with ad-null and stained for phosphatidylserine (red), compromised nuclei (green) or viable cells (blue), showed presence of significantly fewer apoptotic cells than adult cardiomyocytes infected with either p.Pro63Ala + Pro380Ser or p.Ala479Val BAG3 (Figure 31A). Agreeing with our previous findings, cells infected with wild-type BAG3 had significantly less apoptosis than cBAG3fl/+ cells with ad-null, as well as less apoptosis than cells expressing either p.Pro63Ala + Pro380Ser or p.Ala479Val BAG3. Quantification of these findings is presented in figure 31B.
[74]
Figure 31: A) Representative confocal images of Adult cardiomyocytes cells stained for viable cells (blue, upper left quadrant of each image), phosphatidylserine (red, upper right quadrant of each image) and compromised nuclei (green, lower left quadrant of each image) to distinguish viable cells from apoptotic cells. Lower right quadrant is merge of the three wavelengths. B) Quantification of images from a minimum of 5 replicates, approximately 7 cells per field. *P<0.0001 as compared to BAG3+/+ Ad-null. (Two way ANOVA)
[75]
Cardiac Function in vivo with Expression of BAG3 Variants When the BAG3 variants present in protein binding domains were expressed in BAG3+/+ and BAG3fl/+ mice and examined for differences in function we found the following:
There were no statistically significant differences in heart rate between experimental and control groups over time with multiple comparisons, allowing us to assess functional differences as independent of heart rate.
When comparing BAG3+/+ mice expressing AAV9-GFP (+/+GFP) and cBAG3fl/+ mice expressing AAV9-GFP (+/-GFP) there was a significant decrease in both %EF and %FS by 6 weeks post injection when the mice were between 10 and 12 weeks old (P=0.03 for both comparisons) (Figure 32A). There were also significant decreases in LVPW during systole in +/-GFP mice by 4 weeks post injection, which was consistent through 6 weeks post injection (P=0.03).
There was no difference between %EF and %FS +/+GFP and cBAG3fl/+ mice expressing
AAV9-WtBAG3 (+/-WtBAG3) (Figure 32B) or between +/+GFP and BAG3+/+ mice expressing AAV9-WtBAG3 (+/+WtBAG3). There were no differences at any time points between +/-WtBAG3 and +/+GFP or +/+WtBAG3 in CO, LVIDs or LV Vol s. There were differences at 6 weeks post injection in both LVPWd and LVPWs between +/+GFP and
+/-WtBAG3, but no differences in LVPW between +/+WtBAG3 and +/-WtBAG3. LV
Vol d and LVIDd were both significantly increased in +/-WtBAG3 two weeks post AAV injection, but these differences were rescued by 4 weeks post-injection (Table 9). cBAG3fl/+ mice expressing p.Pro63Ala + Pro380Ser BAG3 (+/-63/380) showed a significant decrease in cardiac function (both %EF and %FS) when compared to +/+GFP
[76] mice by 2 weeks post injection (P=0.02), these decreases continued to be statistically significant at 4 and 6 weeks post injection (P=0.004 and 0.008 respectively) (Figure 32C).
Cardiac function was significantly higher in BAG3+/+ mice expressing p.Pro63Ala +
Pro380Ser (+/+63/380) at 2 weeks post injection when compared to +/-63/380 mice. This difference was gone by 4 weeks post injection when both +/+63/380 and +/-63/380 mice had decreased cardiac function (Figure 32D). Additionally, there was significant wall thinning in +/-63/380 mice by 4 weeks post injection as evidenced by significant decreases in both LVPWs and LVPWd when compared to +/+GFP mice (at 4 weeks P=0.002 and
0.04, at 6 weeks P=0.01 and 0.06 respectively). There was also significant chamber dilatation in +/-63/380 mice as early as 2 weeks post injection shown by increases in both
LVIDs and LVIDd (at 2 weeks P=0.03 and P=0.04, at 4 weeks P=0.0001 and 0.004, and at
6 weeks P=0.004 and P=0.03 respectively). There were concomitant increases in chamber volume (LV vol s and LV Vol d) by 2 weeks post injection in +/-63/380 mice when compared to +/+GFP mice (at 2 weeks P=0.03 and P=0.04, at 4 weeks P=0.0003 and 0.003, and at 6 weeks P=0.005 and P=0.03 respectively) (Table 9). p.AlaA479Val expression rescued cardiac function in cBAG3fl/+ mice (+/-A479). There were no significant differences in %EF or %FS between +/+GFP and +/-A479 mice (Figure
32E). However, at 4 and 6 weeks post injection, both %EF and %FS were significantly higher in +/-A479 mice than +/-GFP mice (P=0.01 at both 4 and 6 weeks for both %EF and %FS) (Figure 32F). There were no significant differences in CO, SV, LV Vol s, LV
Vol d, LVIDs, LVIDd or LVPWs between +/+GFP and +/-A479 mice. There was a significant decrease in LVPWd in +/-A479 mice when compared to +/+GFP mice at 6 weeks post injection, but not before. There were no significant differences between
[77]
BAG3+/+ mice expressing p.AlaA479Val BAG3 (+/+A479) and +/-A479 BAG3 in %EF,
%FS, CO, LV Vol s, LV Vol d, LVIDs, LVIDd, LVPWs or LVPWd. There was a significant increase SV in +/A479 mice at 6 weeks post injection when compared to
+/+A479 mice (P=0.02) (Table 9).
[78]
Figure 32: Graphical representation of %EF in control and cBAG3fl/+ mice with AAV9-GFP,
AAV9-WtBAG3 or AAV9-BAG3 variant expression. A) %EF of +/+GFP versus +/-GFP B) %EF of
+/+GFP vs +/-WtBAG3 C) +/+GFP vs +/-63/380 D) +/+63/380 vs +/-63/380 E) +/+GFP vs +/-
A479 F) +/-GFP vs +/-A479 *denotes significant p values as stated in text
[79]
Table 9: Summary of all echocardiography results in control and cBAG3fl/+ mice with AAV9-
GFP, AAV9-WtBAG3 or AAV9-BAG3 variant expression. Statistically significant differences stated in text. (Two way ANOVA)
[80]
CHAPTER 4 DISCUSSION At the beginning of the studies outlined in this thesis, we sought to develop an animal model in which to study the biology of BAG3 in the heart. Earlier studies in our laboratory and by others had shown that deletions, truncations and premature stop codons in BAG3 were causative of left ventricular dysfunction and HF in probands who underwent next generation sequencing. Notably, these studies showed that these BAG3 variants segregated across family members with a HF phenotype. Studies also demonstrated that animal models of HF secondary to myocardial infarction, trans-aortic constriction and ischemia/reperfusion demonstrated significant reductions in levels of BAG3. BAG3 was of great interest to cancer biologists because over-expression in many cancers led to resistance to chemotherapy as well as increased invasiveness and metastatic potential, however, far less was known about the role of BAG3 in the heart. If BAG3 was to serve as a therapeutic target, we would need to know a great deal more about its biology in the heart and the prevalence and incidence of genetic variants. Furthermore, we would need an animal model in which to evaluate regulation of both wild-type BAG3 and BAG3 variants.
Our first challenge was to create a mouse with haplo-insufficiency of BAG3. This challenge proved to be less daunting than expected as previous investigators might have identified the HF phenotype in their own knock-out models if they had simply followed their mice for a longer time period. However, achieving our secondary goals proved to be far more challenging – yet highly informative. We had thought that in sequencing the
BAG3 gene in HF patients of African ancestry we would find a small number of deletions or truncations – consistent with probands sequenced as part of several European studies.
The identification of a group of common non-synonymous single nucleotide variants was
[81] completely unexpected as was the early suggestion that they were associated with a worse outcome in patients with HF. Fortunately, we were able to acquire DNA from African
American subjects enrolled in additional clinical trials and with the availability of mice lacking one BAG3 allele, we had the tools in hand to understand the clinical significance of these novel variants.
BAG3 and the heart: Animal models In 2006, Homma reported for the first time that BAG3 plays an important role in the heart when he and his colleagues generated mice harboring either a homozygous or a heterozygous deletion in BAG3. Global knockout of BAG3 resulted in a profound myofibrillar myopathy with death by four weeks of age (Homma et al., 2006). However, mice with a heterozygous deletion of BAG3 had a normal cardiac phenotype at 4 weeks of age. While, Fang et al were also unable to generate a mouse model of HF secondary to haplo-insufficiency of BAG3, they did confirm our findings that in the failing human heart, without the presence of BAG3 mutations, BAG3 protein levels are decreased (Fang et al.,
2017; Feldman et al., 2014b). Furthermore, they also confirmed our finding that murine models of LV dysfunction secondary to ischemia reperfusion, myocardial infarction or after trans-aortic constriction (TAC) lead to decreased BAG3 protein levels and heart failure (Feldman, Gordon, Wang, Song, Zhang, Myers, Tilley, Gao, Hoffman, Tomar,
Madesh, Rabinowitz, Koch, Su, Khalili, & Cheung, 2016b; Knezevic et al., 2016; Su et al.,
2016). These observations in mice were discordant from early observations in patients with mutations in BAG3. For example, in the first report of a BAG3 mutation in humans, Selcen described three children with a non-synonymous single nucleotide polymorphism (P209L) that resulted in a profound myofibrillar myopathy that was accompanied by hypertrophic
[82] cardiomyopathy and giant axon disease. (H. Lee et al., 2012; Odgerel et al., 2010; Selcen et al., 2009). Subsequent to the report of Selcen, Norton described a family in which a heterozygous deletion mutation in BAG3 was associated with cardiac dilatation and diminished LV function in the absence of neurologic disease. The trait was inherited in an autosomal dominant manner (Norton et al., 2011a).
In view of the human data, we pursued efforts to generate a mouse with heterozygous knockout of the BAG3 gene that would result in LV dysfunction. To that end, we used
BAG3 single allele floxed (cBAG3fl/+) mice and αMHC-Cre mice (Agah et al., 1997b) to generate a mouse with heterozygous constitutive and cardiac-restricted BAG3 knockdown.
In contrast with earlier efforts, the αMHC-Cre mice with haplo-insufficiency of BAG3, showed the characteristic features seen in humans with BAG3 haplo-insufficiency: diminished responsiveness to -adrenergic stimulation, a significant alteration in autophagic flux and a robust increase in apoptosis. Thus, the cBAG3fl/+ mice provide for the first time a useful model for studying the biology of BAG3 mutations that result in haplo-insufficiency. Importantly, young cBAG3fl/+ mice have significant LV dysfunction in the absence of significant dilatation or hypertrophy, a phenotype that is remarkably different from the profound chamber dilation seen in mice after a myocardial infarction and the marked hypertrophy seen after trans-aortic constriction – but consistent with the phenotype seen in humans. Several caveats are worth noting. First, our mice had cardiac- specific KO as versus global KO in the earlier efforts to create mice with a HF phenotype
(Homma et al., 2006). Second, we generated mice in a C57BL/6 background whereas other investigators have used different strains. And finally, the phenotype in our mice did not
[83] develop until between week 8 and 10 with LV dysfunction being delayed in female when compared with male mice – a factor not noted in other studies.
Our cBAG3+/- mice provide an interesting window into the early stages of LV dysfunction.
Fang et al recently showed that cardiac-restricted BAG3-KO and Glu455Lys-knockin led to the development of a dilated cardiomyopathy due to decreased binding to HSP70 and a subsequent decrease in autophagy flux (Fang et al., 2017). They also showed that decreased coupling with HSP70 in both BAG3-KO and Glu455Lys mice was responsible in part for the phenotype. BAG3-KO also decreased contractility but not [Ca2+]I transient amplitudes in single myocytes. By contrast, we found that 10 week old cBAG3fl/+ myocytes had normal contractility and Ca2+ amplitudes at rest – but diminished contractility and [Ca2+]I transient amplitudes in response to isoproterenol. Furthermore, while the reduction in autophagy flux found in cBAG3fl/+ mice was modest, there was a robust increase in apoptosis that was not observed by Fang et al. Thus, cBAG3fl/+ mice demonstrate a phenotype that accurately mirrors the phenotype seen in individuals with haplo- insufficiency, yet differs from the phenotype seen with homozygosity.
Our results in the cBAG3+/- mice provide several important clues regarding the pathobiology of reduced levels of BAG3. First, they confirmed our hypothesis that haploinsufficiency of BAG3 results in development of decreased cardiac function and lead us to the hypothesis that genetic variants that alter one allele of BAG3 can alter the cardiac phenotype. Second, the present study demonstrates that a BAG3 variant on a single allele has multiple adverse effects on the heart including decreased β-adrenergic responsiveness, diminished autophagy flux and increased apoptosis and these adverse effects are seen even early in the course of disease before the ventricle has dilated. Third, our results suggest
[84] that cBAG3+/- mice can serve as a useful model for mechanistic studies directed at understanding the molecular and cellular regulation of BAG3 in the heart. And finally, this model was ideal for expression and investigation of BAG3 variants.
BAG3 variants
We identified four common (>1%) non-synonymous SNVs and one single amino acid insertion in a cohort of subjects of African descent with DCM who were enrolled in
GRAHF, a sub-study of the AHeFT trial. We showed that the p.Pro63Ala and the p.Pro380Ser variants were linked in cis. Neither the p.Pro63Ala + p. Pro380Ser nor the p.Ala479Val genotypes were found in GRAHF subjects whose HF was secondary to ischemic or valvular heart disease. The allele frequencies of both the p.Pro63Ala + p.
Pro380Ser and the p.Ala479Val variants are very low in individuals of non-Finnish
European ancestry, consistent with admixture. Bio-informatic prediction of functional effect predicted that the p.Pro63Ala + p. Pro380Ser variants were benign or likely benign.
However, analysis of 842 nsSNVs from 639 patients with DCM using 13 in silico pathogenicity prediction algorithms revealed high levels of heterogeneity and discordance
(Mueller et al., 2015). The ClinVar database (Landrum et al., 2014) also designated the variants as benign based on its frequency of 1.0% (39/3738) in African American chromosomes from a broad population by the NHLBI Exome Sequencing Project
(http://evs.gs.washington.edu/EVS; dbSNP rs144041999). The p.Ala479Val variant was found through clinical genetic testing performed by several labs who submitted data to
ClinVar as having conflicting evidence for pathogenicity. In silico analysis with PolyPhen-
2 predicts the variant to be probably damaging, mutation taster predicts it to be disease causing, with a Grantham score of 64. The alanine at codon 479 is conserved across species,
[85] as are neighboring amino acids. Our in vitro and in vivo studies indicated that the p.Pro63Ala + p. Pro380Ser and p.Ala479Val variants adversely affected the three mechanistic pathways associated with BAG3: protein quality control, apoptosis and adrenergic responsiveness/ventricular function. Therefore, we posit that these variants lead to a genetic predisposition to IDC in individuals of African ancestry.
The four variants identified in the present study have not been recognized previously in cohorts of probands with familial dilated cardiomyopathy. This is explained by the paucity of individuals of African ancestry in HF studies. For example, in four European studies and one U.S. study that identified BAG3 variants in independent index cases with familial
IDC, fewer than 18 subjects were identified as of African ancestry. (Arimura et al., 2011;
Chami et al., 2014b; Fernlund et al., 2017; Norton et al., 2011b; Ulrike Esslinger, Sophie
Garnier, Agathe Korniat, Carole Proust, Georgios Kararigas, Martina Müller-Nurasyid,
Jean-Philippe Empana, Michael P Morley, Claire Perret, Klaus Stark, Alexander G Bick,
Sanjay K Prasad, Jennifer Kriebel, Jin Li, Laurence Tiret, Konstantin Strauch, Declan P
O'Regan et al., 2017). Nonetheless, these studies in individuals of European ancestry were informative. BAG3 variants were most common in cohorts of probands that were ethnically or geographically isolated: 15% in index cases recruited from an isolated population in the
Gaspesie region in Quebec: 6.7% in a single center Polish study, 3.5% in a European population and 2.25% (7/311) in a large U.S. study (Norton et al., 2011b). Only 2 of the
BAG3 variants identified in the 569 index cases that were included in these studies were identical.
These findings of significant enrichment of BAG3 variants in a population of unrelated patients confirms our hypothesis that BAG3 variants differ by race or ethnicity. This
[86] finding also led us to hypothesize that classification of some BAG3 variants as benign based solely on bioinformatics analysis may not accurately reflect the role of these BAG3 variants in the failing heart.
Pathogenicity of BAG3 variants
BAG3 regulates many important cellular functions such as protein quality control, apoptosis and excitation-contraction coupling. BAG3 protein levels are reduced in human end-stage heart disease and in animal models of heart failure. The functional significance of BAG3 insufficiency is demonstrated by our previous observations that knockdown of
BAG3 by siRNA impairs excitation-contraction, apoptosis and autophagy in cardiac myocytes and that our cardiac-specific BAG3 haplo-insufficient mouse manifests the heart failure phenotype by 10 weeks of age. In the current study, to assess the functional consequences of BAG3 variants found in African Americans with IDC, we took advantage of our development of a BAG3 haplo-insufficient mouse model to determine whether the
BAG3 variants could rescue cardiac/myocyte dysfunction as we have seen with WT BAG3 and thus whether the BAG3 variants could be pathogenic.
Next-generation sequencing of the human genome has led to the identification of an enormous number of genetic variants; however, identifying their pathogenicity remains challenging especially in the absence of familial recurrence and segregation analysis
(Boycott, Vanstone, Bulman, & MacKenzie, 2013). Investigators have used bio-informatic analysis of multiple large data sets, computational tools that predict the impact of a genetic variant on gene/protein structure and function, and the presence of evolutionary sequence conservation to predict pathogenicity have limitations (Campuzano, Allegue, Fernandez,
Iglesias, & Brugada, 2015).
[87]
We took a reductionist approach to assessing the biologic effects of the BAG3 variants both in vitro and in vivo due to the known limitations of non-biologic measures of pathogenicity. It is not surprising that the p.Ala479Val variant is associated with an increase in apoptosis and a decrease in autophagy in vitro because it is located in the highly conserved BAG domain that binds to Bcl-2 (Behl, 2011; J. Lee et al., 1999) and facilitates autophagy by binding to the ATPase domain of heat shock protein 70 (Hsp70/Hsc70)
(Claudia S. Gässler, Thomas Wiederkehr, Dirk Brehmer, Bernd Bukau, & Matthias P.
Mayer, 2001; Claudia S. Gassler, Thomas Wiederkehr, Dirk Brehmer, Bernd Bukau, &
Matthias P. Mayer, 2001; Takayama & Reed, 2001). Fang et al recently reported that knock-in of a variant found in the BAG domain in a family of European ancestry (BAG3-
E455K) disrupted the interaction between BAG3 and Hsp70, decreased levels of the small heat shock proteins and caused a dilated cardiomyopathy in mice. Our results also support the pathogenicity of p.Pro63Ala + p.Pro380Ser; however, the mechanism is less clear. p.Pro63Ala is not a highly conserved amino acid and does not alter cellular functions whereas p.Pro380Ser impairs excitation-contraction coupling. The p.Pro380Ser variant resides in the proline rich PXXP motif that serves as a docking site for Src homology 3
(SH3) domains and the PXXP motif may also interact with the WW domain resulting in a change in 3-dimensional structure. Further support for the pathogenicity of both p.Pro63Ala + p.Pro380Ser and p.Ala479Val is the observation that both P380 and A479 amino acids are conserved across all mammals studied. By contrast, the p.Pro63Ala variant resides in a region that has not been associated with pathogenicity and it is not conserved in mammals.
[88]
We additionally used gene delivery through retro-orbital injection of AAV9 BAG3 variants in our haplo-insufficient mouse model to determine the functional impact of the two conserved BAG3 variants. This showed significant decreases in cardiac function with expression of the linked variant. However, our model showed no decrease in function with expression of the p.Ala479Val variant after 6 weeks of expression. This demonstrates the diversity of each variant and that different variants can have very different effects on cellular functions. However, it should be noted that we cannot exclude the possibility that the p.Ala479Val variant might have untoward effects over a longer period of time – particularly in light of the finding that it altered the autophagy/apoptosis axis as well as excitation-contraction coupling in studies in isolated adult myocytes.
We report for the first time that unique variants in BAG3 are found exclusively (or near- exclusively) in individuals of African descent as compared with individuals of other racial and ethnic groups. Furthermore, we also show in retrospective analysis of outcomes data from three heart failure trials that included outcome measures that the presence of any of these unique genetic variants predicts a worse outcome with the development of HF.
Because our results were generated retrospectively, a prospective study will be required to confirm our findings. Nonetheless, the current studies provide important information about the potential usefulness of BAG3 as a target for the treatment of patients with BAG3 genetic variants as well as information relevant to generic use of gene therapy for the precision treatment of HF. For example, our results demonstrate that not all genetic variants in a disease-causing gene are equally useful as a therapeutic target. Whereas rAAV9-BAG3WT effectively enhanced cardiac function in mice with deletion of one allele of BAG3 (haplo-insufficiency) and rAAV9-BAG3479 had a similar effect on LV function,
[89] rAAV9-BAG363/380 appeared to worsen LV function. Conceivably, the deleterious effects of rAAV9-BAG363/380 could have been due to a dominant-negative effect. This is supported by the finding that BAG3 levels were supra-normal in patients with HF who harbored the BAG363/380 variant. By contrast, the finding that BAG3 levels were significantly reduced – below levels found in patients with ischemic cardiomyopathy – in hearts having the BAG3-Ala160dup variant suggests that patients harboring this mutation might be significantly benefited by rAAV9-BAG3 gene therapy.
Precision medicine is a new concept in cardiovascular disease; however, precision medicine has become a staple of the therapeutic approaches to the treatment of cancer.
Oncologists have begun to recognize that it is not adequate to demonstrate that a particular tumor has a mutation in protein “x”. Rather, it is now becoming important to define the specific mutation. In a recent study in Nature (Hyman et al., 2018), investigators reported that the ERBB2 antagonist neratinib improved outcomes and inhibited tumor growth in patients with only selective ERBB2 mutations rather than ubiquitously. Studies such as the one described herein will be required if we are to bring precision medicine to the care of patients with HF.
Conclusion
Investigators have opined that the less favorable prevalence and prognosis of heart failure in individuals of African ancestry are attributable to a preponderance of traditional risk factors including hypertension, hyperlipidemia diabetes mellitus and smoking history
(Carnethon et al., 2017). In addition, a recent study has demonstrated that the neighborhood in which an individual lives can also influence their risk of developing HF.
We would argue that genetic variations in cardiac proteins that are selective for African
[90]
Americans are also strongly associated with the development of IDC and are predictive of outcome. Therefore, biological differences should be considered an important cause of epidemiologic differences across different patient populations. Furthermore, our study points out that we cannot understand population-based differences without enhancing the diversity of populations included in genomic studies. Similarly, in the era of big data, efforts must be undertaken to assess the genetic profile of both probands and their family members as without the ability to measure segregation, penetrance and plasticity we can only ascribe associations to functional genetic variants.
[91]
REFERENCES
Agah, R., Frenkel, P. A., French, B. A., Michael, L. H., Overbeek, P. A., & Schneider, M. D. (1997a). Gene recombination in postmitotic cells. targeted expression of cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo. The Journal of Clinical Investigation, 100(1), 169-179. doi:10.1172/JCI119509
Agah, R., Frenkel, P. A., French, B. A., Michael, L. H., Overbeek, P. A., & Schneider, M. D. (1997b). Gene recombination in postmitotic cells. targeted expression of cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo. The Journal of Clinical Investigation, 100(1), 169-179. doi:10.1172/JCI119509
Amy L. Tucker, Jianliang Song, Xue-Qian Zhang, JuFang Wang, Belinda A. Ahlers, Lois L. Carl, . . . Joseph Y. Cheung. (2006). Altered contractility and [Ca2+]i homeostasis in phospholemman-deficient murine myocytes: Role of na+/Ca2+ exchange. American Journal of Physiology - Heart and Circulatory Physiology, 291(5), 2199- 2209. doi:10.1152/ajpheart.01181.2005
Arimura, T., Ishikawa, T., Nunoda, S., Kawai, S., & Kimura, A. (2011). Dilated cardiomyopathy‐associated BAG3 mutations impair z‐disc assembly and enhance sensitivity to apoptosis in cardiomyocytes. Human Mutation, 32(12), 1481-1491. doi:10.1002/humu.21603
Arndt, V., Dick, N., Tawo, R., Dreiseidler, M., Wenzel, D., Hesse, M., . . . Höhfeld, J. (2010). Chaperone-assisted selective autophagy is essential for muscle maintenance. Current Biology, 20(2), 143-148. doi:10.1016/j.cub.2009.11.022
Bahrami, H., Kronmal, R., Bluemke, D. A., Olson, J., Shea, S., Liu, K., . . . Lima, J. A. C. (2008). Differences in the incidence of congestive heart failure by ethnicity: The multi-ethnic study of atherosclerosis. Archives of Internal Medicine, 168(19), 2138- 2145. doi:10.1001/archinte.168.19.2138
Behl, C. (2011). BAG3 and friends: Co-chaperones in selective autophagy during aging and disease. Autophagy, 7(7), 795-798. doi:10.4161/auto.7.7.15844
Behl, C. (2016). Breaking BAG: The co-chaperone BAG3 in health and disease. Trends in Pharmacological Sciences, 37(8), 672-688. doi:10.1016/j.tips.2016.04.007
Benjamin, E., Blaha, M., Chiuve, S., Cushman, M., Das, S., Deo, R., . . . Muntner, P. (2017). Heart disease and stroke Statistics—2017 update: A report from the american heart association. Circulation, 135(10), e603. doi:10.1161/CIR.0000000000000485
[92]
Bibbins-Domingo, K., Pletcher, M. J., Lin, F., Vittinghoff, E., Gardin, J. M., Arynchyn, A., . . . Hulley, S. B. (2009). Racial differences in incident heart failure among young adults. The New England Journal of Medicine, 360(12), 1179-1190. doi:10.1056/NEJMoa0807265
Boycott, K. M., Vanstone, M. R., Bulman, D. E., & MacKenzie, A. E. (2013). Rare- disease genetics in the era of next-generation sequencing: Discovery to translation. Nature Reviews. Genetics, 14(10), 681. doi:10.1038/nrg3555
Braunwald, E. (2017). Cardiomyopathies: An overview. Circulation Research, 121(7), 711-721. doi:10.1161/CIRCRESAHA.117.311812
Bristow, M. R., Minobe, W. A., Raynolds, M. V., Port, J. D., Rasmussen, R., Ray, P. E., & Feldman, A. M. (1993). Reduced beta 1 receptor messenger RNA abundance in the failing human heart. The Journal of Clinical Investigation, 92(6), 2737-2745. doi:10.1172/JCI116891
Brocheriou, V., Hagège, A. A., Oubenaïssa, A., Lambert, M., Mallet, V. O., Duriez, M., . . . Gilgenkrantz, H. (2000). Cardiac functional improvement by a human Bcl‐2 transgene in a mouse model of ischemia/reperfusion injury. The Journal of Gene Medicine, 2(5), 326-333. doi:AID-JGM133>3.0.CO;2-1
Campuzano, O., Allegue, C., Fernandez, A., Iglesias, A., & Brugada, R. (2015). Determining the pathogenicity of genetic variants associated with cardiac channelopathies. Scientific Reports, 5, 7953. doi:10.1038/srep07953
Carnethon, M., Pu, J., Howard, G., Albert, M., Anderson, C., Bertoni, A., . . . Yancy, C. (2017). Cardiovascular health in african americans: A scientific statement from the american heart association. Circulation, doi:10.1161/CIR.0000000000000534
Carra, S., Seguin, S. J., & Landry, J. (2008). HspB8 and Bag3: A new chaperone complex targeting misfolded proteins to macroautophagy. Autophagy, 4(2), 237-239. doi:5407 [pii]
CDC report 2015
Chami, N., Tadros, R., Lemarbre, F., Lo, K. S., Beaudoin, M., Robb, L., . . . Lettre, G. (2014a). Nonsense mutations in BAG3 are associated with early-onset dilated cardiomyopathy in french canadians. The Canadian Journal of Cardiology, 30(12), 1655-1661. doi:10.1016/j.cjca.2014.09.030
Chami, N., Tadros, R., Lemarbre, F., Lo, K. S., Beaudoin, M., Robb, L., . . . Lettre, G. (2014b). Nonsense mutations in BAG3 are associated with early-onset dilated cardiomyopathy in french canadians. The Canadian Journal of Cardiology, 30(12), 1655-1661. doi:10.1016/j.cjca.2014.09.030
[93]
Chan, T. O., Chan, A. M., Rodeck, U., Kimmelman, A. C., Rittenhouse, S. E., Panayotou, G., & Tsichlis, P. N. (2002). Small GTPases and tyrosine kinases coregulate a molecular switch in the phosphoinositide 3-kinase regulatory subunit. Cancer Cell, 1(2), 181-191. doi:10.1016/S1535-6108(02)00033-8
Claudia S. Gässler, Thomas Wiederkehr, Dirk Brehmer, Bernd Bukau, & Matthias P. Mayer. (2001). Bag-1M accelerates nucleotide release for human Hsc70 and Hsp70 and can act concentration-dependent as positive and negative cofactor. Journal of Biological Chemistry, 276(35), 32538-32544. doi:10.1074/jbc.M105328200
Claudia S. Gassler, Thomas Wiederkehr, Dirk Brehmer, Bernd Bukau, & Matthias P. Mayer. (2001). Bag-1M accelerates nucleotide release for human Hsc70 and Hsp70 and can act concentration-dependent as positive and negative cofactor. Journal of Biological Chemistry, 276(35), 32538-32544. doi:10.1074/jbc.M105328200
Cuenca, S., Ruiz-Cano, M. J., Gimeno-Blanes, J. R., Jurado, A., Salas, C., Gomez-Diaz, I., . . . Garcia-Pavia, P. (2016). Genetic basis of familial dilated cardiomyopathy patients undergoing heart transplantation. Journal of Heart and Lung Transplantation, 35(5), 625-635. doi:10.1016/j.healun.2015.12.014
Damasceno, A., Mayosi, B. M., Sani, M., Ogah, O. S., Mondo, C., Ojji, D., . . . Sliwa, K. (2012). The causes, treatment, and outcome of acute heart failure in 1006 africans from 9 countries: Results of the sub-saharan africa survey of heart failure. Archives of Internal Medicine, 172(18), 1386-1394. doi:10.1001/archinternmed.2012.3310
Davidson, M. M., Nesti, C., Palenzuela, L., Walker, W. F., Hernandez, E., Protas, L., . . . Isaac, N. D. (2005). Novel cell lines derived from adult human ventricular cardiomyocytes. Journal of Molecular and Cellular Cardiology, 39(1), 133-147. doi:10.1016/j.yjmcc.2005.03.003
Dennis M McNamara, Randall C Starling, Leslie T Cooper, John P Boehmer, Paul J Mather, Karen M Janosko, . . . G William Dec. (2011a). Clinical and demographic predictors of outcomes in recent onset dilated cardiomyopathy. Journal of the American College of Cardiology, 58(11), 1112-1118. doi:10.1016/j.jacc.2011.05.033
Dennis M McNamara, Randall C Starling, Leslie T Cooper, John P Boehmer, Paul J Mather, Karen M Janosko, . . . G William Dec. (2011b). Clinical and demographic predictors of outcomes in recent onset dilated cardiomyopathy. Journal of the American College of Cardiology, 58(11), 1112-1118. doi:10.1016/j.jacc.2011.05.033
Dokladny, K., Myers, O. B., & Moseley, P. L. (2015). Heat shock response and autophagy-cooperation and control. Autophagy, 11(2), 200-213. doi:10.1080/15548627.2015.1009776
Dries, D. L., Exner, D. V., Gersh, B. J., Cooper, H. A., Carson, P. E., & Domanski, M. J. (1999). Racial differences in the outcome of left ventricular dysfunction. The New
[94]
England Journal of Medicine, 340(8), 609-616. doi:10.1056/NEJM199902253400804
Echols, M. R., Felker, G. M., Thomas, K. L., Pieper, K. S., Garg, J., Cuffe, M. S., . . . O'Connor, C. M. (2006). Racial differences in the characteristics of patients admitted for acute decompensated heart failure and their relation to outcomes: Results from the OPTIME-CHF trial. Journal of Cardiac Failure, 12(9), 684-688. doi:10.1016/j.cardfail.2006.08.003
Eman A Hamad, Weizhong Zhu, Tung O Chan, Valerie Myers, Erhe Gao, Xue Li, . . . Arthur M Feldman. (2012). Cardioprotection of controlled and cardiac-specific over- expression of A2A-adenosine receptor in the pressure overload. PLoS One, 7(7) doi:10.1371/journal.pone.0039919
Fang, X., Bogomolovas, J., Wu, T., Zhang, W., Liu, C., Veevers, J., . . . Chen, J. (2017). Loss-of-function mutations in co-chaperone BAG3 destabilize small HSPs and cause cardiomyopathy. Journal of Clinical Investigation, 127(8), 3189. doi:10.1172/JCI94310
Feldman, A. M., Begay, R. L., Knezevic, T., Myers, V. D., Slavov, D. B., Zhu, W., . . . Taylor, M. R. (2014a). Decreased levels of BAG3 in a family with a rare variant and in idiopathic dilated cardiomyopathy. Journal of Cellular Physiology, 229(11), 1697-1702. doi:10.1002/jcp.24615 [doi]
Feldman, A. M., Begay, R. L., Knezevic, T., Myers, V. D., Slavov, D. B., Zhu, W., . . . Taylor, M. R. (2014b). Decreased levels of BAG3 in a family with a rare variant and in idiopathic dilated cardiomyopathy. Journal of Cellular Physiology, 229(11), 1697-1702. doi:10.1002/jcp.24615 [doi]
Feldman, A. M., Gordon, J., Wang, J., Song, J., Zhang, X. Q., Myers, V. D., . . . Cheung, J. Y. (2016). BAG3 regulates contractility and ca homeostasis in adult mouse ventricular myocytes. Journal of Molecular and Cellular Cardiology, 92, 10-20. doi:S0022-2828(16)30015-3 [pii]
Feldman, A. M., Gordon, J., Wang, J., Song, J., Zhang, X., Myers, V. D., . . . Cheung, J. Y. (2016a). BAG3 regulates contractility and Ca2+ homeostasis in adult mouse ventricular myocytes. Journal of Molecular and Cellular Cardiology, 92, 10-20. doi:10.1016/j.yjmcc.2016.01.015
Feldman, A. M., Gordon, J., Wang, J., Song, J., Zhang, X., Myers, V. D., . . . Cheung, J. Y. (2016b). BAG3 regulates contractility and Ca2+ homeostasis in adult mouse ventricular myocytes. Journal of Molecular and Cellular Cardiology, 92, 10-20. doi:10.1016/j.yjmcc.2016.01.015
Fernlund, E., Österberg, A., Kuchinskaya, E., Gustafsson, M., Jansson, K., & Gunnarsson, C. (2017). Novel genetic variants in BAG3 and TNNT2 in a swedish
[95]
family with a history of dilated cardiomyopathy and sudden cardiac death. Pediatric Cardiology, 38(6), 1262-1268. doi:10.1007/s00246-017-1655-0
Fuchs, M., Poirier, D. J., Seguin, S. J., Lambert, H., Carra, S., Charette, S. J., & Landry, J. (2009). Identification of the key structural motifs involved in HspB8/HspB6-Bag3 interaction. The Biochemical Journal, 425(1), 245-255. doi:10.1042/BJ20090907 [doi]
Hayashi, M., Shimizu, W., & Albert, C. (2015). The spectrum of epidemiology underlying sudden cardiac death. Circulation Research, 116(12), 1887-1906. doi:10.1161/CIRCRESAHA.116.304521
Herman, D. S., Lam, L., Taylor, M. R. G., Wang, L., Teekakirikul, P., Christodoulou, D., . . . Seidman, C. E. (2012). Truncations of titin causing dilated cardiomyopathy. The New England Journal of Medicine, 366(7), 619. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/22335739
Hershberger, R. E., Hedges, D. J., & Morales, A. (2013). Dilated cardiomyopathy: The complexity of a diverse genetic architecture. Nature Reviews. Cardiology, 10(9), 531. doi:10.1038/nrcardio.2013.105
Hishiya, A., Salman, M. N., Carra, S., Kampinga, H. H., & Takayama, S. (2011). BAG3 directly interacts with mutated alphaB-crystallin to suppress its aggregation and toxicity. PloS One, 6(3), e16828. doi:10.1371/journal.pone.0016828 [doi]
Homma, S., Iwasaki, M., Shelton, G. D., Engvall, E., Reed, J. C., & Takayama, S. (2006). BAG3 deficiency results in fulminant myopathy and early lethality. The American Journal of Pathology, 169(3), 761-773. doi:S0002-9440(10)62755-1 [pii]
Hoogstraten-Miller, S., Yardeni, T., Huizing, M., Eckhaus, M., & Morris, H. D. (2011). Retro-orbital injections in mice. Lab Animal, 40(5), 155-160. doi:10.1038/laban0511-155
Hyman, D. M., Piha-Paul, S., Won, H., Rodon, J., Saura, C., Shapiro, G. I., . . . Solit, D. B. (2018). HER kinase inhibition in patients with HER2- and HER3-mutant cancers. Nature, 554, 189. Retrieved from http://dx.doi.org/10.1038/nature25475
Janin, A., N'Guyen, K., Habib, G., Dauphin, C., Chanavat, V., Bouvagnet, P., . . . Millat, G. (2017). Truncating mutations on myofibrillar myopathies causing genes as prevalent molecular explanations on patients with dilated cardiomyopathy. Clinical Genetics, 92(6), 616-623. doi:10.1111/cge.13043
Jianliang Song, Erhe Gao, JuFang Wang, Xue-Qian Zhang, Tung O. Chan, Walter J. Koch, . . . Joseph Y. Cheung. (2012). Constitutive overexpression of phosphomimetic phospholemman S68E mutant results in arrhythmias, early mortality, and heart failure: Potential involvement of na+/Ca2+ exchanger. American
[96]
Journal of Physiology - Heart and Circulatory Physiology, 302(3), 770-781. doi:10.1152/ajpheart.00733.2011
Jianliang Song, Xue-Qian Zhang, JuFang Wang, Ellina Cheskis, Tung O. Chan, Arthur M. Feldman, . . . Joseph Y. Cheung. (2008). Regulation of cardiac myocyte contractility by phospholemman: Na+/Ca2+ exchange versus na+-K+-ATPase. American Journal of Physiology - Heart and Circulatory Physiology, 295(4), 1615- 1625. doi:10.1152/ajpheart.00287.2008
JuFang Wang, Erhe Gao, Jianliang Song, Xue-Qian Zhang, Jifen Li, Walter J. Koch, . . . Joseph Y. Cheung. (2010). Phospholemman and β-adrenergic stimulation in the heart. American Journal of Physiology - Heart and Circulatory Physiology, 298(3), 807-815. doi:10.1152/ajpheart.00877.2009
JuFang Wang, Erhe Gao, Joseph Rabinowitz, Jianliang Song, Xue-Qian Zhang, Walter J. Koch, . . . Joseph Y. Cheung. (2011). Regulation of in vivo cardiac contractility by phospholemman: Role of na+/Ca2+ exchange. American Journal of Physiology - Heart and Circulatory Physiology, 300(3), 859-868. doi:10.1152/ajpheart.00894.2010
JuFang Wang, Tung O. Chan, Xue-Qian Zhang, Erhe Gao, Jianliang Song, Walter J. Koch, . . . Joseph Y. Cheung. (2009). Induced overexpression of na+/Ca2+ exchanger transgene: Altered myocyte contractility, [Ca2+]i transients, SR Ca2+ contents, and action potential duration. American Journal of Physiology - Heart and Circulatory Physiology, 297(2), 590-601. doi:10.1152/ajpheart.00190.2009
Kabbage, M., & Dickman, M. (2008). The BAG proteins: A ubiquitous family of chaperone regulators. Cellular and Molecular Life Sciences, 65(9), 1390-1402. doi:10.1007/s00018-008-7535-2
Kerr, J. F., Wyllie, A. H., & Currie, A. R. (1972). Apoptosis: A basic biological phenomenon with wide-ranging implications in tissue kinetics. British Journal of Cancer, 26(4), 239. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/4561027
Knezevic, T., Myers, V. D., Su, F., Wang, J., Song, J., Zhang, X. Q., . . . Feldman, A. M. (2016). Adeno-associated virus serotype 9 - driven expression of BAG3 improves left ventricular function in murine hearts with left ventricular dysfunction secondary to a myocardial infarction. JACC.Basic to Translational Science, 1(7), 647-656. doi:10.1016/j.jacbts.2016.08.008 [doi]
Landrum, M. J., Lee, J. M., Riley, G. R., Jang, W., Rubinstein, W. S., Church, D. M., & Maglott, D. R. (2014). ClinVar: Public archive of relationships among sequence variation and human phenotype. Nucleic Acids Research, 42(D1), D985. doi:10.1093/nar/gkt1113
[97]
Lee, H., Cherk, S., Chan, S., Wong, S., Tong, T., Ho, W., . . . Mak, C. (2012). BAG3‐ related myofibrillar myopathy in a chinese family. Clinical Genetics, 81(4), 394-398. doi:10.1111/j.1399-0004.2011.01659.x
Lee, J., Takahashi, T., Yasuhara, N., Inazawa, J., Kamada, S., & Tsujimoto, Y. (1999). Bis, a bcl-2-binding protein that synergizes with bcl-2 in preventing cell death. Oncogene, 18(46), 6183-6190. doi:10.1038/sj.onc.1203043
Lek, M., Karczewski, K. J., Minikel, E. V., Samocha, K. E., Posthuma, D., & Exome Aggregation Consortium, [. (2016). Analysis of protein-coding genetic variation in 60,706 humans. Nature, 536(7616), 285-291. doi:10.1038/nature19057
Li, X., Colvin, T., Rauch, J. N., Acosta-Alvear, D., Kampmann, M., Dunyak, B., . . . Gestwicki, J. E. (2015). Validation of the Hsp70-Bag3 protein-protein interaction as a potential therapeutic target in cancer. Molecular Cancer Therapeutics, 14(3), 642- 648. doi:10.1158/1535-7163.MCT-14-0650
Loehr, L. R. (2008). Heart failure incidence and survival (from the atherosclerosis risk in communities study). Am J Cardiol, 101(7), 1016-1022. doi:10.1016/j.amjcard.2007.11.061
Maria Franaszczyk, Zofia T Bilinska, Malgorzata Sobieszczanska-Malek, Ewa Michalak, Justyna Sleszycka, Agnieszka Sioma, . . . Rafal Ploski. (2014). The BAG3 gene variants in polish patients with dilated cardiomyopathy: Four novel mutations and a genotype-phenotype correlation. Journal of Translational Medicine, 12(1), 192. doi:10.1186/1479-5876-12-192
McCollum, A. K., Casagrande, G., & Kohn, E. C. (2009). Caught in the middle: The role of Bag3 in disease. The Biochemical Journal, 425(1), 1. doi:10.1042/BJ20091739 [doi]
McNamara, D. M., Holubkov, R., Janosko, K., Palmer, A., Wang, J. J., MacGowan, G. A., . . . Feldman, A. M. (2001). Pharmacogenetic interactions between beta-blocker therapy and the angiotensin-converting enzyme deletion polymorphism in patients with congestive heart failure. Circulation, 103(12), 1644. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11273991
McNamara, D. M., Holubkov, R., Postava, L., Janosko, K., MacGowan, G. A., Mathier, M., . . . London, B. (2004). Pharmacogenetic interactions between angiotensin- converting enzyme inhibitor therapy and the angiotensin-converting enzyme deletion polymorphism in patients with congestive heart failure. Journal of the American College of Cardiology, 44(10), 2019-2026. doi:10.1016/j.jacc.2004.08.048
McNamara, D. M., Tam, S. W., Sabolinski, M. L., Tobelmann, P., Janosko, K., Taylor, A. L., . . . Worcel, M. (2006). Aldosterone synthase promoter polymorphism predicts outcome in african americans with heart failure: Results from the A-HeFT trial.
[98]
Journal of the American College of Cardiology, 48(6), 1277. doi:10.1016/j.jacc.2006.07.030
McNamara, D. M., Tam, S. W., Sabolinski, M. L., Tobelmann, P., Janosko, K., Venkitachalam, L., . . . Worcel, M. (2009). Endothelial nitric oxide synthase (NOS3) polymorphisms in african americans with heart failure: Results from the A-HeFT trial. Journal of Cardiac Failure, 15(3), 191-198. doi:10.1016/j.cardfail.2008.10.028
McNamara, D. M., Taylor, A. L., Tam, S. W., Worcel, M., Yancy, C. W., Hanley-Yanez, K., . . . Feldman, A. M. (2014). G-protein beta-3 subunit genotype predicts enhanced benefit of fixed-dose isosorbide dinitrate and hydralazine: Results of A-HeFT. JACC. Heart Failure, 2(6), 551. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/25306451
Mensah, G. A., & Brown, D. W. (2007). An overview of cardiovascular disease burden in the united states. Health Affairs, 26(1), 38-48. doi:10.1377/hlthaff.26.1.38
Mezzano, V., & Sheikh, F. (2012). Cell–cell junction remodeling in the heart: Possible role in cardiac conduction system function and arrhythmias? Life Sciences, 90(9-10), 313-321. doi:10.1016/j.lfs.2011.12.009
Mueller, S. C., Backes, C., Haas, J., Katus, H. A., Meder, B., Meese, E., & Keller, A. (2015). Pathogenicity prediction of non-synonymous single nucleotide variants in dilated cardiomyopathy. Briefings in Bioinformatics, 16(5), 769-779. doi:10.1093/bib/bbu054
Myers Valerie D., Tomar Dhanendra, Madesh Muniswamy, Wang Jufang, Song Jianliang, Zhang Xue-Qiang, Gupta Manish K, Tahrir Farzenah G, Gordon Jennifer, McClung Joseph M., Kontos Christopher D., Khalili Kamel, Cheung Joseph Y. Feldman Arthut. (2018). Haplo-insufficiency of Bcl2-associated athanogene 3 in mice results in progressive left ventricular dysfunction, β-adrenergic insensitivity and increased apoptosis. Journal of Cellular Physiology,
Norton, N., Li, D., Rieder, M. J., Siegfried, J. D., Rampersaud, E., Zuchner, S., . . . Hershberger, R. E. (2011a). Genome-wide studies of copy number variation and exome sequencing identify rare variants in BAG3 as a cause of dilated cardiomyopathy. American Journal of Human Genetics, 88(3), 273-282. doi:10.1016/j.ajhg.2011.01.016 [doi]
Norton, N., Li, D., Rieder, M., Siegfried, J., Rampersaud, E., Züchner, S., . . . Hershberger, R. (2011b). Genome-wide studies of copy number variation and exome sequencing identify rare variants in BAG3 as a cause of dilated cardiomyopathy. The American Journal of Human Genetics, 88(3), 273-282. doi:10.1016/j.ajhg.2011.01.016
[99]
Ntusi, N. B. A., & Mayosi, B. M. (2009). Epidemiology of heart failure in sub-saharan africa. Expert Review of Cardiovascular Therapy, 7(2), 169. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/19210213
Odgerel, Z., Sarkozy, A., Lee, H., McKenna, C., Rankin, J., Straub, V., . . . Goldfarb, L. G. (2010). Inheritance patterns and phenotypic features of myofibrillar myopathy associated with a BAG3 mutation. Neuromuscular Disorders, 20(7), 438-442. doi:10.1016/j.nmd.2010.05.004
Olivetti, G., Quaini, F., Sala, R., Lagrasta, C., Corradi, D., Bonacina, E., . . . Anversa, P. (1996). Acute myocardial infarction in humans is associated with activation of programmed myocyte cell death in the surviving portion of the heart. Journal of Molecular and Cellular Cardiology, 28(9), 2005-2016. doi:10.1006/jmcc.1996.0193
Papini, E., Bugnoli, M., De Bernard, M., Figura, N., Rappuoli, R., & Montecucco, C. (1993). Bafilomycin A1 inhibits helicobacter pylori-induced vacuolization of HeLa cells. Molecular Microbiology, 7(2), 323-327. doi:10.1111/j.1365- 2958.1993.tb01123.x
Patricia Boya, Fulvio Reggiori, & Patrice Codogno. (2013). Emerging regulation and functions of autophagy. Nature Cell Biology, 15(7), 713. doi:10.1038/ncb2788
Pedro, J., Kroemer, G., & Galluzzi, L. (2017). Autophagy and mitophagy in cardiovascular disease. Circulation Research, 120(11), 1812. Retrieved from http://kipublications.ki.se/Default.aspx?queryparsed=id:135878984
Riera, C., Lois, S., & de la Cruz, X. (2014). Prediction of pathological mutations in proteins: The challenge of integrating sequence conservation and structure stability principles. Wiley Interdisciplinary Reviews: Computational Molecular Science, 4(3), 249-268. doi:10.1002/wcms.1170
Rosati, A., Graziano, V., De Laurenzi, V., Pascale, M., & Turco, M. C. (2011). BAG3: A multifaceted protein that regulates major cell pathways. Cell Death & Disease, 2, e141. doi:10.1038/cddis.2011.24 [doi]
Sasaki, Y., Ikeda, Y., Iwabayashi, M., Akasaki, Y., & Ohishi, M. (2017). The impact of autophagy on cardiovascular senescence and diseases. International Heart Journal, 58(5), 666-673. doi:10.1536/ihj.17-246
Seguchi, O., Takashima, S., Yamazaki, S., Asakura, M., Asano, Y., Shintani, Y., . . . Kitakaze, M. (2007). A cardiac myosin light chain kinase regulates sarcomere assembly in the vertebrate heart. The Journal of Clinical Investigation, 117(10), 2812-2824. doi:10.1172/JCI30804
[100]
Selcen, D., Muntoni, F., Burton, B. K., Pegoraro, E., Sewry, C., Bite, A. V., & Engel, A. G. (2009). Mutation in BAG3 causes severe dominant childhood muscular dystrophy. Annals of Neurology, 65(1), 83-89. doi:10.1002/ana.21553 [doi]
Shinichi Takayama, Zhihua Xie, & John C. Reed. (1999). An evolutionarily conserved family of Hsp70/Hsc70 molecular chaperone regulators. Journal of Biological Chemistry, 274(2), 781-786. doi:10.1074/jbc.274.2.781
Sliwa, K., Wilkinson, D., Hansen, C., Ntyintyane, L., Tibazarwa, K., Becker, A., & Stewart, S. (2008). Spectrum of heart disease and risk factors in a black urban population in south africa (the heart of soweto study): A cohort study. The Lancet, 371(9616), 915-922. doi:10.1016/S0140-6736(08)60417-1
Su, F., Myers, V. D., Knezevic, T., Wang, J., Gao, E., Madesh, M., . . . Feldman, A. M. (2016). Bcl-2-associated athanogene 3 protects the heart from ischemia/reperfusion injury. JCI Insight, 1(19), e90931. doi:10.1172/jci.insight.90931 [doi]
Takayama, S., & Reed, J. C. (2001). Molecular chaperone targeting and regulation by BAG family proteins. Nature Cell Biology, 3(10), E241. doi:10.1038/ncb1001-e237
Tanida, I. (2011). Autophagy basics. Microbiology and Immunology, 55(1), 1-11. doi:10.1111/j.1348-0421.2010.00271.x
Tanida, I., Ueno, T., & Kominami, E. (2008). LC3 and autophagy. Methods in Molecular Biology (Clifton, N.J.), 445, 77. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/18425443
Tarone, G., & Brancaccio, M. (2014). Keep your heart in shape: Molecular chaperone networks for treating heart disease. Cardiovascular Research, 102(3), 346-361. doi:10.1093/cvr/cvu049
Taylor, A. L., Ziesche, S., Yancy, C., Carson, P., D'Agostino, R., Jr, Ferdinand, K., . . . African-American Heart Failure Trial Investigators. (2004). Combination of isosorbide dinitrate and hydralazine in blacks with heart failure. The New England Journal of Medicine, 351(20), 2049-2057. doi:10.1056/NEJMoa042934
Tomar, D., Dong, Z., Shanmughapriya, S., Koch, W., Koch, D., Thomas, T., . . . Madesh, M. (2016). MCUR1 is a scaffold factor for the MCU complex function and promotes mitochondrial bioenergetics. Cell Reports, 15(8), 1673-1685. doi:10.1016/j.celrep.2016.04.050
Ulbricht, A., & Hohfeld, J. (2013). Tension-induced autophagy: May the chaperone be with you. Autophagy, 9(6), 920-922. doi:10.4161/auto.24213 [doi]
Ulrike Esslinger, Sophie Garnier, Agathe Korniat, Carole Proust, Georgios Kararigas, Martina Müller-Nurasyid, . . . Eric Villard. (2017). Exome-wide association study
[101]
reveals novel susceptibility genes to sporadic dilated cardiomyopathy. PLoS One, 12(3), e0172995. doi:10.1371/journal.pone.0172995
Ulrike Esslinger, Sophie Garnier, Agathe Korniat, Carole Proust, Georgios Kararigas, Martina Müller-Nurasyid, . . . Eric Villard. (2017). Exome-wide association study reveals novel susceptibility genes to sporadic dilated cardiomyopathy. PLoS One, 12(3), e0172995. doi:10.1371/journal.pone.0172995
Ulrike Esslinger, Sophie Garnier, Agathe Korniat, Carole Proust, Georgios Kararigas, Martina Müller-Nurasyid, . . . François Cambien. (2017). Exome-wide association study reveals novel susceptibility genes to sporadic dilated cardiomyopathy. PLoS One, 12(3), e0172995. doi:10.1371/journal.pone.0172995 van Heerde, W. L., Robert-Offerman, S., Dumont, E., Hofstra, L., Doevendans, P. A., Smits, J. F., . . . Reutelingsperger, C. P. (2000). Markers of apoptosis in cardiovascular tissues: Focus on annexin V. Cardiovascular Research, 45(3), 549- 559. doi:10.1016/S0008-6363(99)00396-X
Wang, Z. V., & Hill, J. A. (2015). Protein quality control and metabolism: Bidirectional control in the heart. Cell Metabolism, 21(2), 215. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/25651176
Ware, J. S., Li, J., Mazaika, E., Yasso, C. M., DeSouza, T., Cappola, T. P., . . . Arany, Z. (2016). Shared genetic predisposition in peripartum and dilated cardiomyopathies. The New England Journal of Medicine, 374(3), 233. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/26735901
William C Skarnes, Barry Rosen, Anthony P West, Manousos Koutsourakis, Wendy Bushell, Vivek Iyer, . . . Allan Bradley. (2011). A conditional knockout resource for the genome-wide study of mouse gene function. Nature, 474(7351), 337-342. doi:10.1038/nature10163
Xue Li, Deana Mikhalkova, Erhe Gao, Jin Zhang, Valerie Myers, Carmen Zincarelli, . . . Tung O. Chan. (2011). Myocardial injury after ischemia-reperfusion in mice deficient in Akt2 is associated with increased cardiac macrophage density. American Journal of Physiology - Heart and Circulatory Physiology, 301(5), 1932-1940. doi:10.1152/ajpheart.00755.2010
Yancy, C. W. (2000). Heart failure in african americans: A cardiovascular engima. Journal of Cardiac Failure, 6(3), 183. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10997742
Yeboah, J., Rodriguez, C. J., Stacey, B., Lima, J. A., Liu, S., Carr, J. J., . . . Herrington, D. M. (2012). Prognosis of individuals with asymptomatic left ventricular systolic dysfunction in the multi-ethnic study of atherosclerosis (MESA). Circulation, 126(23), 2713-2719. doi:10.1161/CIRCULATIONAHA.112.112201
[102]
Ying-Ying Zhou, Shi-Qiang Wang, Wei-Zhong Zhu, Andrej Chruscinski, Brian K. Kobilka, Bruce Ziman, . . . Rui-Ping Xiao. (2000). Culture and adenoviral infection of adult mouse cardiac myocytes: Methods for cellular genetic physiology. American Journal of Physiology - Heart and Circulatory Physiology, 279(1), 429-436. Retrieved from http://ajpheart.physiology.org/content/279/1/H429
Zhang, Y., Wang, J., Lu, Q., & Wang, Y. (2012). Bag3 promotes resistance to apoptosis through bcl-2 family members in non-small cell lung cancer. Oncology Reports, 27(1), 109. doi:10.3892/or.2011.1486
[103]