Pyocyanin, a Virulence Factor Produced by Sepsis- Causing Pseudomonas Aeruginosa, Promotes Adipose Wasting and Cachexia

University of Kentucky UKnowledge

Theses and Dissertations--Pharmacology and Nutritional Sciences Pharmacology and Nutritional Sciences

2019

PYOCYANIN, A VIRULENCE FACTOR PRODUCED BY SEPSIS- CAUSING PSEUDOMONAS AERUGINOSA, PROMOTES ADIPOSE WASTING AND CACHEXIA

Nika Larian University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/etd.2019.238

Right click to open a feedback form in a new tab to let us know how this document benefits ou.y

Recommended Citation Larian, Nika, "PYOCYANIN, A VIRULENCE FACTOR PRODUCED BY SEPSIS-CAUSING PSEUDOMONAS AERUGINOSA, PROMOTES ADIPOSE WASTING AND CACHEXIA" (2019). Theses and Dissertations-- Pharmacology and Nutritional Sciences. 31. https://uknowledge.uky.edu/pharmacol_etds/31

This Doctoral Dissertation is brought to you for free and open access by the Pharmacology and Nutritional Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Pharmacology and Nutritional Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT:

I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File.

I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. I agree that the document mentioned above may be made available immediately for worldwide access unless an embargo applies.

I retain all other ownership rights to the copyright of my work. I also retain the right to use in future works (such as articles or books) all or part of my work. I understand that I am free to register the copyright to my work.

REVIEW, APPROVAL AND ACCEPTANCE

The document mentioned above has been reviewed and accepted by the student’s advisor, on behalf of the advisory committee, and by the Director of Graduate Studies (DGS), on behalf of the program; we verify that this is the final, approved version of the student’s thesis including all changes required by the advisory committee. The undersigned agree to abide by the statements above.

Nika Larian, Student

Dr. Lisa Cassis, Major Professor

Dr. Howard Glauert, Director of Graduate Studies PYOCYANIN, A VIRULENCE FACTOR PRODUCED BY SEPSIS-CAUSING PSEUDOMONAS AERUGINOSA, PROMOTES ADIPOSE WASTING AND CACHEXIA

______

DISSERTATION ______

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Medicine at the University of Kentucky

Nika Larian

Lexington, KY

Director: Dr. Lisa Cassis, Professor of Nutritional Sciences and Pharmacology, Vice President for Research

Lexington, KY

2019

PYOCYANIN, A VIRULENCE FACTOR PRODUCED BY SEPSIS-CAUSING PSEUDOMONAS AERUGINOSA, PROMOTES ADIPOSE WASTING AND CACHEXIA

Sepsis is a leading cause of death among critically ill patients that results in metabolic alterations including hypercatabolism, lipoatrophy, and muscle wasting, contributing to the development of cachexia. Septic cachexia is associated with loss of body weight, fat mass, and lean mass and dysregulated immune function. There are currently no efficacious treatment strategies for septic cachexia, and nutritional interventions have limited success in preventing hypercatabolic wasting. Pyocyanin is a virulence factor produced by sepsis-causing Pseudomonas aeruginosa that has been shown to activate the aryl hydrocarbon receptor (AhR), increase inflammation, and produce reactive oxygen species. Thus, pyocyanin represents a novel mechanistic target in the development of septic cachexia. In Aim 1, we hypothesized that pyocyanin reduces adipocyte differentiation and activates AhR in vitro and in vivo. In vitro, pyocyanin reduced differentiation of 3T3-L1 cells to adipocytes and promoted expression of proinflammatory cytokines. These effects were associated with activation of AhR. We established an in vivo model of pyocyanin-induced cachexia using repeat intraperitoneal exposure to pyocyanin in male and female C57BL/6J mice. Acutely, pyocyanin reduced differentiation of stem cells isolated from adipose stromal vascular tissue and augmented expression of proinflammatory cytokines. Chronically, pyocyanin reduced body weight and fat mass, which was associated with adipose-specific AhR activation. Pyocyanin had sexually dimorphic effects on lipolysis and adipocyte inflammation. These data suggest a role of pyocyanin in adipose cachexia associated with sepsis.

In Aim 2, we hypothesized that pyocyanin activates adipocyte AhR to promote adipose tissue wasting and cachexia. To test this hypothesis, we used a mouse model of adipocyte-specific deficiency of AhR and chronically administered pyocyanin to male and female mice. In male mice with adipocyte AhR deficiency, effects of pyocyanin to promote adipose wasting and cachexia were attenuated. In contrast, female adipocyte AhR deficient mice had an augmented response to pyocyanin to decrease body weight. Results suggest divergent mechanisms of pyocyanin to regulate adiposity and body weight through adipocyte AhR between male and female mice. These data support a role for pyocyanin in the development of adipose cachexia associated with Pseudomonas aeruginosa sepsis that is partially regulated by adipocyte AhR. Targeting pyocyanin’s effects on adipocytes represents a potentially novel therapeutic approach for septic cachexia that could mitigate septic cachexia, a condition associated with increased risk of mortality in this population.

KEYWORDS: Pyocyanin, Sepsis, Cachexia, Aryl Hydrocarbon Receptor, Adipocyte, Pseudomonas aeruginosa

Nika Larian

May 9, 2019

PYOCYANIN, A VIRULENCE FACTOR PRODUCED BY SEPSIS-CAUSING PSEUDOMONAS AERUGINOSA, PROMOTES ADIPOSE WASTING AND CACHEXIA

Nika Larian

Dr. Lisa Cassis Director of Dissertation

Dr. Howard Glauert Director of Graduate Studies

May 9, 2019 Date

ACKNOWLEDGMENTS

A dissertation is not just a publication, it is a personal story. Woven between these many lines of text are the people, places, and experiences that have crafted my story as a little girl who dreamed so fiercely of growing up and becoming a doctor, a scientist, and a woman with the power to create change. I have many characters to thank in this story. First, I would first like to thank my mentor Dr. Lisa Cassis for her endless support of my research and professional development. You are the reason I came to UK to pursue a PhD, and you are the model of a strong woman in science. Next, I want to thank the other members of the Cassis Lab, who have truly been a family over the past several years. Dr.

Mark Ensor for somehow making injecting hundreds of mice bearable and for constant help and support- I truly couldn’t have survived this last year without you; Dr. Robin Shoemaker for teaching me basically every technique I know; Dr.

Sean Thatcher for always having an answer to my questions and always offering a helping hand; Victoria English for being the lab queen and answering my dog emergency calls; Dr. Yasir Al-Siraj for setting an excellent example of a graduate student; Heba Ali for being the most caring and selfless person I’ve ever met. I would also like to thank my other committee members, Dr. Kevin Pearson, Dr. Xi- ang Li, Dr. Dawn Brewer, and my outside examiner Dr. Nathan Vanderford. Your support, guidance, and perspective have been invaluable in this process.

Importantly, I would like to thank the friends who made this a story worth living. Jessie, I cannot even imagine graduate school without you by my side every step of the way. I didn’t anticipate making close friends in graduate school,

iii

and I certainly didn’t anticipate meeting someone I would consider a sister for life.

Through the highs and lows, you have carried me (sometimes kicking and screaming) to the finish line. To my other friends at UK- Kaia, Peter, Jared,

Adam, Madison, and all the students in the Department of Pharmacology and

Nutritional Sciences, thank you for the community you created. To my friends outside of the department, Megan, Kim, Natalie, and Savanna, thank you for reminding me that I am more than a scientist.

Importantly, I would like to thank my family, particularly my mom and dad.

Dad, thank you for making me tough and fiery, for urging me to find independence, and for instilling in me that education is the most powerful asset.

This will be better than an MD, I promise. Mom, there aren’t enough words to express my love and gratitude. Thank you for your unconditional love, for being the hardest working woman I know, for being the most selfless woman I know, for being everything to me. Mela, you may not be able to read, but you also deserve this PhD for being by my side through every late night and early morning, for being my guardian angel since my first semester. Finally, I would like to thank

God for showing me that strength is built in adversity, that my story is ultimately written by You, and that I should enjoy each page instead of worrying about the final chapter.

This is dedicated to all the women in science. Never let anyone tell you that you can’t be both. Never let your mind trick you into thinking you aren’t good enough, smart enough, strong enough, beautiful enough. Your story is limitless, you just have to turn the page.

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...... iii LIST OF FIGURES ...... viii LIST OF TABLES ...... x Chapter 1 Literature Review ...... 1 1.1 Sepsis: Overview and Evolving Definitions ...... 1 1.1.1 Global Burden of Sepsis ...... 5 1.1.2 Pathogenesis of Sepsis: Cytokine Cascade ...... 7 1.1.3 Pseudomonas Aeruginosa...... 10 1.1.4 Complications and Treatment Strategies ...... 12 1.2 Cachexia in Chronic Critical Illness ...... 16 1.2.1 Fat Metabolism in Sepsis ...... 20 1.2.2 Septic Cachexia ...... 22 1.2.3 Current Treatment Strategies for Cachexia ...... 25 1.3 The Aryl Hydrocarbon Receptor (AhR) ...... 27 1.3.1 Ligands of the AhR ...... 29 1.3.2 Role of the AhR in Adipocyte Biology...... 31 1.3.3 Immune Function ...... 34 1.4 Pyocyanin: An Overview ...... 37 1.4.1 Physiological Effects ...... 39 1.5 Statement of the problem and scope of the dissertation ...... 52 1.5.1 Statement of the problem ...... 52 1.5.2 Aims of dissertation ...... 52 Chapter 2 Pseudomonas aeruginosa-derived pyocyanin is a novel mediator of the wasting and inflammation of adipose in septic cachexia .. 55 2.1 Synopsis ...... 55 2.2 Introduction ...... 56 2.3 Materials and Methods ...... 59 2.3.1 Growth and differentiation of 3T3-L1 cells ...... 59 2.3.2 Pyocyanin treatment in 3T3-L1 cells ...... 59 2.3.3 Animal treatments and sample collection...... 60 2.3.4 Isolation of the stromal vascular fraction (SVF) from adipose ...... 61 2.3.5 Pyocyanin treatment in stromal vascular cells (SVF) ...... 61 2.3.6 Dose escalation pyocyanin pilot study in C57BL/6J mice ...... 62

2.3.7 Dose response pyocyanin pilot study in C57BL/6J mice ...... 62 2.3.8 Repeated pyocyanin administration to male C57BL/6J mice with tissue harvest 1 day following the last dose ...... 62 2.3.9 Repeated pyocyanin administration to male and female C57BL/6J mice with tissue harvest 2 weeks following the last dose ...... 63 2.3.10 Measurement of body composition ...... 64 2.3.11 Extraction of RNA and quantification of mRNA abundance by real- time PCR (RT-PCR) ...... 64 2.3.12 Quantification of lipolysis in adipose tissue explants ...... 65 2.3.13 Quantification of plasma concentrations of inflammatory cytokines ...... 66 2.3.14 Quantification of pyocyanin concentrations in biological samples . 67 2.3.15 Metabolite identification of pyocyanin in mouse urine ...... 68 2.3.16 Statistical analysis ...... 69 2.4 Results ...... 70 2.4.1 Pyocyanin reduces differentiation of 3T3-L1 cells to adipocytes ...... 70 2.4.2 Pyocyanin reduces differentiation of mouse adipose stromal vascular cells to adipocytes and promotes lipolysis of mouse white adipose explants 71 2.4.3 Development of an in vivo model of pyocyanin-induced cachexia .... 71 2.4.4 Pyocyanin acutely reduces body temperature and chronically decreases body weight, fat mass, and adipocyte differentiation in male C57BL/6J mice ...... 72 2.4.5 Pyocyanin chronically decreases body weight and fat mass of male C57BL/6J mice ...... 74 2.4.6 Pyocyanin chronically decreases body weight and fat mass of female C57BL/6J mice ...... 77 2.5 Discussion ...... 78 Chapter 3 Defining the role of the aryl hydrocarbon receptor in pyocyanin-induced adipose cachexia ...... 98 3.1 Synopsis ...... 98 3.2 Introduction ...... 99 3.3 Materials and Methods ...... 101 3.3.1 Growth and differentiation of 3T3-L1 cells ...... 101 3.3.2 Use of AhR antagonists against pyocyanin in 3T3-L1 cells ...... 102 3.3.3 Animal treatments and sample collection...... 103 3.3.4 Model validation by detection of β-galactosidase activity in tissues 104 3.3.5 Administration of pyocyanin to male and female mice ...... 105

3.3.6 Measurement of body composition by EchoMRI ...... 105 3.3.7 Glucose tolerance tests (GTT) ...... 105 3.3.8 Extraction of RNA and quantification of mRNA abundance ...... 106 3.3.9 Quantification of lipolysis in epididymal (EF) adipose explants ...... 107 3.3.10 Statistical analyses ...... 108 3.4 Results ...... 109 3.4.1 AhR antagonists reduce pyocyanin-induced stimulation of CYP1a1 mRNA abundance but have no effect on pyocyanin-induced suppression of adipocyte differentiation ...... 109 3.4.2 Validation of the mouse model of adipocyte AhR deficiency ...... 110 3.4.3 Adipocyte AhR deficiency in male mice attenuates effects of pyocyanin on body weight and fat mass ...... 111 3.4.4 Pyocyanin does not alter glucose tolerance or adipose explant lipolysis of AhRfl/fl or AhRAdQ male mice ...... 112 3.4.5 Adipocyte AhR deficiency abrogates pyocyanin-induced stimulation of adipose CYP1a1 mRNA abundance in male mice ...... 113 3.4.6 Adipocyte AhR deficiency augments effects of pyocyanin to decrease body weight and fat mass of female mice ...... 113 3.4.7 Neither adipocyte AhR deficiency nor pyocyanin influence glucose tolerance of female mice, but adipocyte AhR deficiency abolishes effects of pyocyanin to stimulate lipolysis of adipose tissue explants ...... 114 3.4.8 Pyocyanin-induced stimulation of adipose CYP1a1 mRNA abundance is mediated by adipocyte AhR ...... 115 3.5 Discussion ...... 115 Chapter 4 Overall Discussion...... 135 4.1 Discussion ...... 135 4.1.1 Summary ...... 135 4.1.2 Pyocyanin contributes to adipose cachexia ...... 136 4.1.3 Pyocyanin’s effects on adipose tissue are partially mediated through AhR 139 4.2 Limitations of the present study ...... 142 4.3 Future directions and conclusions ...... 147 References ...... 157 Vita...... 191

vii

LIST OF FIGURES

Figure 1.1. Pathogenesis of adipose cachexia in sepsis ...... 46

Figure 1.2. Ligand binding of AhR ...... 47

Figure 1.3. Representative AhR ligands ...... 49

Figure 1.4. Biosynthesis of pyocyanin ...... 50

Figure 1.5. Generation of reactive oxygen species by pyocyanin ...... 51

Figure 1.6. Graphical abstract of central hypothesis ...... 54

Figure 2.1. Pyocyanin reduces in vitro adipocyte differentation and activates AhR in 3T3-L1 adipocytes ...... 88

Figure 2.2. Pyocyanin reduces adipocyte differentiation from murine stem cells and induces ex vivo lipolysis of mouse adipose explants ...... 90

Figure 2.3. Pyocyanin results in an acute reduction in body temperature and sustained reductions in body weight of male C57BL/6 mice ...... 91

Figure 2.4. Pyocyanin regulates indices of whole body metabolism in male mice ...... 92

Figure 2.5. Pyocyanin results in sustained reductions in body weight, lean and fat mass of male C57BL/6J mice ...... 93

Figure 2.6. Pyocyanin results in sustained and robust reductions in body weight, lean and fat mass of female C57BL/6J mice ...... 94

Figure 2.7 Dose response study indicates priming effect of pyocyanin exposure via intraperitoneal (IP) injection ...... 95

Figure 2.8 Acute effects of intraperitoneal (IP) injection of pyocyanin on lipolysis and gene expression ...... 96

Figure 2.9 Pyocyanin is rapidly metabolized and excreted in the urine of injected mice ...... 97

Figure 3.1. AhR antagonists have no effect on pyocyanin-induced reductions of adipocyte differentiation but differentially affect CYP1a1 expression...... 122

Figure 3.2. Validation of mouse model of adipocyte-specific AhR deficiency ... 124

Figure 3.3 Adipocyte deficiency of AhR attenuates weight loss in males administered pyocyanin ...... 125

viii

Figure 3.4 Adipocyte AhR does not affect body composition in chronically exposed males ...... 126

Figure 3.5 Neither adipocyte AhR deficiency nor pyocyanin administration regulates glucose tolerance of male mice ...... 127

Figure 3.6 . Adipocyte AhR does not influence lipolysis of adipose explants from male mice ...... 128

Figure 3.7. Adipocyte AhR deficiency abolishes pyocyanin-induced elevations of CYP1a1 mRNA abundance in adipose tissue, but not livers of male mice . 129

Figure 3.8. Adipocyte AhR deficiency augments pyocyanin-induced reductions in body weight of female mice ...... 130

Figure 3.9. Adipocyte AhR deficiency augments pyocyanin-induced reductions in fat mass of female mice ...... 131

Figure 3.10. Neither adipocyte AhR deficiency nor pyocyanin regulate glucose tolerance of female mice ...... 132

Figure 3.11. Adipocyte AhR deficiency abolishes pyocyanin-induced stimulation of lipolysis in adipose explants from female mice ...... 133

Figure 3.12. Adipocyte AhR deficiency abolishes pyocyanin-induced elevations of CYP1a1 mRNA abundance in adipose tissue, but not livers of female mice ...... 134

LIST OF TABLES

Table 1.1 Reported in vitro and in vivo effects of pyocyanin...... 45

Table 2.1 Plasma cytokine concentrations in male and female mice administered vehicle or pyocyanin ...... 86

Table 2.2 Plasma cytokine concentrations in male and female mice administered vehicle or pyocyanin ...... 87

Chapter 1 Literature Review

1.1 Sepsis: Overview and Evolving Definitions

In 2016, a task force convened by the European Society of Intensive Care

Medicine and the Society of Critical Care Medicine published the Third

International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). The new consensus defines sepsis as life-threatening organ dysfunction caused by a dysregulated host response to infection [1]. Infection is identified using the classifications of a systemic inflammatory response syndrome (SIRS), defined as the presence of two or more of the following: temperature >38oC or <36 oC, heart rate >90 beats/min, respiratory rate >20 breaths/min or PaCO2 <32 mmHg (4.3 kPa), or white blood cell count >12,000/mm3 or <4000/mm3 or >10% immature bands [1]. Organ dysfunction is defined by a Sequential Organ Failure

Assessment (SOFA) score of 2 points or higher, with higher scores associated with greater mortality in sepsis [1, 2]. However, because SOFA definition requires laboratory tests that may be time-consuming, the task force also suggested the use of quick SOFA (qSOFA) to quickly identify organ dysfunction using the following definitions: a respiratory rate > 22/min, altered mentation, and systolic blood pressure >100mmHg [1].

Septic shock represents a more severe and lethal subcategory of sepsis.

The definition of septic shock was broadened from “a state of acute circulatory failure” to “a subset of sepsis in which underlying circulatory and cellular metabolism abnormalities are profound enough to substantially increase mortality” [1, 3]. The clinical criteria of septic shock now incorporate both

hyperlactemia and hypotension, identified clinically by a serum lactate level >2 mmol/L (18mg/dL) and the required use of vasopressors to maintain a mean arterial pressure (MAP) > 65 mmHg despite adequate fluid resuscitation [1].

Septic shock can be divided into the ebb and flow phases. The ebb phase is characterized by hyper-dynamic shock, decreased systemic vascular resistance, and hypovolemia [4]. After stabilization, the patient enters the hyper-catabolic flow phase with activation of the innate immune system and increased energy expenditure [4, 5]. Lastly, the task force also approved a lay definition of sepsis to increase awareness and understanding of the syndrome.

The new definition of sepsis aims to encapsulate the dichotomous pathobiology of sepsis, involving both pro- and anti-inflammatory responses [1,

6]. Furthermore, while these inflammatory responses are triggered by the presence of an exogenous pathogen, the milieu of sepsis is heavily impacted by endogenous factors and the host’s immune system [1, 7, 8]. The first definition of sepsis was released in 1992 and derived the definition of sepsis from the presence of SIRS in the host [9]. In 2001, a second definition was released that expanded the diagnostic criteria for sepsis by adding organ injury but was largely the same as the 1992 guidelines [3]. Until Sepsis-3, the definition of sepsis had been largely unchanged for over two decades. The new definition of sepsis incorporates the use of patient health records and is based on the current understanding of the pathobiology of sepsis, including changes of organ function, biochemistry, and circulation. Furthermore, Sepsis-3 aims to encompass the heterogeneous and complex nature of sepsis, including the diverse effects that

age, sex, existing conditions, and source of infection play in incidence and progression of affected patients [1, 10].

As can be seen from evolving definitions, sepsis is a syndrome that currently lacks a standard diagnostic test and is, therefore, difficult to define and diagnose. As such, the new definition of sepsis aimed to differentiate sepsis from uncomplicated infection, update the definition to reflect new knowledge of sepsis pathobiology, promote early recognition of sepsis, and produce a more simple and consistent identification of sepsis. Furthermore, adding “life-threatening organ dysfunction” to the definition emphasizes the potential lethality and necessity of early diagnosis and treatment of sepsis [1]. Under this new definition, “severe sepsis” becomes “superfluous” and has been removed from the definition [1]. Additionally, the task force believed that the similar characteristics of “sepsis” and “severe sepsis” contributed to confusion amongst clinicians and patients [1].

The previous use of two or more SIRS criteria to diagnose sepsis was deemed “unhelpful” by the 2016 task force [1]. The SIRS criteria do not accurately distinguish a normal inflammatory response from dysregulated inflammatory response and life-threatening sepsis; for example, a bad cold could be diagnosed as sepsis using SIRS criteria, which could lead to unnecessary antibiotic use contributing to antibiotic resistance. Furthermore, the SIRS criteria failed to capture the dynamic pro- and anti-inflammatory responses of sepsis.

However, SIRS is still helpful in identifying an infection.

The task force recognized that the clinical criteria for sepsis should allow for prompt diagnosis of sepsis, as early recognition and treatment of sepsis can improve patient outcomes. The new definition sought to increase uniformity in definitions of sepsis, which would lead to fewer variations in reported incidences and mortality rates. Increased standardization allows for more accurate epidemiological reporting of sepsis and allows for more accurate coding in hospitals. As opposed to the previous definitions, which were based on expert opinion, Sepsis-3 is based on objective data and large databases of patient records.

However, the new definition of sepsis is not without flaws. SOFA is not well known outside of the critical care community, and the data required for qSOFA criteria may not be available in hospitals outside of the U.S. [11]. Neither

SOFA nor SIRS determine the cause of the dysfunction [12]. The task force acknowledged the need for an updated SOFA scoring system or implementation of a superior scoring system for organ dysfunction in future definitions [1].

Furthermore, by removing the progression from sepsis to severe sepsis to septic shock in place of a more severe definition of sepsis, there have been concerns these stringent guidelines may delay recognition and intervention in patients [13].

However, despite these weaknesses of Sepsis-3, revised definitions are necessary to update diagnostic criteria to reflect current advances in the understanding of the mechanisms and pathophysiology of sepsis.

1.1.1 Global Burden of Sepsis

Sepsis remains a leading cause of death in critically ill patients, with global estimates of 31.5 million cases resulting in 5.3 million deaths annually [14]. In the

United States (US), the prevalence of sepsis is estimated at 1.7 million cases resulting in 265,000 deaths per year [15]. The prevalence of sepsis has increased 13.7% per year from 1979 to 2000, with 659,935 recorded cases in

2000 [16]. During this 22-year period, sepsis incidence also increased 8.7% annually [16]. Sepsis incidence has risen precipitously to 535 hospitalized cases per 100,000 US residents [17], placing sepsis incidence far higher than myocardial infarction (208 cases per 100,000 person-years) [18] and the combination of lung, breast, and prostate cancer (129, 124, and 115 per 100,000, respectively [19]). Despite the shockingly high incidence rates of sepsis, it often receives far less attention than heart disease and cancer. This increase in sepsis incidence can be explained, in part, by augmentations in antibiotic resistance, elderly populations, diseases and treatments that cause immune suppression, transplantation surgeries and other invasive procedures, and nosocomial infections [16].

Sepsis mortality rates are high despite advances in critical care, and 1 in 3 hospital deaths are due to sepsis [20]. Septic patients face a 25-30% mortality rate that rises to 40-50% in cases of septic shock [21]. Globally, mortality rates are highest in the Middle East, Eastern Europe, and South America and lowest in

North America [21]. Among sepsis decedents, the most common listed causes of death were unspecified septicemia, septicemia caused by other gram-negative

bacteria, and septicemia caused by Staphylococcus aureus [22]. Sepsis particularly affects the elderly population. Of sepsis mortalities, 49% of patients were 65-84 years old, 26% were >85 years old, and 25% were 25-64 years old; patients <25 years old accounted for 1% of decedents [22].

These increases in sepsis incidence and prevalence are placing a heavy burden on the US healthcare system. Sepsis is the most expensive condition treated in hospitals in the US, accounting for $24 million in aggregate hospital costs [23, 24]. Costs of sepsis are estimated at $22,000 to 50,000 per patient

[25, 26] with total costs at $17 billion annually [25]. The length of hospital stays has increased from 1979 to 2000 [16], with median ICU and hospital stays of 5 days and 10 days, respectively [15]. Increased hospital stays are problematic, as mortality is higher among patients who contract sepsis after hospital admittance

(25.5%) as compared to patients who present with sepsis upon admission

(13.4%) [16]. Moreover, fewer patients diagnosed with sepsis are discharged to home while a growing number are discharged to long-term care or other health care facilities [16]. Therefore, sepsis represents a growing and ponderous chronic critical health issue.

Sex differences exist in the incidence, prevalence, and mortality from sepsis. Prevalence of sepsis is higher among males than females [15, 16]. From

1979 to 2000, sepsis incidence increased in both sexes; however, incidence increased more rapidly in females [16]. Sepsis incidence occurs later in life for females than males, with a mean age of 62.1 years in females and 56.9 years in males [16]. Furthermore, mortality rates are higher for males than females [15].

These sex differences result from the influence of sex hormones on inflammation and energy and lipid metabolism [27]. Therefore, females appear to be slightly protected from sepsis as compared to males.

1.1.2 Pathogenesis of Sepsis: Cytokine Cascade

The immune response of the host and the resulting pathogenesis of sepsis depend on the location of infection, type of infection, and existing immune status of the host. Sepsis most often originates from infections in the lungs

(40%), abdominal organs (30%), and urinary tract (10%) [28, 29]. In 2000, the leading causes of sepsis were gram-positive bacteria (52.1% of cases) and gram-negative bacteria (37.6% of cases), with polymicrobial infections, anaerobes, and fungi accounting for the remaining cases [16]. Among gram- positive bacteria, Staphylococcus aureus and Streptococcus pneumoniae dominate. On the other hand, Escherichia coli, Klebsiella species, and

Pseudomonas aeruginosa account for the majority of gram-negative bacterial infections [30, 31]. Bacterial components and toxins produced by these microorganisms play a pivotal role in the pathogenesis of sepsis.

Recognition of microorganisms by pattern recognition receptors (PRRs) triggers activation of the innate immune system. PRRs recognize exogenous pathogen-associated molecular patterns (PAMPs), inherent microbial components of bacteria, fungi, parasites, or viruses, or endogenous damage- associated molecular patterns (DAMPs) [32]. The toxins released by the microorganism combined with the cytokines released by the host’s immune

response ultimately result in cell death activation of DAMPs. Therefore, activation of both exogenous and endogenous activation cascades results in an amplified inflammatory response.

Common PRRs in sepsis include Toll-like receptors (TLRs), nucleotide- binding oligomerization domain (NOD)-like receptors, and retinoic acid-inducible gene (RIG)-like receptors. TLRs, perhaps the most studied PRR in sepsis, can detect bacterial components. For example, TLR4 recognizes lipopolysaccharide

(LPS), a potent immunostimulant contained the in the cell walls of Gram-negative bacteria [32]. Interestingly, septic patients possess leukocytes bearing higher expression levels of TLR4 [33, 34]. Upon binding to exogenous and/or endogenous ligands, PRRs induce signaling cascades that ultimately lead to inflammation. PRR binding to PAMPs and DAMPs can result in activation of mitogen-activated protein kinase (MAPKs), Janus kinases (JAKs) or signal transducers and activators of transcription (STATs), or nuclear factor kappa-light- chain-enhancer of activated B cells (NF-), triggering the production of an inflammatory “cytokine storm [35].”

Cytokines are small cell signaling proteins (<40 kDa) that play an important role in immunomodulation via autocrine, paracrine, and endocrine signaling to promote inflammation [36]. Cytokines, including tumor necrosis factor

(TNF), interleukins (IL), chemokines, and interferons, constitute a delicate balance between pro- and anti-inflammatory processes. The pro-inflammatory cytokines TNF-, interleukin (IL)-1, and IL-6 are commonly studied in sepsis; on the other hand, anti-inflammatory IL-10 and IL-1 receptor antagonist (IL-1Ra)

play an immunosuppressive role in sepsis. IL-10 blocks the production of inflammatory cytokines by immune cells in an attempt to dampen the inflammatory process [6, 37, 38]. Cytokine production occurs rapidly after micro- organismal insult, with peak levels of TNF-, IL-6, IL-1, and IL-10 reached 1.5-2 hours after infection and rapidly decreased after 6 hours [39-42]. This cytokine cascade contributes to activation and recruitment of leukocytes, namely monocytes/macrophages, neutrophils, eosinophils, basophils, and natural killers

(NKs) [42, 43]. Recruitment of leukocytes to the site of infection aims to resolve the infection by clearing microorganisms and dead cells and generating inflammation; however, this inflammation becomes problematic when it spreads systemically.

Paradoxically, while systemic inflammation is the hallmark of sepsis, anti- inflammatory cytokines are also heavily produced, resulting in immune suppression. Anti-inflammatory cytokines, such as IL-10 and transforming factor-

 (TGF-) suppress immune function, which increases the risk of opportunistic infection, positive blood cultures, and re-activation of latent viruses in septic patients [44-46]. These anti-inflammatory cytokines are produced by immunosuppressive immature polymorphonuclear leukocytes (PMNs), myeloid- derived suppressor cells (MDSCs), and M2 macrophages, which are increased as a consequence of sepsis [47]. Expansion of T regulatory cells and anergic

(unresponsive) T cells, a shift towards an immunosuppressive T helper 2 (TH2) T cell phenotype, and apoptosis of T cells, B cells, and dendritic cells further drives the immunosuppression of chronic sepsis [47-49]. Ultimately this dichotomy

between inflammation and immunosuppression in chronic sepsis leads to persistent inflammation/immunosuppression and catabolism syndrome (PICS)

[50-53]. PICS, characterized by persistent inflammation, immunosuppression, organ failure, poor wound healing, and cachexia, is a growing problem among chronic critically ill patients and contributes to complications of sepsis, difficulties in treatment strategies, and poor outcomes.

1.1.3 Pseudomonas Aeruginosa

Pseudomonas (P.) aeruginosa is one of the main organisms responsible for nosocomial infections. This opportunistic bacterium commonly afflicts immunocompromised patients, such as intensive care unit (ICU) patients, burn victims, septic patients, and individuals with cystic fibrosis (CF). Among bacteria isolated from blood cultures, P. aeruginosa is the third most frequent gram- negative pathogen and seventh most frequent among all pathogens [54, 55].

Risk of P. aeruginosa infection is increased with presence of a central venous or urinary catheter, previous bacteremia or antibiotic therapy, mechanical ventilation, and neutropenia [56]. P. aeruginosa is associated with a higher fatality rate than other gram-negative bacterial infections, likely due to its high propensity for bacterial resistance [54, 57-60]. Of cultures positive for P. aeruginosa among hospital patients, 29.6% were resistant and 33.3% were multi drug resistant [61]. The rates of drug resistance to this pathogen have been steadily growing [54], indicating a need for new therapeutic strategies to treat conditions that result from P. aeruginosa infection, including sepsis.

P. aeruginosa is an important cause of gut-derived sepsis. Although intestinal colonization of P. aeruginosa is low in healthy individuals, studies have shown that up to 36% of hospitalized patients have P. aeruginosa in their intestinal flora [62, 63], and 21% of these individuals have sepsis [64]. No studies have identified a role of P. aeruginosa in cachexia of gut-derived sepsis; however, P. aeruginosa is the most common infection in CF patients, a chronic lung condition that is associated with growth failure and chronic malnutrition [65,

66]. Moreover, lung infection with P. aeruginosa in mice is associated with significant loss of body weight that correlates with expression of TNF- and IL-1 in bronchoalveolar lavage fluid [67]. Infections with P. aeruginosa are followed by an influx of neutrophils, which release ROS and proteases upon activation [68-

70]. The pervasive nature of P. aeruginosa infection is attributable to is production of virulence factors, antibiotic resistance due to an impermeable outer membrane, and formation of biofilms [71].

Bacteria communicate with each other using secreted signaling compounds through a process called quorum sensing (QS). The gram-negative

P. aeruginosa contains three QS systems: Las, Rhl, and the Pseudomonas quinolone signal (PQS) [72]. The activation of PQS leads to the production of virulence factors such as the heterocyclic, redox-active phenazines [73]. P. aeruginosa releases at least four phenazines: pyocyanin, 1-hydroxyphenazine

(1-HP), and phenazine-1-carboxamide (PCN), which are derived from the common precursor phenazine-1-carboxylic acid (PCA) [74]. In addition to the

blue-pigmented pyocyanin, P. aeruginosa also produces pyoverdine (yellow- green), pyomelanin (light-brown), and pyorubin (red-brown) [75, 76].

1.1.4 Complications and Treatment Strategies

The cytokine storm of sepsis leads to deleterious effects on organ systems, particularly neurological, pulmonary, cardiovascular, renal, hematological, and hepatic dysfunction. Globally, common sepsis comorbidities include chronic obstructive pulmonary disease (COPD), cancer, type II diabetes mellitus, heart failure, chronic renal failure, and immunosuppression [15, 21]. The complex paradox of inflammation and immune suppression in sepsis has created challenges for treatment strategies as well as clinical applications of inflammatory research findings. Moreover, chronic critical illness and intensive care unit (ICU) stays can also lead to long-term reductions in quality of life and cognitive impairments [77, 78]. Chronic critical illness (CCI) is defined as an ICU stay of >

8 days plus the presence of one of the following: sepsis, severe wounds, prolonged mechanical ventilation, tracheotomy, stroke, or traumatic brain injury

[79]. Advances in critical care have increased survival through the acute inflammatory stage of sepsis; however, new issues in treatment strategies have arisen as septic patients progress to CCI and face metabolic alterations, such as hyper-catabolism, for which current nutrition therapies are ineffective.

There is currently no FDA-approved medication to treat sepsis. Infection control, hemodynamic management, and regulation of the cytokine storm form the basis of sepsis treatment. The frontline of treatment involves identification of

the source of infection and antibiotic administration. Antibiotic therapy should be initiated as soon as possible following sepsis diagnosis to reduce the risk of mortality [80, 81]. Sepsis can be caused by different kinds of bacteria, which are best killed by different types of antibiotics. However, because identifying the type of bacteria causing the infection can be time-consuming, physicians usually begin treatment with broad-spectrum antibiotics, such as ceftriaxone, azithromycin, ciprofloxacin, vancomycin, and piperacillin-tazobactam, which cover a wide range of common sepsis culprits. Often, combination antibiotic treatment is preferred [82, 83]. Once the type of bacteria is identified, a more targeted antibiotic treatment protocol should be utilized to reduce costs and the development of antibiotic resistance.

Hemodynamic stabilization involves the use of fluids to prevent dangerous hypotension, organ injury, and shock. Fluid resuscitation in sepsis occurs in four stages: salvage, optimization, stabilization, and de-escalation [84]. Intravenous fluid administration allows the medical team to track the amount and types of fluids the patient receives. Fluids can also help prevent dehydration and kidney failure. Current guidelines recommend commencing treatment with initial fluid resuscitation with 30mL/kg of crystalloid within the first three hours [85]; however, the guidelines for fluid resuscitation in sepsis are an area of controversy [86].

Mechanical ventilation is also used to correct hypoxemia and prevent lung injury

[87].

Lastly, drug development has focused largely on targeting the cytokine storm and early pro-inflammatory phase of sepsis. However, over 150 clinical

trials targeting PRRs, PAMPs, or cytokines have not been successful in improving patient outcomes [47]. In fact, some of these anti-inflammatory therapies actually increased patient mortality [88, 89]. These clinical trials may not have been successful due to improper timing of drug administration or poor identification of target sepsis patient population for treatment [90]. The failure of these clinical trials and lack of identification of a treatment for sepsis highlight the complexity of the pathogenesis of sepsis and the need for novel mechanisms to target for sepsis therapeutic development. However, advancements on this front have been complicated by several drawbacks in the study of sepsis, largely performed in animal models of research.

Animal studies of sepsis utilize host-barrier disruption models, toxemia models, and bacterial infection models to replicate sepsis. Cecal ligation and puncture (CLP), a host-barrier disruption model, is considered the gold standard for experimental sepsis research. This model involves midline laparotomy followed by ligation and puncture of the cecum in order to replicate the human conditions of ruptured appendicitis or perforated diverticulitis [91, 92]. CLP results in a polymicrobial infection as a result of extrusion of fecal contents into the peritoneum; furthermore, the ligated cecum is a necrotic source of inflammation

[91]. In toxemia models, exogenous administration of a toxin to induce sepsis allows researchers to tightly control the experimental model and investigate the effects and mechanisms of particular compounds. Common chemical mediators used include TLR4 activators (i.e. LPS) or TLR9 activators (i.e. immunostimulatory CpG DNA) [91]. This model is popular due to its simplicity.

Bacterial infection involves administration (often injection) of pure or mixed bacterial flora and can provide important insights on the mechanisms of host response to specific pathogens. Furthermore, various sites of infection can be examined, with the peritoneal compartment, lung, and blood being common routes of inoculation. Additionally, bacterial strains can be tested in isolation, and the severity of sepsis can be adjusted by altering the bacterial load used for infection.

Overall, the models presented above represent useful, rapid, and reproducible methods of studying sepsis. The animal models used, such as mice, are small and cost-effective. Furthermore, various strains of mice, including those with knockdown of certain genes either in specific tissues or whole body, allows for valuable mechanistic elucidation of the pathophysiology of sepsis. However, there are major drawbacks to the utilization of animal models for the examination of human sepsis. Namely, the timeline of disease progression is far more rapid in animal models, with animals succumbing to sepsis and organ failure within hours to days as compared to days to weeks in human patients [91]. Furthermore, mice and humans differ in their immune responses, compounding difficulties for clinical translation. Additionally, human sepsis patients usually receive some forms of supportive care (i.e. antibiotics, mechanical ventilation, and enteral/parenteral nutrition); however, these methods are rarely employed in animal studies, and certain forms of supportive care, such as use of antibiotics, may confound the ability to study the effect of pathogen (i.e. in the bacterial infection models) [93].

Lastly, sepsis patients represent a heterogeneous population of different ages,

sex, race, immune function, type of infection, and location of infection that are not easy to replicate in animal studies.

The current treatment strategies for sepsis discussed above merely attempt to control the symptoms of sepsis. The complexity of treating sepsis is evident by the lack of an FDA-approved medication for the treatment or prevention of sepsis. Failure of anti-inflammatory treatments that target the cytokine storm indicate that these endogenous inflammatory pathways may be essential for immunity against sepsis. While these drugs reduce inflammation, they also suppress immune function, thus increasing susceptibility to secondary infection. Identification of efficacious therapies is further complicated by the use of animal models in research that often cannot replicate the complex and dynamic nature of sepsis. Therefore, a growing number of patients are progressing to chronic critical illness and face changes in metabolism that ultimately lead to cachexia. As such, there is a gap in the research for sepsis treatment development, representing a need to identify novel mechanisms of therapeutically targetable sepsis pathogenesis.

1.2 Cachexia in Chronic Critical Illness

Cachexia is a serious complication of sepsis, necessitating the development of novel therapeutic approaches. In addition to sepsis, cachexia is present in cancer, chronic heart failure (CHF), chronic renal failure (CRF), chronic obstructive pulmonary disease (COPD), and human immunodeficiency virus infection/acquired immune deficiency syndrome (HIV/AIDS) [94]. Cachexia

is a complex metabolic syndrome characterized by weight loss, weakness, and fatigue as a result of muscle wasting with or without fat loss [95]. This wasting, associated with increased morbidity and mortality, is often associated with inflammation, anorexia, and insulin resistance as a result of chronic critical illness

[95]. As previously discussed, there are currently no FDA approved medications for the treatment of sepsis. Current treatment strategies, such as antibiotics and fluid resuscitation, have increased acute sepsis survival; however, a growing number of septic patients are progressing to chronic critical illness (CCI), falling victim to the weight loss, hyper-catabolism, and increased risk of mortality associated with cachexia.

Cachexia is diagnosed as edema-free weight loss of at least 5% in 12 months or less, or a BMI <20 kg/m2 plus 3 of the 5 following conditions: low fat- free mass, decreased muscle strength, fatigue, anorexia, or abnormal biochemistry indicating increased inflammation, anemia, or low serum albumin

[95]. Weight loss is consistently associated with poor outcomes and mortality in cancer [96, 97], chronic heart failure [98], HIV [99, 100], and the elderly [101].

Cachexia is often misdiagnosed as malnutrition as it is often associated with reductions in appetite. Malnutrition is distinct from cachexia as it can be overcome with adequate nutrition and proper absorption and utilization of nutrients [102]. Furthermore, during starvation, metabolism attempts to preserve body composition, particularly lean mass, while the inflammation associated with cachexia contributes to hyper-catabolism and wasting of fat and lean mass [103].

While anorexia is common in chronic critical illness, the loss of muscle and fat mass often precedes a drop in food intake [104, 105].

Due to the deleterious effects on quality of life and patient outcomes, the muscle wasting of cachexia has been extensively studied. In skeletal muscle, the accelerated loss of muscle mass contributes to fatigue and distinguishes cachexia from weight loss caused by reduced intake [106]. The wasting of muscle is attributed to increased protein breakdown and reduced protein synthesis [107, 108], with breakdown of the actin and myosin proteins as the primary mechanism [109, 110]. Inflammatory markers such as NF-κb have been shown to increase protein breakdown [111]. The weakness and fatigue created by muscle cachexia necessitates the use of mechanical ventilation, prolonging hospital stays and increasing risk of lung injury and mortality [107]. In septic cachexia, pro-inflammatory cytokines, glucocorticoids, and the ubiquitin- proteasome system result in increased muscle wasting [112, 113]. While muscle wasting is similar between males and females in moderate weight loss cachexia, severe weight loss results in a sexually dimorphic effect on muscle function, with males losing more muscle function than females [114, 115].

While the wasting of muscle has been extensively studied in cachexia

[107, 108, 112, 113, 116], the loss of fat mass in cachectic patients is poorly understood [95]. Furthermore, the loss of fat may precede muscle wasting of cachexia, and lipolysis contributes to reductions in muscle mass [117, 118].

Increases in lipolysis [119-124] and fatty acid oxidation [122, 125, 126] in cachexia result in fat loss that is predictive of poor survival [127-129].

Furthermore, increased thermogenesis in brown adipose [130, 131] and browning of white adipose tissue [132-135] have been reported in mouse models of cancer cachexia and may further augment the wasting of adipose tissue.

White adipose tissue (WAT) plays a critical role in the regulation of cachexia [136]. In cancer, adipose cachexia has been associated with increased lipolysis [123, 124, 137], reduced lipogenesis [138], alterations in adipogenesis genes [139, 140], and altered remodeling of the extracellular matrix [139, 141,

142]. In both human and mouse cancer cachexia, WAT had increased expression of nuclear factor  (NF-), inflammatory cytokines TNF-), IL-1, and IL-6, and NACHT, LRR and PYD domains-containing protein 3 (NLRP3) inflammasome activation [136, 143]. Furthermore, cachectic adipose tissue was apoptotic as measured by Caspase-3 and -9 cleavage as well as remodeling of the extracellular matrix [142]. Clinical studies of cachectic cancer patients demonstrated increased mRNA abundance of adiponectin, TNF-, and IL-6 in subcutaneous adipose tissue [143]. Interestingly, these changes in gene expression were exclusive to subcutaneous adipose and were absent in visceral fat [143]; therefore, subcutaneous adipose tissue potentially has a greater contribution to the inflammation and progression of cancer cachexia. Even within visceral fat, different depots (i.e. retroperitoneal fat and mesenteric fat) respond differently to atrophy, inflammation, and changes in adipocyte size in cancer cachexia [140, 142, 144].

It is evident that understanding early mechanisms of adipose cachexia is essential for the development of potential therapies. In a study of early cancer

cachexia in mice, increased basal lipolysis and phosphorylation of hormone sensitive lipase (HSL) were associated with reductions in body weight, muscle mass, and the mass of epididymal, inguinal, and interscapular brown fat [119].

Indirect calorimetry of mice with early cancer cachexia revealed elevations in total energy expenditure (TEE) and rectal temperature and decreased locomotor activity and respiratory exchange ratio (RER) [119]. However, studies in cancer cachexia have revealed normal [145], reduced [146], or elevated [147] TEE depending on the type of cancer. Reductions in RER indicate greater oxidation of fat as an energy source. Moreover, fatty acid oxidation and thermogenesis were increased in brown adipose tissue from cachectic mice [119].

1.2.1 Fat Metabolism in Sepsis

Cachexia is associated with hyper-catabolism and metabolic alterations including increased lipolysis, hyperglycemia, hyperlactatemia, and hypoaminoacidemia, which ultimately contribute to the wasting of fat and lean mass [148]. Hypoaminoacidemia is a result of increased utilization of amino acids that cannot be compensated by muscle catabolism [149, 150]. Increases in plasma lactate can augment the Cori cycle to convert lactate to glucose in the liver during cachexia [151]. Since the Cori cycle is energy-consuming, this increase in glucose flux may contribute to weight loss [151].

After consuming dietary fat, lipid triglycerides (TGs) are hydrolyzed to free fatty acids (FFAs) and glycerol by intestinal lipases. In the enterocyte, the FFAs are re-esterified with glycerol, forming TGs that enter the lymphatic circulation as

chylomicrons. These TGs can be hydrolyzed by lipoprotein lipase (LPL) to release fatty acids that can be stored as energy in adipose tissue. In the postprandial period, this stored energy can be liberated via lipolysis by hormone- sensitive lipase (HSL), producing non-esterified fatty acids (NEFAs) and glycerol

[152]. Catecholamines, which are increased in sepsis, activate HSL and stimulate lipolysis [153].

Adipose tissue can be divided into subcutaneous and visceral fat.

Subcutaneous fat is found under the skin, while visceral fat is found in the abdomen and around organs. Visceral fat is more vascular and innervated than subcutaneous fat, and its blood drains through the portal vein, providing the liver with direct access to free fatty acids and adipokines [154]. Visceral adipose tissue contains more glucocorticoid receptors involved in the metabolic regulation

[155, 156] and more adrenergic receptors, indicating a greater capacity for catecholamine-induced lipolysis during sepsis [157, 158].

Fat is the preferred energy fuel source of sepsis [120, 159, 160]. The increase in fat oxidation and resting energy expenditure of septic patients is associated with an increase in lipid cycling and plasma NEFAs that cannot be suppressed with glucose infusion [161-164]. In sepsis, increased plasma NEFAs are reflective of augmented lipolysis [165, 166]. The cytokine storm of sepsis can contribute to lipolysis, as TNF- can directly increase lipolysis [167]. Increases in

TNF- may increase circulating lipid by inhibiting lipoprotein lipase, preventing uptake of circulating fatty acids for storage in adipose tissue [168]. Furthermore, catecholamines, which can trigger lipolysis, are elevated in septic patients [169].

Glucagon is also elevated in sepsis and can drive lipolysis and catabolism [148,

170]. Increased plasma NEFAs results in greater fatty acid oxidation, which is reflected by a lower respiratory quotient in sepsis [159]. Additionally, increased circulating NEFAs can augment proteolysis and exacerbate wasting of lean mass

[171].

1.2.2 Septic Cachexia

The metabolic alterations of sepsis, including insulin resistance, hyperlactatemia, hypercatabolism, muscle wasting, and lipoatrophy [94, 172,

173], contribute to cachexia pathogenesis (Figure 1.1). The relationship between inflammation and altered metabolism in sepsis is described as the metabolic inflammatory complex or immunometabolism [174]. Mitochondrial dysfunction leads to the release of mitochondrial DNA, which triggers activation of the NLRP3 inflammasome, production of ROS, and release of mitochondrial DAMPs, ultimately contributing to increased systemic inflammation and multiple organ dysfunction [94, 175-177]. Metabolic dysfunction and inflammatory pathways, such as NF-B and hypoxia-inducible factor 1-alpha (HIF-1), enhance each other in a feed forward mechanism [175-177].

High levels of plasma lactate, or hyperlactatemia, is a “hallmark of sepsis” linked to increased mortality [178]. Increased production as opposed to reduced clearance of lactate is implicated in hyperlactatemia. The increased production of lactate is believed to result from cytopathic hypoxia, the shift from mitochondrial oxidative phosphorylation to anaerobic glycolysis for the production of adenosine

triphosphate (ATP), even in the presence of oxygen [179, 180]. This metabolic shift has also been established in cancer as the Warburg effect and in diabetes as pseudohypoxia [181]. Studies have suggested that adipose tissue may be the site of lactate generation in sepsis [182]. In septic patients, increased lactate clearance in the blood [183, 184] and in adipose tissue [182] is associated with improved clinical outcomes.

Rates of obesity have grown at an alarming rate, and obesity is independently associated with increased all-cause mortality [185]. However, the obesity paradox indicates that fat mass may play a protective role in sepsis.

Obese and overweight septic patients have improved outcomes as compared to normal-weight patients [186-188]. In mice, high fat feeding prior to sepsis induction by CLP stabilized body temperature, improved immune response, and increased survival [189]. Another study in mice using CLP found that obese mice lost more fat mass but less lean mass than lean mice, which was associated with improved hepatic fatty acid and glycerol metabolism and reduced serum fatty acids in obese mice [190]. Furthermore, the authors of this study suggest obese mice may have a different metabolic response to sepsis, as body fat was more reduced in obese mice while muscle protein and triglycerides in muscle and liver were preserved [190]. Greater fat depots of obese individuals allow more fatty acids and glycerol to be released and subsequently utilized, thus protecting vital organs. Interestingly, while the loss of body weight, fat mass, and lean mass were not affected by parenteral nutrition, obesity appeared to protect against muscle wasting and weakness [190].

There is a growing appreciation that adipose tissue is an endocrine organ that can secrete adipokines. Adipocytes produce monocyte chemoattractant protein-1 (MCP-1), triggering the infiltration of macrophages into fat depots that then secrete inflammatory cytokines [154]. These adipokines, which are implicated in cachexia pathogenesis, include IL-6, TNF-, leptin, adiponectin, and C-reactive protein (CRP) [154]. Moreover, visceral adipose tissue is capable of producing these inflammatory adipokines to a greater extent than subcutaneous fat [191-193] and is more susceptible to weight loss [194].

Very few studies have investigated adipose cachexia in sepsis. In one study investigating the catabolic state of sepsis, C57BL/6 mice that underwent cecal ligation and puncture (CLP) had reduced body weight within 24 hours with peak body weight reductions at 2-4 days [195]. While mice undergoing sham surgery were able to restore their body fat mass to normal by day 10, mice with

CLP-sepsis failed to replete their white adipose tissue [195]. This acute reduction in body weight was associated with increased endoplasmic reticulum (ER) stress, apoptosis, proteasome activity, increased NLRP3 inflammasome activation, and lipolysis as well as decreased adipose lipogenesis [195].

Similarly, in humans injected with lipopolysaccharide, early endotoxemia was associated with increased lipolysis and glycerol release from adipose tissue

[196]. The recovery phase of experimental sepsis was associated with increased global protein synthesis independent of mTORC1, increased autophagy, NLRP3 inflammasome activation, ER stress, and decreased lipolysis and lipogenesis in

WAT [195]. TNF-α remained elevated in both eWAT and plasma of mice

recovering from sepsis, but the elevation of IL-1β only persisted in eWAT [195].

These results indicate that adipose tissue is an important contributor to septic cachexia; however, further studies are needed to elucidate the mechanisms of adipose wasting during acute and chronic sepsis.

1.2.3 Current Treatment Strategies for Cachexia

Cachexia, unlike malnutrition, cannot be successfully treated with nutrition therapy alone. The inflammation associated with cachexia impairs nutrient utilization [197]. The wasting of lean and fat mass and metabolic dysregulation of cachexia cannot be treated by adequate feeding, even in cases of total parenteral nutrition [198]. Overfeeding does not have any additional benefit for nitrogen balance and can actually contribute to increased mortality [199]. Studies utilizing total parenteral nutrition (TPN) or appetite stimulants such as Megace® have demonstrated that any weight gain that occurs from these treatments is a result of increases in fat or body fluid [200-202]. Treating cachexia involves not only meeting nutrient needs but also necessitates addressing the underlying inflammation, as much of the energy supplied will be used to synthesize acute- phase proteins [103]. Treatment should commence as soon as possible, as a

“window of anabolic potential” to slow or prevent cachexia exists early in the disease trajectory [203]. Unfortunately, nutritional assessment is often not a clinical priority [204].

Lipid emulsions provide fatty acids at a high energy content and low osmolarity to help meet the increased energy demands of sepsis [205, 206]. A

mix of long-chain and medium triglycerides (LCTs and MCTs, respectively) is recommended, and there is a growing understanding of the benefit of omega-3 polyunsaturated fatty acids in septic patients. For example, omega-3 fatty acids have been shown to stimulate protein synthesis and prevent catabolism in cancer cachexia [207]. Omega-3s are believed to be beneficial in treating cachexia by inhibiting TNF- and IL-1 by blocking cyclooxygenase (COX) and lipoxygenase

(LO) pathways and inhibiting the acute phase response [208-210].

Either enteral nutrition (EN) or parenteral nutrition (PN) can be used to provide lipids to septic patients. EN involves feeding the patient orally and is associated with fewer complications than PN because it helps maintain gut function, a healthy microbiome, and proper immune function [211]. On the other hand, PN utilizes intravenous administration of nutrition that can be tightly controlled. While PN may be useful in gut-derived sepsis to bypass a dysfunctional gut, PN can result in gut mucosal atrophy that can contribute to increased inflammation and secondary sepsis [212].

In addition to nutrition therapies, anti-cytokine agents, anti-inflammatories, and anabolic agents, such as androgen receptor modulators, growth hormone, and testosterone derivatives represent potential pharmacological treatments for the management of weight loss in cachexia [208-210]. However, evidence of the efficacy of these interventions is limited, and there remains no standard treatment for septic patients with cachexia. Therefore, there is a need for a better understanding of cachexia mechanisms, leading to combination therapies

involving nutrition support coupled with anti-inflammatory pharmacologics to target the underlying causes of cachexia.

1.3 The Aryl Hydrocarbon Receptor (AhR)

AhR is a ligand-activated transcription factor belonging to the basic helix- loop-helix/Per-Arnt-Sum (bHLH/PAS) family. Unstimulated AhR in the cytoplasm is in a complex bound to heat shock protein 90 (Hsp90), X-associated protein 2

(XAP2), and p23 [213]. Upon ligand binding, AhR undergoes a conformational change resulting in the exposure of a nuclear localization signal and translocation to the nucleus where AhR forms a heterodimer with the AhR nuclear transporter

(ARNT) and binds to specific AhR response elements upstream of target genes

[213] (Figure 1.2). In its classical role in drug and xenobiotic metabolism, AhR binds to xenobiotic response elements in the promoter regions of genes such as cytochrome P450 (CYP) genes CYP1a1, CYP1a2, and CYP1b1 [214]. These phase I metabolic enzymes assist in the clearance of xenobiotic AhR ligands, such as environmental pollutants.

AhR exhibits promiscuous ligand binding to many drug and xenobiotic exogenous ligands. Environmental persistent organic pollutants (POPs), such as the halogenated and polycyclic aromatic hydrocarbons, are AhR ligands [213], including 2,3,7,8-Tetrachlorodibenzodioxin (TCDD) and coplanar polychlorinated biphenyls (PCBs) [213]. AhR detoxifies these lipophilic compounds by hydroxylation, increasing their water solubility and excretion [215]. Although much of the AhR has focused on detoxification and biological effects of

xenobiotics, there is growing interest in physiological roles of this highly- conserved protein [216], as studies in AhR knockout mice have produced phenotypes in the absence of xenobiotics [217-219]. Furthermore, AhR has demonstrated roles in endogenous processes including immunity [220-222], inflammation [223, 224], and adipocyte biology [219, 225, 226], as discussed in further detail below. AhR also exhibits non-canonical activation, including interactions with NF-B [227, 228] and estrogen receptor signaling [229, 230].

AhR signaling can be terminated by proteasome degradation and negative feedback from the AhR repressor (AhRR). Upon dissociation from ARNT, a nuclear export sequence is revealed, which permits AhR to be transported back to the cytoplasm [231]. Once in the cytoplasm, AhR undergoes in-mediated receptor protein degradation by the 26S proteasome [232-235]. The AhR response is also regulated by AhRR, another member of the bHLH/PAS family of transcription factors localized to the nucleus [236]. AhRR bears structural similarity to AhR and is able to form heterodimers with ARNT and bind to AhR response elements [237]. However, AhRR is believed to act independently of ligands as it lacks a proper ligand-binding domain and cannot bind TCDD [238,

239]. AhR activation regulates transcription of AhRR [240-242]; therefore, AhR binding to ligand activates AhR and leads to transcriptional upregulation of both

CYP1a1 and AhRR. AhRR then exerts negative feedback on AhR-induced transcription by either competitive binding or trans-repression [237, 238]. In the first instance, AhRR binds to ARNT and prevents DNA-binding of AhR-ARNT heterodimers; thus, AhRR competes with AhR for ARNT binding and AhRR-

ARNT dimers compete with AhR-ARNT for DNA binding [238]. Additionally,

AhRR may act as a trans-repressor, affecting protein-protein interactions without direct binding to DNA [237, 243].

1.3.1 Ligands of the AhR

AhR ligands can be categorized as agonists, antagonists, selective modulators, and indirect regulators. AhR agonists, which act in the canonical pathway to bind AhR and activate transcription of downstream target genes, are the most extensively studied AhR ligands and include both exogenous and endogenous agonists. As previously mentioned, exogenous ligands include the synthetic environmental agonists halogenated and polycyclic aromatic hydrocarbons, such as TCDD and PCBs [213] (Figure 1.3). Additionally, natural exogenous ligands, such as the plant flavonoids quercetin, galangin, and indole-

3-carbinol have demonstrated AhR agonist activity [244-246].

In addition to the well-researched exogenous ligands of AhR, studies have suggested the presence of endogenous ligands of AhR, indicated by AhR activation in the absence of exogenous ligands [247-250]. The most heavily studied of these putative endogenous ligands are the indoles, tryptophan metabolites such as kynurenine, kynurenic acid, and 6-formylindolo[3,2- b]carbazole (FICZ) [251-254]. Indigo and indirubin, also tryptophan metabolites, were recently reported to have more potent AhR agonism than TCDD in yeast cell systems [255]. The tetrapyroles bilirubin and its precursor biliverdin have

demonstrated AhR agonism [256-258]. Lastly, arachidonic acid metabolites, such as lipoxin A4 and prostaglandins, have weak agonist activity [259, 260].

In contrast, AhR antagonists inhibit nuclear translocation of the receptor by competitive binding to the AhR ligand-binding domain. Potent and reliable

AhR antagonists have been difficult to find, as many antagonists possess partial agonist activity [261]. For example, - naphthoflavone is an AhR antagonist with partial AhR agonist activity that is able to antagonize AhR at high concentrations by competing with AhR ligands [262]. 6,2’,4’-trimethoxyflavone (TMF) is an AhR antagonist; however, prolonged exposure to TMF results in weak partial agonism

[261]. On the other hand, CH-223191 is a potent, pure competitive antagonist of

AhR [263-265].

Less is known about indirect regulators and selective AhR modulators.

Indirect regulators of AhR are poorly understood and influence AhR signaling without binding to the receptor’s ligand-binding domain. The polyphenol epigallocatechin gallate (EGCG), found in green tea, antagonizes AhR without binding to the ligand-binding domain [266]. On the other hand, selective AhR modulators do bind to the AhR ligand-binding domain, triggering translocation of the receptor into the nucleus and dimerization with ARNT [267, 268]. However, these ligands are able to act as agonists or antagonists through non-canonical pathways without binding to DNA AhR response elements [267-269].

As the list of novel putative ligands of AhR grows, so does the understanding of the myriad of physiological roles downstream of AhR activation.

While AhR sensing of exogenous environmental toxins and subsequent

activation pathways has been well studied, there is growing interest in endogenous and dietary ligands of AhR, many of which may play a role in immunity [253, 270, 271]. Notably, Moura-Alves et al. recently demonstrated

AhR’s ability to detect and potentially detoxify pathogen-associated molecular patterns (PAMPs), including the pigmented bacterial virulence factors pyocyanin

(PYO), 1-hydroxyphenazine (1-HP), phenazine-1-carboxylic acid (PCA), and phenazine-1-caboxamide (PCN) from Pseudomonas aeruginosa as well as the napthoquinone phthiocol (Pht) produced by Mycobacterium tuberculosis [270].

Therefore, AhR appears to play a role in bacterial defense by clearing bacterial virulence factors and activating innate immunity.

1.3.2 Role of the AhR in Adipocyte Biology

AhR is involved in the development of several different cell types including adipocytes. The functions of adipocyte AhR are of particular interest due to the lipophilicity of AhR ligands, including POPs, which results in their accumulation in adipose tissue in close contact to adipocyte AhR [272]. Several studies have demonstrated POP-mediated regulation of adipocyte differentiation [219, 225] and increased production of inflammatory cytokines such as TNF-α through an

AhR-dependent mechanism in mature adipocytes [225].

In murine 3T3-L1 cells differentiated to adipocytes, AhR expression decreases throughout adipocyte differentiation [273, 274]. Expression of the

ARNT protein also decreases during differentiation [273]. Furthermore, when eWAT was excised from C57BL/6J mice and digested into a stromal vascular

fraction (SVF) and an adipocyte fraction, the SVF fraction possessed higher mRNA abundance of AhR as compared to adipocytes [274]. AhR’s inhibitory control of adipocyte differentiation is independent of the presence of exogenous

AhR ligands added to the experimental system. The downregulation of AhR during adipocyte differentiation is sufficient to yield the loss of function response to xenobiotics, including the inhibitory effect of TCDD [273]. Moreover, overexpression of AhR inhibits adipocyte differentiation as indicated by reduced oil red O staining and mRNA abundance of aP2 and CCAAT/enhancer-binding proteins (C/EBPs) [275]. On the other hand, 3T3-L1 cells expressing antisense

AhR mRNA had slightly increased adipocyte differentiation compared to controls

[275].

The downregulation of AhR during adipocyte differentiation occurs at the transcriptional level, and inhibition of the 26S proteasome responsible for degrading AhR had no effect on AhR cellular protein levels [274]. AhR’s inhibitory effect on adipocyte differentiation was facilitated by hyper-activation of the p42/p44 MAP kinase [275]. Interestingly, AhR overexpression had no effect on

PPAR mRNA abundance, and addition of PPAR activators restored the ability of cells overexpressing AhR to differentiate to adipocytes [275]. Together, these results suggest AhR inhibits adipocyte differentiation during early stages of clonal expansion before the activation of PPAR.

Exogenous AhR ligands also exert effects on adipocyte differentiation.

Specifically, exposure of 3T3-L1 cells to TCDD (10 nM) reduced adipocyte differentiation [225, 226]. However, the timing of TCDD exposure was critical for

a negative effect on differentiation. When 3T3-L1 cells were exposed to TCDD within 24 hours of the induction of differentiation, adipocyte differentiation was reduced [273]; however, if TCDD was added 48 hours after the induction of differentiation, normal adipocyte differentiation was observed [226, 273]. These results lend further support that AhR’s inhibitory control occurs early in the differentiation process. Previous studies in our laboratory demonstrated the ability of another AhR ligand, PCB-77, to alter adipocyte differentiation of 3T3-L1 adipocytes and induce the expression of TNF- in differentiated adipocytes [225].

While the early effects of TCDD impacted inflammation and differentiation, treatment of mature 3T3-L1 adipocytes with TCDD induced lipolysis [276].

Moreover, in vivo exposures to TCDD resulted in a wasting syndrome associated with weight loss, lean and fat mass loss, decreased lipoprotein lipase (LPL) activity, and hyperlipidemia in guinea pigs [277]. Development of TCDD wasting syndrome could be explained by inhibition of adipocyte differentiation and activation of inflammatory cytokines observed in vitro [225].

Consequently, our laboratory demonstrated a role of AhR and endogenous AhR ligands in the regulation of body weight, using a mouse model of adipocyte-specific AhR deficiency (AhRAdQ) using the Cre-LoxP system under control of the adiponectin promoter (AhRAdQ) (mice were on a C57BL/6J genetic background) [247]. When challenged with a high fat diet for 12 weeks, AhRAdQ mice had greater increases in body weight, increased fat mass, decreased lean mass, and increased adipocyte size compared to floxed littermate controls [247].

Together, these results suggest a role for AhR in the regulation of body weight.

1.3.3 Immune Function

AhR has been implicated in endogenous regulation of immunity and inflammation [278-281]. The generation of AhR knockout (KO) mice revealed a role of AhR in development and immunity. In the postnatal period, AhR KO mice had higher rates of mortality and slower growth [282, 283]. Furthermore, AhR KO mice had organ abnormalities, including alterations in the structure and function of the liver, spleen, and lymph nodes [282-284]. These initial findings have provoked an expansive study of AhR’s role in immune function, particularly at barriers that serve as the frontline defense against toxins and infections, such as the gut, skin, and lung.

AhR regulates the development of immune cells, including T cells, B cells, and hematopoietic stem cells. Among T cells, AhR is expressed in IL-17-

+ producing T (TH17) cells, FoxP3 regulatory T (Treg) cells, and Type 1 regulatory

T (TR1) cells but not in T helper Th1 or Th2 cells [224]. Studies have demonstrated AhR’s contribution to the differentiation of TH17 cells, which are implicated in autoimmunity and produce proinflammatory cytokines such as IL-

17, IL-21, IL-22, and granulocyte-macrophage colony-stimulating factor (GM-

CSF) [223, 224, 285-288]. AhR also plays a role in the regulation of Treg cells and

TR1 cells; however, the mechanisms of AhR signaling in these cell types remain to be fully elucidated. TCDD has repeatedly been shown to result in an increased population of Treg cells in mice [220, 221, 286, 289, 290]. However, it remains unclear if the increase in numbers of Treg cells is due to increased proliferation or

decreased apoptosis [287]. Interestingly, endogenous ligands, namely the tryptophan metabolites kynurenine and FICZ have opposing effects on Treg cell populations [222]. AhR also promoted differentiation of TR1 cells that produced the anti-inflammatory cytokine IL-10, which plays a crucial role in resolving inflammatory responses [291]. Therefore, AhR plays a diverging role in immunity that can either be pro-inflammatory or anti-inflammatory based on the target immune cell population. B cells express AhR, and AhR activation by TCDD suppressed differentiation and inhibited humoral immunity [292, 293]. However, the mechanisms of AhR’s contribution to B cell regulation and development are not well understood. Lastly, AhR plays a functional role in hematopoietic stem cell differentiation. Antagonism or knockout of AhR reduced differentiation and expansion of hematopoietic stem cells [294, 295].

Innate lymphoid cells (ILCs) are lymphocytes expressed highly at mucosal sites, such as the gut. ILC3s express AhR and are capable of producing IL-17 and IL-22 [296]. Studies have demonstrated AhR’s role in the development of

ILC3 cells as well as their production of IL-22 [281, 297, 298]. AhR maintains ILC as well as intraepithelial lymphocytes (IELs) in the gut [271, 281, 297-299], indicating an important function of AhR in intestinal barrier maintenance, which can ultimately influence bacterial translocation.

AhR is implicated in the regulation of pattern recognition receptors (PRRs) such as the NACHT, LRR and PYD domains-containing protein 3 (NLRP3) inflammasome. The NLRP3 inflammasome is formed upon exposure to stimuli during infection or metabolic dysregulation, including bacterial toxins and

extracellular ATP; therefore, NLRP3 plays an important role in innate immunity by facilitating in the production of IL-1 and IL-18 via activation of caspase-1

[300, 301]. AhR suppressed NLRP3 inflammasome activation [302] and also inhibited NF-B transcription, which are essential for NLRP3 expression [303-

305]. Therefore, AhR is able to impact inflammation by suppressing NF-B transcription of IL-6 and TNF- [306] and inhibiting NLRP3 activation of caspase-

1 and IL-1 secretion [302].

Furthermore, recent studies have shown that AhR binds and senses pathogen-associated molecular patterns (PAMPs) and directly senses pigmented bacterial virulence factors [270], including those produced by the gram-negative bacteria Pseudomonas (P.) aeruginosa, one of the main organisms responsible for nosocomial infections. Therefore, it is highly likely that AhR activation by bacteria-derived factors contributes to sepsis pathogenesis. Specifically, AhR KO mice were more susceptible to LPS-induced septic shock compared to wild type control mice [306, 307]. This increased susceptibility was attributed to AhR’s effect on macrophages, believed to be mediated by a reduction in expression of plasminogen activator inhibitor-2 (Pai-2) [307]. Both whole body and macrophage-specific AhR KO mice had increased mortality following LPS challenge, which was accompanied by increased plasma concentrations IL-1,

IL-18, TNF-, and IL-6 [307].

Moura-Alves et al. investigated the role of AhR in sensing bacterial pigments in P. aeruginosa infection. Following intratracheal infection with P. aeruginosa, mice developed respiratory distress and severe disease [270]. AhR

KO mice (AhR-/-) had higher bacterial loads of P. aeruginosa in their lungs, greater tissue damage, and succumbed more quickly to infection compared to wild-type controls [270]. AhR-/- mice had reduced neutrophil numbers and expression of neutrophil chemoattracts CXCLI and CXCL2 after infection, indicating a role of neutrophil recruitment in host defense against P. aeruginosa

[270]. Additionally, AhR played a role in the cytokine response to P. aeruginosa infection, as the ability or P. aeruginosa infection to increase IL-1, IL-1, and

RANTES/CCL5 was attenuated in AhR-/- mice [270]. Furthermore, AhR sensing of bacterial phenazines facilitated host resistance to infection by reducing bacterial burden, which is potentially linked to the clearance of pyocyanin [270].

Therefore, AhR can be viewed as a PRR that can recognize and potentially metabolize bacterial pigments, a new class of PAMPs. Overall, AhR plays a critical role in immune function and diseases of inflammation, such as sepsis; therefore, interventions targeted at AhR may provide a novel treatment strategy for patients with inflammatory disorders, including sepsis caused by bacteria that produce AhR-activating phenazines.

1.4 Pyocyanin: An Overview

The tricyclic phenazine pyocyanin is a blue-pigmented virulence factor released by Pseudomonas (P.) aeruginosa. Pyocyanin is a low molecular weight zwitterion believed to easily cross cell membranes [308-310]. With a pKa of 4.9, pyocyanin is weakly acidic [311-314]. While pyocyanin is a neutral, blue molecule at physiological pH, protonation at one of the central nitrogens in acidic

environment causes pyocyanin gain charge turning it red in color (Figure 1.4)

[308-310]. Pyocyanin is synthesized from the common phenazine precursor phenzine-1-carboxylic acid (PCA) by the phzM and phzS enzymes [315]. PCA is first converted to 5-methylphenazine-1-carboxylic acid betaine by phzM, which then undergoes hydroxylative decarboxylation by phzS to become pyocyanin

(Figure 1.4) [316].

P. aeruginosa releases pyocyanin via a type II secretion system [317], and infected patients have been demonstrated to have concentrations of pyocyanin up to 130M in bodily secretions, including sputum, urine, wounds, and ear secretions [318-320]. Only recently has pyocyanin been quantified systemically.

Arora et al. detected pyocyanin (10 nM) in the plasma of mice exposed to 50

g/L of pyocyanin via intranasal delivery [321].

Pyocyanin possesses antibacterial activity that allows it to kill off competitors of P. aeruginosa. Pyocyanin antibacterial activity impedes the ability of the competitor bacteria to perform active transport by acting on the cell membrane respiratory chain [310, 315, 322]. Pyocyanin negatively impacted active transport in organisms and produced deleterious reactive oxygen species

(ROS) [315, 323]. Studies have also shown pyocyanin has anti-fungal activity against Aspergillus fumigatus and Candida albicans [324]. Pyocyanin also promoted the formation of biofilms by increasing the release of extracellular DNA

[325], which increased longevity of infection by P. aeruginosa.

A recent study by Moura-Alves and colleagues demonstrated the ability of pyocyanin to activate AhR in a dose-dependent manner in pneumocytes and

macrophages [270]. Pyocyanin also increased expression of CYP1a1, a marker of AhR activation, which was attenuated when AhR was silenced in these cell types [270]. When macrophages were treated with various strains of P. aeruginosa, the strains overproducing pyocyanin had consistently higher AhR activation as compared to bacterial strains that lacked phenazine production

[270]. In pneumocytes, pyocyanin degradation was observed and appeared to be mediated by AhR [270]. Studies in A549 alveolar epithelial cells suggest pyocyanin has a half-life of ~12 hours [326].

1.4.1 Physiological Effects

Oxidative Stress

Pyocyanin is a redox-active compound capable of producing reactive oxygen species (ROS), namely superoxide and hydrogen peroxide [312, 327-

329]. ROS are produced when pyocyanin undergoes non-enzymatic, cyclic reduction by NAD(P)H, oxidizing intracellular pools of NADPH and GSH directly by accepting electrons [312, 327, 330, 331]. This reduced form of pyocyanin then donates electrons to oxygen to produce superoxide [312, 327, 330]. Superoxide dismutase (SOD) can subsequently transform superoxide to hydrogen peroxide

[327].

P. aeruginosa infection reduces the protective antioxidant enzymes superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-

Px) in mice [332], and pyocyanin alone can decrease CAT activity in alveolar epithelial cells [326]. Furthermore, studies have suggested pyocyanin can directly oxidize GSH to GSSG and produces hydrogen peroxide in the process [311]. In

human tracheobronchiolar epithelial cells, pyocyanin increased the production of superoxide and hydrogen peroxide, which led to increased mucin synthesis and mucin (MUC) and MUC2 gene expression [333]. Furthermore, as indicators of oxidative stress, SOD2 and growth differentiation factor (GDF)-15 were increased while catalase was decreased in epithelial cells treated with pyocyanin

[333].

The redox-active nature of pyocyanin is thought to be responsible for most of its effects described on host cells [330]. Together, these ROS can cause free radical damage and oxidative stress to cells and DNA. Production of oxidative stress is a major contributor to pyocyanin’s cytotoxicity. Pyocyanin’s induction of oxidative stress affects calcium homeostasis, inhibits cellular respiration, prostacyclin release, and release of nitric oxide [315]. Strains of P. aeruginosa that overproduce pyocyanin exhibit greater oxidative stress, cell lysis, and extracellular DNA (eDNA) levels than wild-type strains [325]. Increased eDNA contributes to the formation of biofilms, which augment the persistence of P. aeruginosa infections [325].

Inflammation and Immunomodulation

The generation of reactive oxygen species contributes to augmented inflammation and immunomodulatory effects of pyocyanin. For example, in murine bone marrow derived macrophages, pyocyanin inhibited activation of the

NLRP3 inflammasome, therefore blocking Caspase-1 maturation and IL-1 release [334]. This inhibition of the NLRP3 inflammasome was the result of reactive oxygen and reactive nitrogen species by pyocyanin [334]. These results

suggest that anti-inflammatory effects of pyocyanin may help P. aeruginosa evade detection, allowing for more persistent and pervasive infections [334].

Pyocyanin also increases inflammatory cytokine production. P. aeruginosa infections are marked by recruitment of neutrophils, which is facilitated by IL-8

[335]. Pyocyanin has been shown to increase IL-8 release from human airways epithelial cells in a dose-dependent manner, potentially through a mechanism involving oxidants and signaling through protein tyrosine kinases (PTKs) and

MAP kinases (MAPKs) [336, 337]. Furthermore, in these same airway samples, pyocyanin inhibited RANTES expression [336, 337]. The thiol antioxidant N- acetyl cysteine (NAC) is able to scavenge oxidants formed in response to pyocyanin and reduced pyocyanin’s ability to increase IL-8 release, indicating a role of ROS in pyocyanin’s ability to regulate cytokines [336]. Furthermore, pyocyanin (100M) has been demonstrated to increase IL-6 release from urothelial cells to a greater extent than LPS [338]. In human tracheobronchiolar epithelial cells (TBECs), pyocyanin increased inflammatory cytokine expression of IL-1, IL-1, IL-6, IL-8, TNF-, as well as the inflammatory mediators G-CSF,

GM-CSF, CXCL1, CXCL2, CXCL3, CCL20, CXR4, IL-22, Serum amyloid A 1

(SAA1) and SAA2 [333].

Pyocyanin also influences neutrophil function as a means of prolonging P. aeruginosa infection. Normally, resolution of acute inflammation involves apoptosis of recruited inflammatory cells such as neutrophils. Pyocyanin has been shown to induce apoptosis of human neutrophils but not epithelial cells or macrophages in a dose-dependent manner in concentrations up to 100M even

in the presence of anti-apoptotic LPS [339]. Pyocyanin also increased generation of reactive oxygen intermediates and reduced intracellular CAMP and ATP as mechanisms preceding this increase in neutrophil apoptosis [339]. Pyocyanin has consistently been shown to produce superoxide and hydrogen peroxide [340,

341]; however, P. aeruginosa is protected from pyocyanin’s effects and escapes oxidative injury [342]. The increased production of reactive oxygen intermediates and oxidative stress caused by pyocyanin plays a role in neutrophil apoptosis because the antioxidant NAC can block pyocyanin-induced cell death [339].

In mice infected intra-tracheally with P. aeruginosa, pyocyanin was also found to increase neutrophil apoptosis and decrease neutrophil recruitment [343].

In these mice, pyocyanin appeared to suppress the increase of neutrophil chemokines MKC/CXCLI and MIP-2 typically seen upon infection [343].

Furthermore, pyocyanin plays a role in P. aeruginosa clearance, as mutant strains of the bacterium that lack pyocyanin production are cleared much faster than wild-type P. aeruginosa strains that produce pyocyanin [343]. As such, pyocyanin contributes to the longevity of P. aeruginosa infection. In fact, this same mutant strain of P. aeruginosa with reduced pyocyanin production had reduced mortality in a murine sepsis model [73].

Neutrophil apoptosis typically promotes the resolution of inflammation by impairing proinflammatory neutrophil processes and promoting production of anti- inflammatory cytokines while suppressing proinflammatory cytokines [339].

Premature neutrophil apoptosis induced by pyocyanin may contribute to pathogen evasion of host defense [344]. However, excessive neutrophil

apoptosis may overwhelm phagocytosing macrophages, increasing proinflammatory processes [345].

Pyocyanin also helps P. aeruginosa evade the immune system by inhibiting T cell lymphocyte proliferation as a result of decreased IL-2 [346]. While pyocyanin had little effect on IL-1 and tumor necrosis factor (TNF) production by monocytes, it enhanced the production of these monokines by lipopolysaccharide

(LPS) in peripheral blood mononuclear cells (PBMCs) [347].

These effects of pyocyanin to increase oxidative stress and inflammation, which are summarized in Table 1.1, have largely been studied in the respiratory system due to the frequency of P. aeruginosa infections in patients with cystic fibrosis and lung injury [319]. While these studies have largely looked at in vitro effects, a small number of in vivo studies have revealed deleterious effects of pyocyanin on the respiratory tract, including increased neutrophil migration in sheep [348] and mice [349]. A small number of studies have investigated pyocyanin’s effects on the urological, central nervous, vascular, and hepatic system [331]. However, no studies have explored pyocyanin’s effects on adipose tissue.

Oxidative stress in 3T3-L1 adipocytes has been shown to dysregulate adipokines, including adiponectin, plasminogen activator inhibitor-1 (PAI-1), IL-6, and monocyte chemotactic protein-1 (MCP-1) [350]. Obese mice with oxidative stress had reduced PPAR and adiponectin mRNA and increased TNF- expression in white adipose tissue [350]. As such, there appears to be a relationship between body weight and adipose inflammation that is linked to

oxidative stress. These findings indicate that oxidative stress in adipose tissue may be a therapeutic target for diseases of metabolic dysregulation. Moreover, oxidative stress has been identified as a mechanism in cancer cachexia [351].

Lastly, superoxide and hydrogen peroxide contribute to mitochondrial dysfunction, leading to sepsis pathogenesis and mortality [352].

As a producer of oxidative stress and inflammation, pyocyanin should be studied in the context of adipocyte in regulation of body weight. Furthermore, pyocyanin has been shown to activate AhR [270], a receptor that has demonstrated roles in the regulation of adipocyte differentiation and immune function. Moreover, due to the frequency of P. aeruginosa infections in sepsis, the physiological role of pyocyanin in sepsis pathogenesis warrants exploration.

Specifically, adipose cachexia in sepsis represents a gap in the literature.

Identifying compounds, such as pyocyanin, that are present in sepsis infections and can regulate oxidative stress, inflammation, and receptor signaling pathways involved in adipocyte differentiation and immune function could lead to a better understanding of the mechanisms of adipose cachexia and, ultimately, novel therapeutic treatment strategies for septic patients.

Table 1.1 Reported in vitro and in vivo effects of pyocyanin. Effect of Pyocyanin System Model Activates AhR and CYP1a1 in vitro THP-1 cells [270], A549 cells [270] Inhibits SOD, CAT, and GSH-Px in vivo, Rats [332], yeast cells [353], activity in vitro A549 cells [353], A549 cells [326], H292 cells [333] Depletes GSH in vitro HUVECs [327], HBE [311] Increases ROS hydrogen peroxide in vitro HUVECs [327], HBE [311], and superoxide A549 [326], H292 cells [333]

Increases neutrophil migration in vivo Sheep [348], mice [349] Increases neutrophil apoptosis in vitro, Human neutrophils [339], in vivo mice [343] Inhibits T cell production in vitro MNCs [346, 347] Low concentrations increase, high in vitro MNCs [347] concentration decrease: T and B cell proliferation, immunoglobulin production by B cells, B cell differentiation Inhibits NLRP3 inflammasome and in vitro BMDMs [334] IL-1 Increases IL-8, decreases in vitro Lung cells [336] RANTES Increases IL-6 in vitro RT4 urothelial cells [338] Inhibits IL-2 in vitro MNCs [346, 347] Increases IL-1, TNF-a in vitro MNCs [347], H292 cells [333] Increases inflammatory cytokines: in vitro H292 cells [333] IL-1a, IL-1B, IL-6, IL-8, TNF- Increases inflammatory mediators: in vitro H292 cells [333] G-CSF, GM-CSF, CXCLI, CXCL2, CXCL3, CCL20, CXCR4, IL-23, SAA1, SAA2 Increases mucin synthesis in vitro H292 cells [333] (MUC5AC and MUC2) Reduces intracellular cAMP and in vitro A549 cells [326], lung cells ATP [354]

Abbreviations: AhR, aryl hydrocarbon receptor; SOD, superoxide dismutase; CAT, catalase; GSH-Px, glutathione peroxide; GSH, glutathione; ROS, reactive oxygen species; HUVECs, human umbilical vein endothelial cells; MNC, mononuclear cells; HBE, human bronchial epithelial; BMDM, bone marrow derived macrophages.

Figure 1.1. Pathogenesis of adipose cachexia in sepsis

Sepsis

Systemic inflammation Metabolic alterations

Cachexia

White adipose tissue Apoptosis ¯ Lipogenesis

Lipolysis ¯ Adipocyte size

Inflammasome Cytokines

Figure 1.1. Pathogenesis of adipose cachexia in sepsis. In sepsis, infection results in systemic inflammation and metabolic alterations that contribute to cachexia. Mechanisms of adipose cachexia in white adipose tissue include increases in apoptosis, lipolysis, inflammasome activation, and inflammatory cytokines, coupled with decreased adipocyte size and lipogenesis.

Figure 1.2. Ligand binding of AhR

Figure 1.2. Ligand binding of AhR. AhR is a cytoplasmic ligand-activated transcription factor that, when unstimulated, is bound in a complex with heat shock protein 90 (Hsp90), X-associated protein 2 (XAP2), and p23. Upon ligand binding, AhR translocates into the nucleus and forms a heterodimer with the AhR nuclear transporter (ARNT). The AhR-ARNT heterodimer can then bind to AhR response elements upstream of target genes such as cytochrome

P450 (CYP) gene CYP1a1. The receptor then undergoes ubiquitin-mediated receptor protein degradation by the 26S proteasome. Adapted from Denison and Nagy, 2003 [213].

Figure 1.3. Representative AhR ligands

TCDD PCB-77 Pyocyanin

FICZ EGCG Quercetin

Figure 1.3. Representative AhR ligands. Depiction of selected ligands of the aryl hydrocarbon receptor (AhR), including the persistent organic pollutants

TCDD and PCB-77, the bacterial phenazine pyocyanin, and the natural compounds FICZ, EGCG, and quercetin.

Figure 1.4. Biosynthesis of pyocyanin

pKa = 4.9

Phenazine-1-carboxylic acid 5 methyl phenazine-1-carboxylic acid betaine Pyocyanin (Red) Pyocyanin (Blue)

Figure 1.4. Biosynthesis of pyocyanin. Phenazine-1-carboxylic acid (PCA) is a common precursor for many phenazines. PCA is converted to the dark red 5 methyl phenazine-1-carboxylic acid betaine by the PhzM enzyme, which then undergoes hydroxylative decarboxylation by PhzS to become pyocyanin. At physiological pH, pyocyanin is a neutral, blue molecule. In acidic environments, the central nitrogen is protonated, causing pyocyanin to gain charge and become red in color.

Figure 1.5. Generation of reactive oxygen species by pyocyanin

Figure 1.5. Generation of reactive oxygen species by pyocyanin. As a redox- active compound, pyocyanin is able to induce oxygen stress through the creation of reactive oxygen species (ROS). Adapted from Muller, 2002 [327].

Abbreviations: SOD, superoxide dismutase; H2O2, hydrogen peroxide; GSH, glutathione; GSSG, glutathione disulfide; NADP+, NADPH, nicotinamide adenine dinucleotide phosphate.

1.5 Statement of the problem and scope of the dissertation

1.5.1 Statement of the problem

Sepsis is a growing clinical problem associated with significant morbidity and mortality, with no effective therapeutics. Patients surviving sepsis suffer from cachexia, which does not respond to nutritional therapies aimed at simply replacing nutrients. Cachexia associated with sepsis arises from losses of both lean and fat mass, but there is little known about mechanisms contributing to septic-cachexia. Our laboratory, as well as others, have demonstrated that activation of AhR, either by endogenous or exogenous ligands, regulates the differentiation of adipocytes and inflammatory adipokine production. Recent studies demonstrated that pyocyanin, a virulence factor produced by the gram- negative sepsis-inducing bacteria, P. aeruginosa, is an AhR ligand. These results raise the possibility that P. aeruginosa-derived pyocyanin activates adipocyte

AhR to regulate adipocyte differentiation and function, an intriguing hypothesis that could mechanistically contribute to septic-cachexia. The purpose of this dissertation research was to define effects of pyocyanin on adipocytes, whether these effects were AhR-mediated, and to determine if pyocyanin regulates body weight in mice as an experimental model of septic cachexia.

1.5.2 Aims of dissertation

The overall objective of this project was to elucidate the effects of pyocyanin, a virulence factor produced by the sepsis-inducing bacteria P. aeruginosa, on adipocyte differentiation, function (ex vivo lipolysis), and expression of inflammation-regulating cytokines. Moreover, we defined effects of

pyocyanin on body weight regulation and developed an experimental mouse model of pyocyanin-induced cachexia.

The central hypothesis of this dissertation is that pyocyanin, released by

P. aeruginosa during sepsis, acts at adipocyte AhR to reduce adipocyte differentiation and promote adipocyte inflammation, thereby contributing to the development of septic cachexia (Figure 1.4). We tested our central hypothesis using the following specific aims:

Specific Aim 1. Define the role of pyocyanin in adipocyte differentiation and inflammation in vitro using 3T3-L1 cells and use this information to establish an in vivo mouse model of pyocyanin-induced cachexia.

Specific Aim 2. Define the role of adipocyte AhR on pyocyanin-induced regulation of adipocyte differentiation and on pyocyanin-induced cachexia in mice.

Figure 1.6. Graphical abstract of central hypothesis

Figure 1.6. Graphical abstract of central hypothesis .

Chapter 2 Pseudomonas aeruginosa-derived pyocyanin is a novel mediator of the wasting and inflammation of adipose in septic cachexia

2.1 Synopsis

Pseudomonas aeruginosa, a leading cause of sepsis, produces pyocyanin, a blue-pigmented virulence factor. Recent studies demonstrated affinity of pyocyanin for the aryl hydrocarbon receptor (AhR). Adipocytes express AhR, where activation has been shown to reduce adipocyte differentiation, while adipocyte deficiency of AhR increased body weight. Effects of pyocyanin at adipocyte AhR are unknown, but may contribute to septic cachexia, a problem with no effective therapeutics. This study examined in vitro and in vivo effects of pyocyanin on adipocyte differentiation and body weight regulation. In 3T3-L1 preadipocytes, pyocyanin reduced adipocyte differentiation and activated AhR and its downstream marker CYP1a1. Similarly, pyocyanin reduced adipocyte differentiation from stem cells isolated from naïve C57BL/6J mice. Intraperitoneal injection of pyocyanin to male C57BL/6J mice acutely (over 24 hours) reduced body temperature with altered locomotion but caused sustained (7 days) weight loss associated with reduced stem cell differentiation to adipocytes. Following three weekly injections of pyocyanin to male and female C57BL/6J mice, body weight and fat mass were reduced for 4 weeks, and AhR was activated in adipose tissue, but not liver. Pyocyanin-treated male mice had decreased energy expenditure, reduced physical activity, and increased adipose explant lipolysis. In females, pyocyanin caused more robust reductions in body weight, adipose- specific AhR activation, and increased expression of inflammatory cytokines in

adipocytes differentiated in vitro from pyocyanin-treated mice. These results demonstrate that pyocyanin reduces adipocyte differentiation and decreases body weight and fat mass in male and female mice through divergent mechanisms. Moreover, pyocyanin may play a role in septic cachexia.

2.2 Introduction

Sepsis is a life-threatening condition characterized by dysregulated host response to infection and multiple organ dysfunction [1]. Sepsis pathogenesis includes metabolic alterations such as hypercatabolism, muscle wasting, and lipoatrophy [94], leading to cachexia characterized by decreased body weight, lean body mass, and fat mass as well as metabolic disruption and systemic inflammation [95, 355, 356]. Sepsis remains a leading cause of death in critically ill patients, with global estimates of 31.5 million cases resulting in 5.3 million deaths annually [14]. While advances in critical care have increased survival from acute sepsis, a growing number of patients progress to chronic critical illness that includes septic cachexia, a condition for which nutritional therapies have limited efficacy. Furthermore, there is currently no FDA-approved medication that specifically targets sepsis [94]. Anti-inflammatory strategies are used to manage acute sepsis; however, no therapeutic approaches improve septic cachexia, and wasting of adipose tissue in sepsis has been largely unexplored [107, 108, 195].

Although adipose cachexia in sepsis is an understudied area, white adipose tissue (WAT) is known to be an important regulator of cachexia associated with cancer, with increases in WAT apoptosis, lipolysis, NLRP3 inflammasome

activation, inflammatory cytokine expression, and decreases in adipogenesis and adipocyte size [136, 142, 143]. Similarly, a recent study found that septic mice lost more weight than controls and failed to replete their fat mass even when body weight returned to baseline [195]. This state of septic adipose cachexia was associated with increases in inflammation, apoptosis, and lipolysis, and decreases in lipogenesis of WAT [195]. These results suggest that adipose tissue is a site where cachexia from sepsis is manifest, but mechanisms for adipose tissue wasting during acute or chronic sepsis are not well defined.

Pseudomonas aeruginosa (P. aeruginosa), a Gram-negative bacterium, is a leading cause of sepsis that commonly colonizes the lung and gut with a high propensity for antibiotic resistance. P. aeruginosa produces pyocyanin, a blue- pigmented toxin that is a major virulence factor for this organism. The toxic and inflammatory properties of pyocyanin are due, in part, to its ability to increase production of reactive oxygen species, induce neutrophil apoptosis, and facilitate the formation of biofilms [315, 331, 357]. Pyocyanin possesses both antibiotic and antifungal properties, which allow it to kill off competitors of P. aeruginosa.

The majority of studies on pyocyanin have focused on its ability to facilitate the virulence of P. aeruginosa.

Recent studies demonstrated that pyocyanin binds the aryl hydrocarbon receptor (AhR) and results in AhR activation in macrophages and pneumocytes

[270]. Pyocyanin has structural similarity to 2,3,7,8-tetrachlorodibenzodioxin

(TCDD), a prototypical ligand of AhR, and similar to TCDD, easily crosses the cell membrane as a low molecular weight zwitterion [1]. AhR-deficient mice are

more susceptible to P. aeruginosa lung infection than wild type mice, indicating a role of AhR in resistance against P. aeruginosa that is potentially related to clearance of pyocyanin [270]. In its classical role in drug and xenobiotic metabolism, AhR binds to xenobiotic response elements in the promoter regions of genes such as cytochrome P450 CYP1a1, CYP1a2, and CYP1b1 [214]. AhR exhibits promiscuous ligand binding to many drug and xenobiotic ligands, including persistent organic pollutants (POPs), such as TCDD and coplanar polychlorinated biphenyls (PCBs) [213]. AhR has been implicated in the differentiation and functional regulation of several different cell types, including adipocytes. The functions of adipocyte AhR are of particular interest due to the lipophilicity of AhR ligands, including POPs, which results in their accumulation in adipose tissue in close proximity to adipocyte AhR [272].

Pyocyanin has been detected in sputum, wounds, and urine in concentrations up to 130µM [319, 320]. While there are several studies demonstrating pyocyanin promotes the virulence of P. aeruginosa, levels of pyocyanin released by the bacteria may also regulate the function of mammalian cells, including activation of AhR in adipocytes, a cell type potentially related to cachexia of chronic sepsis. In this study, we defined effects of the novel AhR ligand pyocyanin on in vitro adipocyte differentiation and inflammation. We then used this information to establish an in vivo model of pyocyanin-induced cachexia in male and female C57BL/6J mice to elucidate possible mechanisms of pyocyanin’s effects on the development of septic cachexia.

2.3 Materials and Methods

2.3.1 Growth and differentiation of 3T3-L1 cells

3T3-L1 mouse adipocytes were purchased from ATCC (catalogue number

CL-173, ATCC, Manassas, VA). Cells were plated into 6-well plates at a seeding density of 10,000 cells/cm2 and grown in pre-adipocyte expansion medium containing 90% Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen,

Carlsbad, CA), 10% Newborn Calf Serum (NCS, Gemini Bio-Products, Carlsbad,

CA), and 1% penicillin/streptomycin. Cells (passage number 6 or lower) were grown to 100% confluence at 37°C in a humidified 5% CO2 atmosphere and culture media was changed every 48 hours. Two days after cells reached 100% confluence, differentiation was initiated (day 0) with media containing 90%

DMEM, 10% fetal bovine serum (FBS; Gemini Bio-Products, Woodland, CA), 1% penicillin/streptomycin, 0.2 µM insulin, 0.5 mM IBMX and 1.0 µM dexamethasone. Forty-eight hours later (day 2), media was changed to adipocyte maintenance media containing 90% DMEM, 10% FBS, 1% penicillin/streptomycin, and 0.2 µM insulin. Following day 2, media was changed every 48 hours (day 4 and day 6) using maintenance media containing 90%

DMEM, 10% FBS, and 1% penicillin/streptomycin. On day 8, cells were considered fully differentiated adipocytes.

2.3.2 Pyocyanin treatment in 3T3-L1 cells

Pyocyanin was purchased from Sigma-Aldrich (catalogue number P0046,

Sigma-Aldrich, St. Louis, MO) and dissolved in DMSO. For treatment during

differentiation, 3T3-L1 cells were grown to confluence in preadipocyte expansion medium in 6-well plates. Two days after reaching confluence, cells were treated with 0 (DMSO, 0.02%), 10, 50, or 100 µM pyocyanin, with fresh media containing vehicle or pyocyanin added on days 0, 2, 4, and 6. On day 8, cells were harvested for RNA extraction and gene expression analysis, or Oil Red O (ORO) staining as a marker of adipocyte differentiation. For post-differentiation treatment of mature adipocytes, fully differentiated 3T3-L1 adipocytes (day 8 cells) were treated with 0, 10, 50, or 100 µM pyocyanin for 24 hours and then harvested for RNA extraction or ORO staining. Cells were scraped using 175 µL of RNA lysis buffer (Maxwell, catalogue # MC501C, Promega, Madison, WI), and stored at -80⁰C. Oil Red O staining was performed on separate plates on day 8 or 9 using the ORO Staining Kit from Lifeline Cell Technology (catalogue number

LL-0052, Frederick, MD). Stained cells were imaged at 10x. After imaging, water was removed from the stained cells, 500 µL of isopropanol was added to each well for 1 minute to extract ORO from the cells, and 200 µL was removed from each well and absorbance measured in a 96-well plate at 510nm in a spectrophotometer.

2.3.3 Animal treatments and sample collection

All experiments met the approval of the Animal Care and Use Committee of the University of Kentucky. Mice were housed in micro-isolator, polystyrene cages with a 14 hr light/10 hr dark cycle. Room temperature was at a range of

20-21ºC, and humidity ranged from 30-70%. Male and female mice C57BL/6J mice were purchased from The Jackson Laboratories (Bar Harbor, MA) and aged

6 months to have sufficient fat mass to assess adipose cachexia. All mice were fed standard murine diet (Harlan Teklad 2918 Global Rodent Diet, irradiated;

Harlan Laboratories, Indianapolis, IN) ad libitum for the duration of the study design. Body weights were quantified daily. At study end point, mice were anesthetized [ketamine/xylazine, 10/100 mg/kg, by intraperitoneal (ip) injection] for exsanguination and tissue harvest (liver, subcutaneous adipose (SubQ), retroperitoneal adipose (RPF), epididymal adipose (EF)/periovarian fat (POF), interscapular brown adipose tissue (BAT), heart, lung, and soleus)).

2.3.4 Isolation of the stromal vascular fraction (SVF) from adipose

SubQ and EF tissue was aseptically excised from C57BL/6J mice, minced, and incubated in basal medium (Zenbio, Research Triangle Park, NC) supplemented with collagenase (1 mg/mL) and penicillin (100

U/mL)/streptomyocin (100 µg/mL) for 1 hour with shaking at 37°C, as previously described in 12-well plates at a seeding density of 50,000 cells/cm2 [358]. Two days after SVF cells had reached 100% confluence (day 0), the medium was changed to differentiation media and then replaced every other day with fresh media for 8 days. Cells were harvested at day 8 after differentiation for ORO staining and RNA isolation using Maxwell RSC simplyRNA Cell Kit; cDNA synthesis and real-time PCR were performed as described below.

2.3.5 Pyocyanin treatment in stromal vascular cells (SVF)

SVF cells were harvested from naïve 10-month old male C57BL/6J mice and plated onto 12-well plates at a seeding density of 50,000 cells/cm2. Cells were treated with vehicle (DMSO, 0.02%) or pyocyanin (100 µM) beginning on

day 0 and every 48 hours thereafter until cells were collected for ORO staining and RNA extraction on day 8.

2.3.6 Dose escalation pyocyanin pilot study in C57BL/6J mice

Male C57BL/6J mice, aged to 6 months as adults with significant adipose tissue mass, were administered vehicle (phosphate buffered saline, PBS) or escalating doses (2, 6, 19, and 50 mg/kg) of pyocyanin by intraperitoneal (IP) injection separated by 3-4 days. Body weights were recorded daily, and body composition was quantified by EchoMRI as described below. Study endpoint occurred 3 weeks after the final injection of 50 mg/kg pyocyanin.

2.3.7 Dose response pyocyanin pilot study in C57BL/6J mice

Male C57BL/6J mice (6 months of age) received a total of three IP injections, at weeks 0, 3 or 13, of either PBS VEH control or pyocyanin at 30, 40, or 50 mg/kg. Body weights were recorded daily, and body composition was measured by EchoMRI as described below. Study endpoint occurred 24 hours after the final injection.

2.3.8 Repeated pyocyanin administration to male C57BL/6J mice with tissue

harvest 1 day following the last dose

Male C57BL/6J mice (6 months of age) were administered IP injections of

PBS VEH control or pyocyanin (40 mg/kg, ip) on day 0 and 7, with study endpoint

24 hours after the last dose. Body weights were quantified daily and EchoMRI was performed prior to each injection as described below. After each injection, body temperature was quantified using a subcutaneously implantable programmable temperature transponder (IPTT) and Bio Medic Data Systems

(BMDS) transponder (product numbers IPTT 300 and DAS-7007, Bio Medic Data

Systems Inc, Seaford, DE). At study endpoint, EF explants were prepared

(described below) and SVF cells were isolated from both EF and SubQ for adipocyte differentiation.

2.3.9 Repeated pyocyanin administration to male and female C57BL/6J mice

with tissue harvest 2 weeks following the last dose

Male and female C57BL/6J mice (6 months of age) were administered IP injections of PBS VEH control or pyocyanin (40 mg/kg, ip) on days 0, 7 and 14, with study endpoint two weeks after the final dose. Body weights were taken daily and EchoMRI was performed each week prior to the next injection. Male mice received their first two injections while in indirect calorimetry chambers

(LabMaster TSE Systems Inc., Chesterfield, MO). After one week of acclimation to the chamber system, baseline measurements were recorded for one week.

Mice received two injections of PBS or pyocyanin, separated by one week, while recordings continued for 7 days beyond the last injection. Data from three 24- hour periods after each injection were adjusted for lean mass and averaged. For both sexes, study endpoint occurred two weeks following the third injection, at which point EF explants were used to quantify lipolysis (described below) and

SVF cells were isolated from SubQ for adipocyte differentiation.

2.3.10 Measurement of body composition

Body composition (fat and lean mass) of conscious mice was determined by nuclear magnetic resonance spectroscopy [EchoMRI (magnetic resonance imaging)] as described previously [247].

2.3.11 Extraction of RNA and quantification of mRNA abundance by real-time

PCR (RT-PCR)

Total RNA was extracted from tissues and cells using the Maxwell RSC simplyRNA Cell or Tissue Kit (Promega Corporation, Madison, WI) according to the manufacturer’s instructions. RNA concentrations were determined using a

NanoDrop 2000 spectophotometer (ThermoScientific, Wilmington, DE). cDNA was synthesized from 0.4 µg total RNA with qScript cDNA SuperMix (Quanta

Biosciences, Gaithersburg, MD) in the following reaction: 25°C for 5 minutes,

42°C for 30 minutes, and 85°C for 5 minutes. The cDNA was diluted to 0.4 ng/µL and amplified with an iCycler (Bio-Rad, Hercules, CA) and the Perfecta SYBR

Green Fastmix for iQ (Quanta Biosciences, Gaithersburg, MD). Using the difference from GAPDH cDNA (reference gene) and the Ct method, the relative quantification of mRNA abundance in each sample was calculated. The

PCR reaction was as follows: 94°C for 5 minutes, 40 cycles at 94°C for 15 seconds, 60°C or 64°C (based on tested primer efficiency) for 40 seconds, 72°C for 10 minutes, and 100 cycles from 95°C to 45.5°C for 10 seconds. Primer sequences were as follows: AhR, forward 5’-

GACCAAACACAAGCTAGACTTCACACC, reverse 5’-

CAAGAAGCCGGAAAACTGTCATGC; AhR, forward 5’-

AGTAAAGCCCATCCCCGCTGAAGG-3’, reverse 5’-

CATCAAAGAAGCTCTTGGCCC-3’; CYP1A1 (cytochrome P450 1A1), forward

5’-AGTCAATCTGAGCAATGAGTTTGG-3’, reverse 5’-

GGCATCCAGGGAAGAGTTAGG-3’; GAPDH, forward 5’-

GCCAAAAGGGTCATCATCTC-3’, reverse 5’-GGCCATCCACAGTCTTCT-3’;

TNF-α, forward 5’-CCCACTCTGACCCCTTTACTC-3’, reverse 5’-

TCACTGTCCCAGCATCTTGT-3’; aP2, forward 5’-

GGAACCTGGAAGCTTGTCTC-3’, reverse 5’- TGATGCTCTTCACCTTCCTG-3’;

PPARγ, forward 5’- GATGGAAGACCACTCGCATT-3’, reverse 5’-

AACCATTGGGTCAGCTCTTG-3’; β-catenin, forward 5’-

ATGGACTGCCTGTTGTGGTT-3’, reverse 5’- AAAGGCGCATGATTTGCTGG-3’;

RANTES, forward 5’- CCCTCACCATCATCCTCACT-3’, reverse 5’-

CCTTCGAGTGACAAACACGA-3’; F4/80, forward 5’-

CTTTGGCTATGGGCTTCCAGTC-3’, reverse 5’-

GCAAGGAGGACAGAGTTTATCGTG-3’.

2.3.12 Quantification of lipolysis in adipose tissue explants

Epididymal adipose tissue was cut into 25-50 mg explants. A single EF explant was placed into one 24-well plate containing Krebs buffer (1 mL).

Explants were washed with fresh buffer, which was removed and replaced with

Krebs buffer (0.5 mL) containing 2% fatty acid free bovine serum albumin, and the plates were incubated at 37°C. A 30 uL sample of buffer was removed from

each well at 60, 120, 180, and 240 minutes after the start of the incubation. The glycerol concentration of the samples was quantified using the Glycerol

Colorimetric Assay Kit (Item # 10010755, Caymen Chemicals, Ann Arbor, MI) per the manufacturer’s instructions. The remaining EF explants were washed three times with Krebs buffer (1 mL/each) and frozen for protein determination. For protein determination, tissue samples were suspended on ice in PBS (0.5 mL) containing EDTA (2 mM) and protease cocktail inhibitor (cOmplete Mini, Roche

Diagnostics, Indianapolis, IN). Tissue was homogenized using a Geno/Grinder

(Spex SamplePrep, Metuchen, NJ) set to 1,350 rpm x 1.5 minutes. After homogenization, samples were centrifuged at 14,000 rpm x 10 minutes at 4°C and the supernatants transferred to clean tubes. Protein concentrations of the supernatants were determined using the Pierce BCA protein assay kit (Dallas,

TX). Lipolysis is reported as amount of glycerol produced/mg protein/hour.

2.3.13 Quantification of plasma concentrations of inflammatory cytokines

Mouse plasma (25 µL) was collected in EDTA and diluted 1:2 in Assay

Buffer (Milliplex, Item #L-AB, Millipore Sigma, Burlington, MA) to quantify plasma inflammatory cytokine concentrations using the Mouse Cytokine/Chemokine

Magnetic Bead Panel as per the manufacturer’s instructions (Item

#MCYTOMAG-70K-PMX, Millipore Sigma, Burlington, MA). The 96-well magnetic bead assay was read using a Luminex 200 (R&D Systems, Minneapolis, MN).

2.3.14 Quantification of pyocyanin concentrations in biological samples

Sample preparation: Plasma (50 µL) or adipose homogenate (200 mg/ml) was added to a 1.5 mL microcentrifuge tube. Internal standard solution (10 µL; caffeine-d3, 100 ng/mL in ethanol) and ethanol (10 µL) were added (for calibration samples, 10 uL of ethanol containing pyocyanin in a concentration range of 2.5-625 ng/ml) to each tube. After briefly vortex-mixing, methanol (50 uL) and 10% perchloric acid solution (150 uL) were added and the contents mixed for 5 min. Tubes were centrifuged for 5 minutes at 11, 000 x g. The supernatant was recovered and transferred to an autosampler vial.

LC-MS/MS analysis: Analysis was performed on an AB Sciex 4000 Q Trap coupled with an Exion LC system. The Analyst software package was used for data collection and analysis. Chromatography was carried out with a C8 reverse- phase column (Waters ACQUITY UPLC BEH C8, 2.1 X 50 mm, 1.7 μm) maintained at 40℃ and the flow rate was set to 0.3 mL/min. Solvent A is 100% water with 0.1 % formic acid and ammonium carbonate (5 mM) and solvent B is

90% methanol with 0.1 % formic acid and ammonium carbonate. A gradient program was used as follow (T min/%A): 0/95, 1.0/95, 2.5/75, 5.0/75, 5.1/0,

6.6/0, 6.7/95, 9.0 /95. The injection volume was 5.0 μL. Mass spectrometer was equipped with an electrospray ionization (ESI) source and operated in positive mode under the following operating parameters: IonSpray Voltage 5.5 kV,

Desolvation temperature 500℃, Ion Source Gas 1 40 psi, Ion Source Gas 2 40 psi, Curtain Gas 30 psi, Collision Gas Medium, Declustering Potential 80 V,

Entrance Potential 10.0 V, and Collision Energy 27.0 V for caffeine and 45.0 V

for pyocyanin. Quantitative analysis was conducted by monitoring the precursor ion to production ion transitions of m/z 211.2/168.2 for pyocyanin and m/z

198.2/138.0 for caffeine-d3 with a dwell time of 0.15 s.

2.3.15 Metabolite identification of pyocyanin in mouse urine

Urine samples were extracted using methanol, and the supernatant was dried under nitrogen. After reconstituting in 90% acetonitrile, sample (2 μL) was injected for LC-MS analysis. A Q-Exactive mass spectrometer equipped with an

Ultimate 3000 ultra high performance liquid chromatography system (Thermo

Fisher Scientific, San Jose, CA) was used for sample detection.

Chromatographic separation was performed on a reversed phase Kinetex C18 column (2.6 mm × 100 mm, 2.1 μm, Phenomenex, USA). Mobile phases were composed of acetonitrile (A) and water (B), both containing 0.1% formic acid.

The column temperature was maintained at 40°C, and the flow rate was set to

0.25 ml/min. Mass spectrometric detection was performed by electrospray ionization in positive ionization mode with source voltage maintained at 4.3 kV.

The capillary temperature, sheath gas flow and auxiliary gas flow were set at

330°C, 35 arb and 12 arb, respectively. Full-scan MS spectra (mass range m/z

75 to 1000) were acquired with resolution R = 70,000 and AGC target 1e6.

MS/MS fragmentation was performed using high-energy C-trap dissociation with resolution R = 35,000 and AGC target 2e5. The stepped normalized collisional energy scheme was set at 30, 40, and 50. Raw data files acquired in full scan- ddMS2 mode were imported into Compound Discoverer™ software (v. 2.1;

Thermo Fisher Scientific) to identify pyocyanin metabolites. The software detects chromatographic peaks, and the mass of the corresponding compound is compared with a list of generated theoretical metabolites. Potential metabolites were proposed based on exact mass, MS2 fragmentation, isotopic pattern and retention time with respect to the parent compound.

2.3.16 Statistical analysis

Data are represented as mean + SEM. Data were tested for normality using the Shapiro-Wilk test, and equal variance was tested using the Brown-Forsythe test. Outlier detection was performed using Grubbs’ or extreme studentized deviate method where alpha = 0.05. If data did not pass normality using these approaches, data were logarithmically transformed. One-way analysis of variance (ANOVA; SigmaPlot, version 13.0; Systat Software Inc., Chicago, IL) was used to define effects of pyocyanin treatment in vitro. Dunnett’s method was used for post-hoc analyses. T-tests were used to analyze in vivo comparisons between pyocyanin (PYO) and vehicle (VEH) treated animals. Body weights and body composition were analyzed by repeated measure. Body temperature analyses were performed in SAS 9.4 (SAS Institute Inc.; Cary, NC, USA). For each mouse, temperature was plotted against log-transformed time and the area under the curve (AUC) was calculated for each of the two injections. A full factorial two-way repeated measures ANOVA was performed on the AUC values, analyzing differences between across treatment and injection number. A

Kenward and Roger adjustment was used to correct for small-sample bias. Post-

hoc two-sample t-tests were performed at each timepoint, separated by injection number. Statistical significance was defined as p < 0.05.

2.4 Results

2.4.1 Pyocyanin reduces differentiation of 3T3-L1 cells to adipocytes

Previous studies demonstrated that activation of AhR reduced differentiation of 3T3-L1 cells to adipocytes [219, 225, 226]. Pyocyanin has been demonstrated to bind to AhR [270]. Thus, we first defined concentration- dependent effects of pyocyanin (0 – 100 µM) on differentiation of 3T3-L1 cells to adipocytes. Pyocyanin (100 M) reduced significantly ORO absorbance and staining as a marker of adipocyte differentiation compared to vehicle controls

(Figure 2.1A,B; P<0.05). Similarly, mRNA abundance of Ap2 and PPARγ, genes associated with a mature adipocyte phenotype [359], were reduced significantly by pyocyanin (100 M; Figure 2.1C; P<0.05). As an index of AhR activation, pyocyanin resulted in robust increase in mRNA abundance of AhR and its downstream marker, CYP1a1 (Figure 2.1C, P<0.05). When incubated with differentiated adipocytes, pyocyanin (50, 100 µM) reduced significantly ORO absorbance and staining (Figure 2.1D,E; P<0.05). However, in mature adipocytes, while pyocyanin at high concentrations (100 µM) increased mRNA abundance of AhR, there was a non-monotonic, inverted-U shape dose response for effects of pyocyanin on mRNA abundance of CYP1a1 and TNF-α (Figure

2.1F). Pyocyanin, at any concentration examined, did not significantly influence cell viability as quantified by trypan blue staining (data not shown).

2.4.2 Pyocyanin reduces differentiation of mouse adipose stromal vascular cells

to adipocytes and promotes lipolysis of mouse white adipose explants

We isolated the stromal vascular fraction (SVF) from adipose tissue to obtain stem cells as an alternative in vitro model of adipocyte differentiation.

Similar to effects of pyocyanin to reduce differentiation of 3T3-L1 cells to adipocytes, pyocyanin (100 µM) reduced significantly ORO absorbance compared to vehicle controls after 8 days of the differentiation protocol (Figure

2.2A, P<0.05). Since pyocyanin reduced ORO absorbance when incubated with mature adipocytes (Figure 2.1D), we defined effects of pyocyanin on lipolysis using epididymal (EF) white adipose explants from naïve male C57BL/6J mice.

Following a 4 hour incubation, pyocyanin (100 M) increased significantly glycerol release from adipose tissue explants (Figure 2.2B, P<0.05).

2.4.3 Development of an in vivo model of pyocyanin-induced cachexia

We developed an in vivo model of pyocyanin-induced cachexia using adult male C57BL/6J mice (aged to 6 months to have sufficient fat mass to quantify adipose cachexia). Intraperitoneal (IP) injection of pyocyanin was chosen as a mode of delivery to replicate gut-derived sepsis. Initial dose escalation studies, initiated at 2 mg/kg of pyocyanin, had no effect on body weight, and thus doses were escalated to a maximum of 50 mg/kg of pyocyanin, which resulted in a reduction in body weight within 48 hours after administration (34.1 ± 0.9 g at baseline versus 31.9 ± 1.2g, P<0.05). We then performed dose response studies testing effects of repeated exposures (two injections separated by one week) to

30, 40, and 50 mg/kg pyocyanin. During the course of these studies, we found that there is an effect of repeated exposures to pyocyanin, with greater losses in body weight and fat mass following a second injection of pyocyanin (Figure

2.7A,B). Furthermore, upon second injection with pyocyanin, mice exhibited changes in behavior, including lethargy, trembling, and poor motor control, which persisted for several hours after injection but returned to normal function within

12 hours. We detected pyocyanin in plasma 24 hours following the second injection of each dose (Figure 2.7C).

2.4.4 Pyocyanin acutely reduces body temperature and chronically decreases

body weight, fat mass, and adipocyte differentiation in male C57BL/6J

mice

Based on results from pilot studies, we administered two injections (IP) of pyocyanin (40 mg/kg) separated by one week. Moreover, because of the behavioral effects of the virulence factor in pilot studies, we quantified body temperature during the first 24 hours after administration of each dose of pyocyanin, and then subsequently for 7 days at the same time each day. Both first and second injection of pyocyanin resulted in a rapid and robust decrease in body temperature (Figure 2.3B, P<0.05) that was accompanied by lethargy, trembling, and poor motor control. Calculation of the area under the curve for body temperature reductions during the 24 hours following pyocyanin exposure demonstrated significant reductions compared to vehicle controls (data not shown). Pyocyanin-induced acute reductions in body temperature were not

maintained beyond 24 hours (Figure 2.3B, P<0.05), and body temperature was not significantly influenced by pyocyanin on subsequent days (Figure 2.3A).

Normalization of body temperature coincided with a return to normal behavior and motor control. Acute body temperature-regulating effects of pyocyanin occurred prior to reductions in body weight (illustrated as % weight loss compared to baseline body weight) of pyocyanin-treated mice compared to vehicle controls (Figure 2.3C). However, while body temperature quickly returned to normal within 24 hours after injection (Figure 2.3A,B), weight loss following pyocyanin was sustained throughout the 7 day time course (Figure 2.3C).

Pyocyanin was detected in the plasma 24 hours following the second injection

(PYO: 4.5 + 1.0 ng/mL; VEH: none detected). We also quantified pyocyanin and associated metabolites in the urine of mice from this study. Pyocyanin was detected in urine (45 and 60 minutes post-injection) as the parent compound and five major metabolites (N-demethylation + glucorindation and oxidation + glucoronidation conjugates; (Figure 2.9). Peak areas for each conjugate decreased from 45 to 60 minutes, indicating pyocyanin is rapidly metabolized.

Additionally, while pyocyanin levels were non-detectable in adipose tissue from vehicle-treated animals, pyocyanin (4 ng/g) was detected in EF and RPF at 24 hours after the last dose (Figure 2.3D, P<0.05).

EF explants removed from animals 24 hours after the last dose of pyocyanin did not exhibit differences in basal lipolysis (See supplemental material, Figure 2.8). Concentrations of the pro-inflammatory cytokine interleukin-

6 (IL-6) were increased in plasma of mice administered pyocyanin compared to

vehicle controls, while concentrations of the anti-inflammatory cytokine interleukin-13 (IL-13) were decreased compared to controls (Table 2.2; P<0.05).

There was a trend toward reduced plasma concentrations of interleukin-1 alpha

(IL-1) and increased concentrations of chemokine (C-X-C motif) ligand 1

(CXCL1) (Table 2.2). In adipose tissue, mRNA abundance of the T-cell marker,

RANTES, was increased significantly 24 hours after the last dose of pyocyanin

(See supplemental material, Figure S2; P<0.05). However, there was no effect of pyocyanin on mRNA abundance of CYP1a1, PPARγ, aP2, TNF-α, F4/80,

RANTES, or interleukin-10 (IL-10) in EF, RPF, or liver compared to vehicle controls (Figure 2.8).

We harvested SVF from subcutaneous and EF adipose tissue of mice administered vehicle or pyocyanin and differentiated stem cells in vitro to adipocytes. On day 8 of the differentiation protocol, ORO absorbance was decreased significantly in adipocytes differentiated from stem cells isolated from both adipose depots of pyocyanin-treated mice compared to vehicle controls

(Figure 2.3E, P<0.05).

2.4.5 Pyocyanin chronically decreases body weight and fat mass of male

C57BL/6J mice

In this study, we administered three injections (IP) of vehicle or pyocyanin

(40 mg/kg) one week apart and harvested tissues 14 days after the last dose.

Our goal was to determine if effects of pyocyanin to decrease body weight and fat mass of male mice were sustained two weeks after the last dose. Moreover, to resolve mechanisms for effects of pyocyanin, we quantified measures of

whole-body metabolism following the first two injections of pyocyanin. We quantified food intake, indirect calorimetry, and physical activity for 3 consecutive days at baseline (prior to exposure) and the 3 days following both the first and second injections of pyocyanin while mice were within the recording chambers.

There were no changes in any measured parameter of vehicle-treated mice at any time point (data not shown). Thus, data are illustrated for pyocyanin-treated mice only. The first injection of pyocyanin resulted in significant reductions in respiratory exchange ratio (RER, as quantified by VCO2/VO2, Figure 2.4A;

P<0.05), energy expenditure (kcal expended; Figure 2.4B; P<0.05), physical activity (counts/30 min; Figure 2.4C; P<0.05), and food intake (kcal consumed;

Figure 2.4D, P<0.05) on day 1 of recording. With the exception of physical activity and energy expenditure, reductions in these parameters (RER, EE, food intake) returned to baseline levels by the second day following the initial injection of pyocyanin. Following the second injection of pyocyanin, there were more pronounced and sustained reductions in RER, EE, activity, and food intake

(Figure 2.4A-D, P<0.05).

Male mice began losing weight following the second injection of pyocyanin and weighed significantly less than vehicle controls following the third injection of pyocyanin (Figure 2.5A, P<0.05). Similarly, lean mass (as a percentage of body weight) of pyocyanin-treated mice was increased significantly compared to vehicle controls, while fat mass was decreased significantly following the second injection of pyocyanin (Figure 2.5B,C; P<0.05).

At 14 days following the final dose, pyocyanin-treated mice had significant reductions in the mass (adjusted to body weight) of EF, retroperitoneal fat (RPF), and interscapular brown fat (isBAT) compared to vehicle controls (Table 2.1;

P<0.05). Liver mass was also reduced significantly in mice administered pyocyanin compared to vehicle controls (Table 2.1; P<0.05). Lipolysis of EF explants was increased significantly at 14 days after the last injection of pyocyanin compared to vehicle controls (Figure 2.5D, P<0.05). Concentrations of

IL-10 were reduced significantly in plasma from mice administered pyocyanin compared to vehicle controls (Table 2.2). Notably, pyocyanin resulted in a significant increase in mRNA abundance for CYP1a1 in EF and RPF, but not in liver (Figure 2.5E; P<0.05). Moreover, mRNA abundance of TNF-α was reduced significantly in RPF from mice administered pyocyanin compared to vehicle controls (Figure 2.5E; P<0.05). However, other markers of adipocyte differentiation (aP2, PPARγ), inflammation (TNF-α), macrophage infiltration

(F4/80), or T-cell infiltration (RANTES) were not altered in adipose tissue from pyocyanin-treated mice. Moreover, absorbance of ORO in adipocytes differentiated from stem cells isolated from subcutaneous adipose tissue of mice administered pyocyanin was not significantly different from control (Figure 2.5F), nor were there any differences in mRNA abundance of adipocyte markers in differentiated adipocytes (Figure 2.5G). Effects of pyocyanin to promote basal lipolysis of adipose explants and activate CYP1a1 expression in adipose tissue were observed despite an inability to detect pyocyanin in plasma or adipose at 14 days after the last injection.

2.4.6 Pyocyanin chronically decreases body weight and fat mass of female

C57BL/6J mice

Studies have demonstrated sex differences in sepsis incidence between males and females [27, 28]. Thus, we repeated chronic pyocyanin exposures using the same experimental design as the above described in males (with the exception of indirect calorimetry) in adult female C57BL/6 mice. In contrast to males, female mice began losing body weight after the first injection of pyocyanin compared to vehicle controls, and weight loss was maintained throughout the study protocol (Figure 2.6A, P<0.05). Body weight reductions were associated with increased lean mass and decreased fat mass compared to baseline levels within each treatment group, or compared to vehicle controls (Figure 2.6B,C,

P<0.05). In females, pyocyanin’s effect to reduce fat mass exhibited similar trends as seen in males, with modest reductions in weights of some fat pads compared to vehicle controls (Table 2.1). However, in contrast to males, liver mass of pyocyanin-treated female mice was increased significantly compared to vehicle controls (Table 2.1; P<0.05). Moreover, in females, there was no significant effect of pyocyanin on lipolysis of adipose tissue explants compared to vehicle controls (Figure 2.6D, P<0.05). Similar to males, pyocyanin resulted in a significant increase in mRNA abundance of CYP1a1 in adipose tissue but not in livers of female mice compared to vehicle controls, with no changes in mRNA abundance of aP2 or PPAR (Figure 2.6E, P<0.05). Pyocyanin resulted in a significant decrease in RANTES mRNA abundance in periovarian adipose tissue

compared to vehicle controls (Figure 2.6E, P<0.05). Moreover, pyocyanin resulted in a significant decrease in RANTES plasma concentrations of females compared to vehicle controls (Table 2.2, P<0.05).

Notably, while there were no significant differences in ORO absorbance when SVF cells isolated from pyocyanin-treated females were differentiated in vitro to adipocytes (Figure 2.6F), adipocytes differentiated from pyocyanin- treated females exhibited significant elevations in mRNA abundance of AhR and

TNF-α (Figure 2.6G, P<0.05). These effects were observed in cells isolated two weeks after the last injection, when pyocyanin levels in plasma and adipose were below the detectable limit.

2.5 Discussion

Results from these studies demonstrate that pyocyanin, a virulence factor released by the sepsis-causing bacteria P. aeruginosa, regulates adipocyte formation and function in vitro, and regulates body weight in vivo of male and female mice. Specifically, we found that (1) pyocyanin reduces differentiation of adipocytes, promotes expression of inflammatory cytokines in differentiated adipocytes, and augments basal lipolysis of adipose tissue explants, (2) pyocyanin results in reductions in body weight and fat mass when administered in vivo to both male and female mice, (3) there are sex differences in mechanisms related to effects of pyocyanin on adipose tissue. While there has been a growing interest in the role of the virulence-promoting effects of pyocyanin in sepsis following P. aeruginosa infection, the role of pyocyanin at

mammalian cells such as adipocytes in the wasting and cachexia associated with sepsis has been largely unexplored. Our results suggest that pyocyanin exerts long-lasting effects to regulate body weight, adipose mass, and adipocyte function. These findings may have relevance to the wasting associated with chronic sepsis.

Using 3T3-L1 cells, we found that pyocyanin stimulated expression of

CYP1a1 as an index of AhR activation at concentrations (100 µM) that resulted in a 50% reduction in adipocyte differentiation. Notably, this concentration of pyocyanin has been detected in human samples [319, 320]. Our laboratory has reported previously an ability of AhR ligands, including coplanar PCBs and dioxin

(TCDD), to reduce adipocyte differentiation [225]. In agreement with these findings, pyocyanin reduced several indices of adipocyte differentiation at concentrations that induced markers of AhR activation in 3T3-L1 adipocytes.

While pyocyanin elicited downstream markers of AhR activation in adipocytes, it is unclear if the effects of pyocyanin on adipocytes were AhR-mediated.

In mature adipocytes, pyocyanin also reduced ORO staining and promoted expression of TNF-α. Elevations in mRNA abundance for proinflammatory adipokines in response to pyocyanin is in agreement with previous findings of AhR activation in differentiated 3T3-L1 adipocytes [225].

However, in the current study, pyocyanin also reduced neutral lipid staining when incubated with differentiated adipocytes. A reduction in ORO staining of mature adipocytes exposed to pyocyanin may represent an increase in lipolysis, potentially related to induction of TNF-α [360, 361]. Indeed, using adipose tissue

explants from mice, we demonstrated that pyocyanin increased basal lipolysis. In a parallel adipocyte differentiation system using stem cells harvested from naïve mice, pyocyanin, at similar concentrations, decreased markers of adipocyte differentiation. It is interesting to note pyocyanin’s effect on CYP1a1 and TNF-α mRNA abundance in mature adipocytes appears to follow a non-monotonic, inverted-U shaped dose response, with the greatest inductions of gene expression occurring at intermediate concentrations of pyocyanin. We have previously reported that AhR ligands, namely environmental pollutants, exhibit non-monotonic and inverted U-shaped associations with disease outcomes

[362].Therefore, it appears pyocyanin might have contrasting effects on pre-

/differentiating adipocytes versus mature adipocytes, representing an important consideration when interpreting in vivo data and defining future therapeutic targets.

Based on these in vitro findings, we developed an in vivo model of pyocyanin-induced cachexia that did not include use of P. aeruginosa as a confounding factor, as our interest was the effects of pyocyanin on mammalian cells. Utilizing IP injection to replicate potential pyocyanin exposures from gut- derived sepsis, pyocyanin dose-dependently elicited sustained weight loss upon repeated exposures. Moreover, while an initial injection of pyocyanin had no effects in male mice, upon second injection, several effects were noted, including behavioral effects that were short-lived. Our findings are in agreement with previous studies indicating that intranasal exposure to pyocyanin resulted in reduced spontaneous locomotor activity and increased immobility time in forced

swim [321]. Hypothermia is a known symptom of sepsis [363]. Our results demonstrate that behavioral effects of pyocyanin, including lethargy, trembling, and poor motor control, were associated with a rapid decrease in body temperature that returned to baseline levels 17 hours after injection, when behavioral effects were no longer evident. These results suggest that these symptoms associated with sepsis from P. aeruginosa may result from release of pyocyanin from the bacteria. However, since weight loss from pyocyanin exposure was sustained and did not coincide with the timeframe for behavioral or temperature-regulating effects of the compound, these results suggest that other mechanisms contribute to pyocyanin’s effects on body weight.

To elucidate mechanisms contributing to body weight-regulating effects of pyocyanin, we studied its effects on adipocyte differentiation and adipose inflammation. Remarkably, when stem cells were harvested 24 hours after the last dose of pyocyanin and differentiated over an 8 day experimental protocol, markers of adipocyte differentiation were reduced, suggesting long-lasting effects of pyocyanin. It is noteworthy that mice injected with pyocyanin begin metabolizing and excreting the compound through their urine within 45 minutes of injection; however, pyocyanin was still detectable in the plasma at 24 hours, when stem cells were harvested for in vitro adipocyte differentiation. Plasma concentrations of the pro-inflammatory cytokine IL-6 were increased 24 hours after the last dose of pyocyanin, while concentrations of the anti-inflammatory cytokine IL-13 were decreased in pyocyanin-treated mice. Elevations in systemic

IL-6 concentrations have been demonstrated in patients with sepsis [6, 364, 365],

with high IL-6 levels associated with poor outcomes in sepsis [42, 366-369].

Previous studies have demonstrated pyocyanin’s ability to increase IL-6 in airway epithelial or urothelial cells [333, 338]. By increasing pro-inflammatory concentrations of IL-6, pyocyanin may augment the acute phase reaction to P. aeruginosa infection. It is possible that reductions in plasma concentrations of IL-

13, an anti-inflammatory cytokine produced by T helper 2 (Th2) cells that has been shown to inhibit secretion of IL-6, TNF- and other inflammatory cytokines, contribute to an overzealous inflammatory response to pyocyanin [370-373].

Conversely, IL-13 has been shown to play a protective role in cecal ligation and puncture (CLP) models of sepsis [374], and reductions in IL-13 were associated with increases in the neutrophil recruiter CXCL1 [374], which was also modestly elevated in the plasma of pyocyanin-treated mice. Therefore, by blocking the protective anti-inflammatory processes of IL-13, pyocyanin may contribute to the longevity of P. aeruginosa survival. These changes in plasma concentrations of factors involved in inflammation may contribute to pyocyanin’s ability to regulate body weight. However, since adipose tissue expression of several inflammatory modulators was not altered by pyocyanin, the source of these systemic factors is unclear.

Though advances in anti-inflammatory strategies have increased survival through the acute phase of sepsis, a growing number of patients are progressing to chronic critical illness [94]. Cachexia, with no known therapeutic strategies, is a complication of chronic survivors of sepsis [94]. We quantified measures of whole-body metabolism in male mice exposed to pyocyanin to define

mechanisms for the observed reductions in body weight and fat mass.

Interestingly, while both injections of pyocyanin lowered RER, EE, activity, and food intake of male mice, reductions were more robust and sustained upon repeated exposure. A shift towards a lower RER indicates that fat is being utilized as the predominant fuel source of pyocyanin-treated male mice. Similarly, fat is the preferred fuel of septic patients [199]. Increased fat utilization and oxidation is further supported by an observed increase in basal lipolysis of fat explants, which coupled with greater fat oxidation may contribute to a loss of fat mass in male pyocyanin-treated mice. Reductions in energy expenditure of male pyocyanin-treated mice may relate to the observed reductions in physical activity.

While food intake declined acutely in response to pyocyanin, these effects were not sustained and thus did not appear to contribute to sustained reductions in body weight.

Since sex differences in sepsis incidence and survival have been reported previously [15, 16], we contrasted effects of chronic pyocyanin exposures on body weight and fat mass in male and female mice. While both male and female mice exhibited sustained weight loss in response to pyocyanin, female mice lost weight after the first pyocyanin exposure and exhibited more robust responses to pyocyanin. An important finding of the present study was an ability of pyocyanin to activate expression of CYP1a1 as a marker of AhR activation in adipose tissue, but not in liver of both sexes. This result was surprising in light of a much larger expression level of AhR in liver compared to adipose tissue [375-377].

Moreover, induction of CYP1a1 in adipose tissue was maintained two weeks

after the last exposure to pyocyanin, supporting sequestration of lipophilic pyocyanin in adipose tissue. Indeed, pyocyanin was detected in adipose tissue

24 hours after the last dose in male mice. However, we were not able to detect pyocyanin in adipose tissue of male or female mice at 2 weeks after the last dose. In addition to differences in the timing and degree of weight loss between males and females, results from this study suggest sex differences in the mechanisms of action of pyocyanin on adipose tissue biology. For example, adipose explants from males, but not females, exhibited increased basal lipolysis, while adipocytes differentiated from stem cells of pyocyanin-treated females had increased expression of TNF-α and AhR. Notably, changes in expression of these markers of inflammation and AhR activation in differentiated adipocytes occurred three weeks following the last exposure of female mice to pyocyanin. Other differences between sexes included levels of pro- or anti- inflammatory cytokines and/or markers of immune cell activation in plasma of male versus female pyocyanin-treated mice. The sexually dimorphic effects of pyocyanin may be due, in part, to sex differences in AhR responsiveness [378-

380]. Regardless, our results suggest that in both sexes, changes in plasma concentrations of inflammatory mediators and/or immune cells that were sustained for several weeks after the last exposure to pyocyanin may contribute to poor outcomes associated with chronic sepsis from P. aeruginosa.

In conclusion, results from this study demonstrate that pyocyanin reduced the differentiation of adipocytes in vitro, and decreased body weight and fat mass when administered to male and female mice in vivo. Effects of pyocyanin to

decrease body weight and fat mass were sustained for several weeks after the last exposure and appeared to involve different mechanisms in male versus female mice. These results indicate a potential role of pyocyanin in adipose wasting and cachexia associated with sepsis from P. aeruginosa. Future studies should elucidate the role of AhR in pyocyanin’s sexual dimorphic effects on adipose cachexia in sepsis. Understanding pyocyanin’s mechanisms of action could lead to novel therapeutic targets for septic cachexia produced by P. aeruginosa.

Table 2.1 Plasma cytokine concentrations in male and female mice administered vehicle or pyocyanin Tissue weight (g)/Body weight (g) Tissue Acute Males Chronic Males Chronic Females Vehicle Pyocyanin Vehicle Pyocyanin Vehicle Pyocyanin

EF 0.043 ± 0.008 0.042 ± 0.01 0.028 ± 0.007 0.019 ± 0.007 * 0.025 ± 0.0112 0.017 ± 0.003

SubQ 0.019 ± 0.008 0.019 ± 0.006 0.009 ± 0.002 0.008 ± 0.003 0.011 ± 0.0033 0.011 ± 0.0022

RPF 0.015 ± 0.003 0.013 ± 0.002 0.010 ± 0.003 0.006 ± 0.003 * 0.005 ± 0.003 0.003 ± 0.0006

isBAT 0.006 ± 0.002 0.007 ± 0.002 0.006 ± 0.0008 0.005 ± 0.0003 * 0.005 ± 0.00097 0.004 ± 0.0007

Liver 0.046 ± 0.002 0.045 ± 0.006 0.056 ± 0.003 0.051 ± 0.003 * 0.041 ± 0.0061 0.048 ± 0.0028 *

Lung 0.006 ± 0.003 0.006 ± 0.002 0.006 ± 0.002 0.006 ± 0.0009 0.006 ± 0.0015 0.008 ± 0.0031

Heart 0.004 ± 0.001 0.004 ± 0.001 0.005 0.0003 0.005 0.0004 0.005 ± 0.0009 0.005 ± 0.0003

0.0006 ± 0.0006 ± 0.0001 -- -- 0.0006 ± 0.0001 0.0007 ± 0.0001* Soleus 0.0001 Values are mean + SEM from n=5-15/group. *, P<0.05 compared to vehicle.

Abbreviations: EF, epididymal fat; SubQ, subcutaneous fat; RPF, retroperitoneal fat; isBAT, interscapular brown fat.

Table 2.2 Plasma cytokine concentrations in male and female mice administered vehicle or pyocyanin Plasma Cytokine Concentration (pg/mL) Acute Males Chronic Males Chronic Females Vehicle Pyocyanin Vehicle Pyocyanin Vehicle Pyocyanin

IL-1α 67.20 ± 35.05 31.21 ± 12.91 31.22 ± 32.82 21.91 ± 9.41 35.31 ± 22.75 19.87 ± 15.29

IL-6 8.14 ± 5.52 33.03 ± 18.69* 0.65 ± 0.48 0.93 ± 1.13 0.78 ± 0.86 1.65 ± 1.97

IL-13 27.34 ± 8.15 9.54 ± 8.61* 18.36 ± 12.74 13.94 ± 9.72 15.75 ± 13.04 49.07 ± 71.13

IL-10 2.68 ± 2.51 2.32 ± 1.98 5.59 ± 3.68 3.41 ± 0.93* 3.73 ± 3.83 4.24 ± 3.64

IP-10 148.95 ± 72.50 130.57 ± 45.74 139.73 ± 32.86 115.89 ± 11.81 105.62 ± 23.03 124.39 ± 40.94

CXCL1 44.94 ± 21.11 132.63 ± 102.54 27.58 ± 11.61 41.09 ± 30.87 25.14 ± 12.21 17.28 ± 10.99

RANTES 17.91 ± 10.48 9.86 ± 5.47 5.02 ± 4.99 6.46 ± 3.34 11.93 ± 5.33 5.21 ± 3.56* Values are mean + SEM from n=5-15/group. *, P<0.05 compared to vehicle

Figure 2.1. Pyocyanin reduces in vitro adipocyte differentation and activates AhR in 3T3-L1 adipocytes

Figure 2.1. Pyocyanin reduces in vitro adipocyte differentiation and activates AhR in 3T3-L1 adipocytes. (A) Oil Red O (ORO) absorbance (510 nm, day 8 of differentiation protocol) of 3T3-L1 adipocytes treated with vehicle (0

µM) or pyocyanin. (B) Representative images of cells (day 8 from (A)) incubated with vehicle or pyocyanin (PYO). (C) mRNA abundance of AhR, CYP1a1, aP2,

PPAR, or -catenin in 3T3-L1 adipocytes incubated with vehicle (0 µM) or pyocyanin during the differentiation protocol. (D) ORO absorbance of differentiated (day 8) 3T3-L1 adipocytes incubated with vehicle (0 µM) or pyocyanin for 24 hours. (E) Representative images of differentiated 3T3-L1 adipocytes from (D) incubated with vehicle or pyocyanin. (F) mRNA abundance of AhR, CYP1a1, or TNF- mRNA abundance in differentiated 3T3-L1 adipocytes incubated with vehicle (0 µM) or pyocyanin for 24 hours. Scale bar in

(B) and (E) is 200 μm. Data are mean + SEM from n = 3-8 wells/treatment. *,

P<0.05 compared to 0 M (VEH).

Figure 2.2. Pyocyanin reduces adipocyte differentiation from murine stem cells and induces ex vivo lipolysis of mouse adipose explants

Figure 2.2 Pyocyanin reduces adipocyte differentiation from murine stem cells and induces ex vivo lipolysis of mouse adipose explants. (A) Oil Red O

(ORO) absorbance (510 nm) of adipocytes, incubated with vehicle (VEH) or pyocyanin (PYO, 100 µM), differentiated from the stromal vascular fraction (SVF) of mouse adipose tissue. (B) Ex vivo lipolysis (glycerol release) of epididymal adipose tissue explants incubated with vehicle (VEH) or pyocyanin (100 µM).

Data are mean + SEM from n = 9-10 mice/group. *, P<0.05 compared to VEH.

Figure 2.3. Pyocyanin results in an acute reduction in body temperature and sustained reductions in body weight of male C57BL/6 mice

Figure 2.3. Pyocyanin results in an acute reduction in body temperature and sustained reductions in body weight of male C57BL/6 mice. Mice received two IP injections of vehicle (VEH) or pyocyanin (PYO, 40 mg/kg) one week apart with study endpoint occurring 24-hours after the second injection. (A)

Subcutaneous body temperature measured at the same time of day for 7 days.

(B) Subcutaneous body temperature measured over a 24-hour period following the first or second IP injection. (C) Percent weight loss (original weight – current weight / original weight x 100) over 7 days. (D) Pyocyanin concentration in adipose tissues (epididymal, EF or retroperitoneal, RPF) 24 hours after second injection. (none detected, N.D.) (E) Oil Red O absorbance (510 nm) of adipocytes (day 8) differentiated from SVF of subcutaneous (SubQ) or EF tissue

(right) of mice administered vehicle or pyocyanin. , indicates timing of IP injection. Data are mean + SEM from n = 5-12 mice/group. *, P<0.05 compared to VEH.

Figure 2.4. Pyocyanin regulates indices of whole body metabolism in male mice

Figure 2.4. Pyocyanin regulates indices of whole body metabolism in male mice. Indirect calorimetry collected over three days of baseline and the first three days following the first and second injection of pyocyanin (PYO) measuring (A)

Respiratory exchange ratio (RER, VCO2/VO2/lean mass), (B) energy expenditure (kcal expended/hr/lean mass), (C) physical activity (counts/30 min/lean mass), or (D) energy intake (kcal consumed/lean mass). Data are mean

+ SEM from n = 15 mice/timepoint. *, P<0.05 compared to baseline PYO.

Figure 2.5. Pyocyanin results in sustained reductions in body weight, lean and fat mass of male C57BL/6J mice

Figure 2.5. Pyocyanin results in sustained reductions in body weight, lean and fat mass of male C57BL/6J mice. Male mice received three IP injections of vehicle (VEH) or pyocyanin (40 mg/kg) one week apart with study endpoint occurring 2 weeks after the third injection. (A) Body weights (g). (B) Percent lean mass (lean mass (g) / body weight (g) x 100)). (C) Percent fat mass (fat mass (g)

/ body weight (g) x 100)). (D) Ex vivo lipolysis of EF explants as quantified by glycerol release. (E) mRNA abundance of target genes in EF, RPF, and liver. (F)

Oil Red O (ORO) absorbance (510 nm) of adipocytes differentiated from SVF cells of male mice administered vehicle (VEH) or pyocyanin (PYO). (G) mRNA abundance of target genes in adipocytes differentiated from (F). , indicates timing of IP injection. Data are mean + SEM from n = 5-15 mice/group. *, P<0.05 compared to VEH. #, P<0.05 as compared to baseline pyocyanin.

Figure 2.6. Pyocyanin results in sustained and robust reductions in body weight, lean and fat mass of female C57BL/6J mice

Figure 2.6. Pyocyanin results in sustained and robust reductions in body weight, lean and fat mass of female C57BL/6J mice. Female mice received three IP injections of vehicle (VEH) or pyocyanin (PYO, 40 mg/kg) one week apart with study endpoint occurring 2 weeks after the third injection. (A) Body weights (g). (B) Percent lean mass (lean mass (g) / body weight (g) x 100)). (C)

Percent fat mass (fat mass (g) / body weight (g) x 100)). (D) Ex vivo lipolysis of

EF explants as quantified by glycerol release. (E) mRNA abundance of CYP1a1,

PPAR, aP2, TNF-, F4/80, or RANTES in EF, RPF, and liver. (F) Oil Red O

(ORO) absorbance (510 nm) of adipocytes differentiated from SVF cells of male mice administered vehicle (VEH) or pyocyanin (PYO). (G) mRNA abundance of target genes in adipocytes differentiated from (F). , indicates timing of IP injection. Data are mean + SEM from n = 5 mice/group. *, P<0.05 compared to

VEH. #, P<0.05 as compared to baseline pyocyanin.

Figure 2.7 Dose response study indicates priming effect of pyocyanin exposure via intraperitoneal (IP) injection

Figure 2.7. Dose response study indicates priming effect of pyocyanin exposure via intraperitoneal (IP) injection. Mice received a total of three IP injections of 30, 40, or 50 mg/kg pyocyanin or PBS VEH control with study endpoint occurring 24-hours after the third injection. (A) Percent weight loss

(original weight – current weight / original weight x 100) two days after the first and second injection. (B) Fat loss (original fat mass – current fat mass / original fat mass x 100) two days after the first and second injection. (C) Plasma concentrations of pyocyanin 24 hours after the third injection. Data are mean +

SEM from n = 5/group. *, P<0.05 compared to VEH.

Figure 2.8 Acute effects of intraperitoneal (IP) injection of pyocyanin on lipolysis and gene expression

Figure 2.8. Acute effects of intraperitoneal (IP) injection of pyocyanin on lipolysis and gene expression of adipose tissue from male mice administered vehicle

(VEH) or pyocyanin (40 mg/kg, two ip injections separated by one week, tissue harvest 24 hours after last injection). (A) Lipolysis of EF explants as quantified by glycerol release. (B) AhR, CYP1a1, PPAR, aP2, TNF-, F4/80, RANTES, and

IL-10 mRNA abundance in EF, RPF, and liver. Data are mean ± SEM from n =

5-12 mice/group. *, P<0.05 compared to VEH.

Figure 2.9 Pyocyanin is rapidly metabolized and excreted in the urine of injected mice

Figure 2.9. Pyocyanin is rapidly metabolized and excreted in the urine of injected mice. Metabolites detected in urine of treated animals 45 and 90 minutes after injection with 40 mg/kg pyocyanin.

Chapter 3 Defining the role of the aryl hydrocarbon receptor in pyocyanin-induced adipose cachexia

3.1 Synopsis

Pyocyanin, a blue-pigmented virulence factor produced by sepsis-causing

Pseudomonas aeruginosa, is a ligand of the aryl hydrocarbon receptor (AhR).

Previous studies demonstrated that pyocyanin activates AhR and reduces adipocyte differentiation. Activation of AhR by pyocyanin (as evidenced by

CYP1a1 induction) occurred in adipose tissue, but not in livers from male and female C57BL/6J mice, and coincided with weight loss, fat loss, increased adipose explant lipolysis, and changes in whole body metabolism. In this study, we defined effects of AhR antagonism on pyocyanin-induced reductions in the differentiation of 3T3-L1 adipocytes. Using male and female mice with adipocyte- specific deficiency of AhR, we determined effects on pyocyanin-induced regulation of body weight and fat mass. In 3T3-L1 cells, CH-223191, an AhR antagonist, reduced pyocyanin-induced stimulation of CYP1a1 mRNA abundance, but had no effect on pyocyanin-induced inhibition of adipocyte differentiation. In male mice, adipocyte AhR deficiency attenuated pyocyanin- induced weight loss and adipose-specific stimulation of CYP1a1 mRNA abundance. In contrast, in female mice, adipocyte AhR deficiency potentiated pyocyanin-induced weight loss, but attenuated pyocyanin-induced stimulation of adipose explant lipolysis and induction of CYP1a1 expression. These results reinforce the sexually dimorphic effect of pyocyanin on cachexia and demonstrate that several of these cachectic outcomes are adipocyte AhR- mediated.

3.2 Introduction

The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that exists in the cytoplasm in its unbound state. Upon binding to ligand,

AhR translocates to the nucleus where it forms a heterodimer with the AhR nuclear transporter (ARNT) [213]. This heterodimer can then bind to AhR response elements on DNA and regulate transcription of target genes, such as the cytochrome P450 gene, CYP1a1 [213]. AhR has been studied in its classical role in drug metabolism and detoxification of xenobiotics. Environmental persistent organic pollutants (POPs), including halogenated and polycyclic aromatic hydrocarbons, are well-known AhR ligands [213]. 2,3,7,8-

Tetrachlorodibenzodioxin (TCDD) and coplanar polychlorinated biphenyls

(PCBs), perhaps the most extensively studied AhR ligands, are hydroxylated by

CYP1a1 and subsequently excreted [215], limiting their toxicity. However, whole body elimination of lipophilic POPs is complicated because of accumulation in adipose lipids, which limits their access to detoxifying enzymes such as CYP1a1

[362].

The accumulation of toxicant AhR ligands in adipose tissue may have physiological implications on adipocyte biology, as AhR is expressed on preadipocytes with expression levels decreasing over the course of adipocyte differentiation [273, 274]. Studies indicate that AhR controls adipocyte differentiation in the early stages of clonal expansion prior to activation of PPAR

[226, 273, 275]. Furthermore, exogenous AhR ligands, including TCDD and

PCBs, reduced adipocyte differentiation and induced inflammation when cells

were exposed to toxicants during the early stages of differentiation [225, 226,

273]. Exposure to TCDD is known to cause a wasting syndrome leading to loss of body weight, fat mass, and lean mass [277]. Previously, we demonstrated a role of AhR in the regulation of body weight using a mouse model with adipocyte- specific AhR deficiency (AhRAdQ) on a C57BL/6J genetic background. After 12 weeks of high fat feeding, AhRAdQ mice had greater increases in body weight and fat mass, decreased lean mass, and increased adipocyte size compared to floxed littermate controls [247].

In addition to its role in adipocyte differentiation and inflammation that is potentially linked to regulation of body weight, AhR also influences immune function. The development of immune cells such as T cells, B cells, and hematopoietic stem cells is regulated by AhR [220, 221, 223, 224, 285-288, 290-

295]. Furthermore, AhR regulates pattern recognition receptors (PRRs), including the NACHT, LRR and PYD domains-containing protein 3 (NLRP3) inflammasome [302-305]. Recently, results demonstrated AhR’s ability to bind and sense pathogen-associated molecular patterns (PAMPs), including pigmented bacterial virulence factors produced by the sepsis-causing bacteria,

Pseudomonas (P.) aeruginosa [270].

P. aeruginosa produces pyocyanin, a blue-pigmented virulence factor with both antibiotic and antifungal properties that kill off competitors of P. aeruginosa

[310, 315, 322, 324]. In biological fluids from patients infected with P. aeruginosa, pyocyanin has been detected at concentrations of 130M [331]. In mammalian cells (e.g., neutrophils), pyocyanin has been reported to increase production of

100

reactive oxygen species and trigger apoptosis [1, 315, 331, 357], but mechanisms for these effects, namely whether they are receptor-mediated, have not been defined. As described in chapter 2, pyocyanin activated AhR and

CYP1a1 in 3T3-L1 adipocytes. Furthermore, pyocyanin reduced the differentiation of adipocytes using two different model systems. When male and female mice were administered pyocyanin, body weight and fat mass decreased, supporting a potential role for pyocyanin in sepsis-associated cachexia. Notably, these effects of pyocyanin were associated with higher mRNA abundance of

CYP1a1 in adipose tissue, but not in liver of male and female mice, supporting

AhR activation that was selective to adipose tissue. In this study, we defined the role of AhR on the in vitro (regulation of adipocyte differentiation, expression levels of CYP1a1) and in vivo (regulation of body weight, fat mass) effects of pyocyanin. Since previous studies identified sex differences in effects of pyocyanin in mice, we examined effects of adipocyte-specific AhR deficiency on pyocyanin administration to male and female C57BL/6J mice.

3.3 Materials and Methods

3.3.1 Growth and differentiation of 3T3-L1 cells

3T3-L1 mouse adipocytes were purchased from ATCC (catalogue number

CL-173). Cells were plated into 6-well plates at a seeding density of 10,000 cells/cm2 and grown in pre-adipocyte expansion medium containing 90%

Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, CA), 10%

Newborn Calf Serum (NCS, Gemini Bio-Products, Carlsbad, CA), and 1%

101

penicillin/streptomycin. Cells (passage number 6 or lower) were grown to 100% confluence at 37°C in a humidified 5% CO2 atmosphere and culture media was changed every 48 hours. Two days after cells reached 100% confluence, differentiation was initiated (day 0) with differentiation medium containing 90%

DMEM, 10% fetal bovine serum (FBS; Gemini Bio-Products, Woodland, CA), 1% penicillin/streptomycin (VWR, Radnor, PA), 0.2 µM insulin (Novo Nordisk A/S,

Bagsvaerd, Denmark), 0.5 mM IBMX (Sigma, catalogue #15879), 1.0 µM dexamethasone (Sigma, catalogue #D4902). Forty-eight hours later (day 2), the medium was changed to adipocyte maintenance medium containing 90% DMEM,

10% FBS, 1% penicillin/streptomycin, and 0.2 µM insulin. Following day 2, the medium was changed every 48 hours (day 4 and day 6) with maintenance medium containing 90% DMEM, 10% FBS, and 1% penicillin/streptomycin only.

On day 8, adipocyte differentiation was quantified.

3.3.2 Use of AhR antagonists against pyocyanin in 3T3-L1 cells

Pyocyanin (Sigma, catalogue number P0046) and the AhR antagonists

CH-223191 (catalogue number C8124), -naphthoflavone (-NF) (catalogue number N5757), and 6, 2’, 4’- trimethoxyflavone (TMF) (catalogue number

T4080) were purchased from Sigma and dissolved in DMSO. As a positive control for AhR activation, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)

(Accustandard, catalogue number D-404N) was dissolved as 1 mg in 3.1 mL

DMSO for a 1 mM stock. To examine effects during differentiation, 3T3-L1 cells were grown to confluence in preadipocyte expansion medium in 6-well plates.

102

Two days after reaching confluence, cells were pretreated with antagonist (20 μM

TMF, 20 μM -NF, or 10 μM CH-223191) for one hour and subsequently treated with pyocyanin (100 µM) or TCDD (10 nM). Fresh media with treatments was replaced every 48 hours. On day 8, cells were harvested for RNA or fixed and stained with Oil Red O (ORO). RNA was collected using RNA lysis buffer (175

µL; Promega, catalogue number MC501C) and scraping the cells. Samples were stored at -80⁰C until RNA extraction was performed. Oil Red O staining was performed on separate plates on day 8 or 9 using the Oil Red O Staining Kit from

Lifeline Cell Technology (catalogue number LL-0052). Stained cells were imaged at 100x. After imaging, all water was removed from the stained cells, and isospropanol (500 µL) was added to each well for 1 minute to extract the Oil Red

O from the cells. Two hundred µL was removed from each well and absorbance was measured in a 96-well plate at 510 nm using a spectrophotometer.

3.3.3 Animal treatments and sample collection

68-70ºC, and humidity ranged from 30-70%. AhR-floxed (AhRfl/fl) mice on a

C57BL/6J background with loxP sites flanking exon 2 were a generous gift from

M. Walker (University of Mexico) [381]. Female AhRfl/fl mice were bred to hemizygous transgenic male Cre mice under the control of the adiponectin promoter/enhancer as described previously [247]. Both male and female AhRfl/fl

103

littermate controls and AhRAdQ mice were randomly assigned to treatment groups for each study. The two genotypes of mice displayed no overt alterations in appearance, behavior, or health at baseline. A total of 37 male mice were used in these experiments, of which n=8 were AhRfl/fl pyocyanin-treated, n= 8 AhRfl/fl vehicle-treated, n=10 AhRAdQ pyocyanin-treated, and n=11 AhRAdQ vehicle- treated. A total of 41 female mice were used in these experiments, of which n=10 were AhRfl/fl pyocyanin-treated, n=9 AhRfl/fl vehicle-treated, n=12 AhRAdQ pyocyanin-treated, and n=10 AhRAdQ vehicle-treated. All mice were fed standard murine diet (Harlan Teklad 2918 Global Rodent Diet, irradiated; Harlan

Laboratories) ad libitum for the course of the studies. At study end point, mice were anesthetized [ketamine/xylazine, 10/100 mg/kg, by intraperitoneal (ip) injection] for exsanguination and tissue harvest (liver, subcutaneous adipose

(SubQ), retroperitoneal adipose (RPF), epididymal adipose (EF)/periovarian fat

(POF), interscapular brown adipose tissue (BAT), heart, lung, and soleus).

3.3.4 Model validation by detection of β-galactosidase activity in tissues

Female ROSA26 Cre reporter mice were bred with AhRAdQ males, and transgenic mice expressed lacZ in all cells driven by the adiponectin (AdQ) promoter. Removal of the floxed STOP cassette by recombinase results in the expression of the lacZ reporter gene coding for beta-galactosidase. Organs from

AhRfl/fl and AhRAdQ male mice resulting from the ROSA26 cross were fixed in formalin at 4°C for 1 hour, then rinsed three times with buffer (100 nM sodium phosphate, 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% NP-40). Organs

104

underwent overnight incubation in 5-bromo-4-chloro-3-indoyl-beta-D- galactopyranoside (X-gal) staining buffer (above rinse buffer with 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 1 mg/mL X-gal). A dark blue precipitate is formed when X-gal is cleaved by -galactosidase, which can be visualized at tissue level.

3.3.5 Administration of pyocyanin to male and female mice

Male and female mice (aged to 7 months to increase fat mass) received three injections (i.p.) of vehicle (VEH) or pyocyanin (40 mg/kg) separated by one week. Body weight was quantified daily and EchoMRI was performed weekly prior to each injection to quantify fat and lean mass. One week following the third injection, a glucose tolerance test was performed as described below. Study endpoint occurred two weeks following the third injection.

3.3.6 Measurement of body composition by EchoMRI

Body composition (fat and lean mass) of conscious mice was determined by nuclear magnetic resonance spectroscopy [EchoMRI (magnetic resonance imaging)] as described previously [247].

3.3.7 Glucose tolerance tests (GTT)

GTT were performed during week 3 of the study design in male and female mice of each genotype that were fasted for 6 hours. Mice were injected

(i.p.) with D-glucose (Sigma; 15% in saline, 10 L/g of body weight) and blood

105

glucose concentrations were quantified using a handheld glucometer (Accu-

Check Aviva Plus, Roche Diagnostics, Indianapolis, IN) at 0, 15, 30, 60, 90, and

120 min using tail vein puncture. Calculations for the total area under the curve

(AUC) were performed by adjusting the baseline to the fasting blood glucose concentration at time 0 for each mouse. Using GraphPad Prism, the total incremental area (between times 0 and 120 min) above baseline was calculated and represented as arbitrary units.

3.3.8 Extraction of RNA and quantification of mRNA abundance

The Maxwell RSC simplyRNA Cell or Tissue Kit (Promega Corporation,

Madison, WI) was used to extract total RNA from tissues and cells using according to the manufacturer’s instructions. RNA concentrations were determined using a NanoDrop 2000 spectophotometer (ThermoScientific,

Wilmington, DE). qScript cDNA SuperMix (Quanta Biosciences, Gaithersburg,

MD) was used to synthesize cDNA from 0.4 µg total RNA with in the following reaction: 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. The cDNA was diluted to 0.4 ng/µL and amplified with an iCycler (Bio-Rad, Hercules,

CA) and the Perfecta SYBR Green Fastmix for iQ (Quanta Biosciences,

Gaithersburg, MD). The relative quantification of mRNA abundance in each sample was calculated using the Ct method and the difference from GAPDH cDNA (reference gene). The PCR reaction was as follows: 94°C for 5 minutes,

40 cycles at 94°C for 15 seconds, 60°C or 64°C (based on tested primer efficiency) for 40 seconds, 72°C for 10 minutes, and 100 cycles from 95°C to

106

45.5°C for 10 seconds. Primer sequences were as follows: AhR, forward 5’-

GACCAAACACAAGCTAGACTTCACACC, reverse 5’-

CAAGAAGCCGGAAAACTGTCATGC; AhR, forward 5’-

AGTAAAGCCCATCCCCGCTGAAGG-3’, reverse 5’-

CATCAAAGAAGCTCTTGGCCC-3’; CYP1A1 (cytochrome P450 1A1), forward

5’-AGTCAATCTGAGCAATGAGTTTGG-3’, reverse 5’-

GGCATCCAGGGAAGAGTTAGG-3’; GAPDH, forward 5’-

GCCAAAAGGGTCATCATCTC-3’, reverse 5’-GGCCATCCACAGTCTTCT-3’.

3.3.9 Quantification of lipolysis in epididymal (EF) adipose explants

EF were cut into 25 to 50 mg explants, with one explant placed into one

24-well plate containing Krebs buffer (1 mL). Explants were washed with fresh buffer, which was removed and replaced with Krebs buffer (0.5 mL) containing

2% fatty acid free bovine serum albumin, and the plates were incubated at 37°C.

A 30 uL sample of buffer was removed from each well at 60, 120, 180, and 240 minutes after the start of the incubation. The glycerol concentration of the samples was quantified using the Glycerol Colorimetric Assay Kit (Cayman

Chemicals, Item # 10010755) per the manufacturer’s instructions. At the end of the incubation, EF explants were washed three times with Krebs buffer (1 mL/each) and frozen for protein determination. For protein determination, tissue samples were suspended on ice in PBS (0.5 mL) containing EDTA (2 mM) and protease cocktail inhibitor (cOmplete Mini, Roche Diagnostics, Indianapolis, IN).

Tissue was homogenized using a Geno/Grinder (Spex SamplePrep, Metuchen,

107

NJ) set to 1,350 rpm x 1.5 minutes. After homogenization, samples were centrifuged at 14,000 rpm x 10 minutes at 4°C and the supernatants transferred to clean tubes. Protein concentrations of the supernatants were determined using the Pierce BCA protein assay kit. Lipolysis is reported as amount of glycerol produced/mg protein/hour.

3.3.10 Statistical analyses

Data are represented as mean + SEM. Data were tested for normality using the Shapiro-Wilk test, and equal variance was tested using the Brown-

Forsythe test. Outlier detection was performed using Grubbs’ or extreme studentized deviate method where alpha = 0.05. Data were logarithmically transformed if data did not pass normality using these approaches. Two-way analysis of variance (ANOVA; SigmaPlot, version 13.0; Systat Software Inc.,

Chicago, IL) was used to define effects of pyocyanin and CH-223191 treatment in vitro. Holm-sidak was used for post-hoc analyses to test for interactions. Two- way Repeated Measure ANOVAs (for body weight and blood glucose) and Two-

Way ANOVAs (for lipolysis and mRNA abundance) were used to analyze in vivo comparisons between pyocyanin (PYO) and vehicle (VEH) treated animals. To analyze body composition, for each outcome variable of interest (fat mass and lean mass), two separate full factorial three-way repeated measures ANOVAs were performed, one for males and one for females, analyzing differences across time, genotype, and treatment. In each model, separate unstructured covariance structures were estimated for the two treatment groups. For factors involved in

108

significant statistical interactions, we performed the corresponding post hoc t- tests. Across all analyses, a p-value of less than 0.05 was considered significant.

All analyses were completed in SAS 9.4 (SAS Institute Inc.; Cary, NC, USA).

Statistical significance was defined as p < 0.05.

3.4 Results

3.4.1 AhR antagonists reduce pyocyanin-induced stimulation of CYP1a1 mRNA

abundance but have no effect on pyocyanin-induced suppression of

adipocyte differentiation

We demonstrated previously (see Chapter 2) that pyocyanin reduced differentiation of 3T3-L1 cells to adipocytes and stimulated adipocyte mRNA abundance of CYP1a1, a marker of AhR activation. To define the role of AhR in these effects of pyocyanin, we examined effects of three different AhR antagonists, 6, 2’, 4’- trimethoxyflavone (TMF), -naphthoflavone (-NF), and

CH-223191. Our rationale for examining different pharmacologic modes of AhR antagonism is based on the actions of these agents to act as partial (TMF, -NF) or complete (CH-223191) antagonists [261, 262]. Moreover, we compared effects of AhR antagonists on pyocyanin responses to those of TCDD, a potent AhR agonist, as a positive control for CYP1a1 activation.

As reported in Chapter 2, pyocyanin significantly reduced ORO staining as a marker of adipocyte differentiation (Figure 3.1A-C, p<0.05). Treatment with the three AhR antagonists (alone) had no significant effect on ORO staining (Figure

3.1A-C). In addition, pretreatment with -NF, TMF, or CH-223191 had no

109

significant effect on pyocyanin-induced reductions in ORO staining (Figure 3.1A-

C).

Pyocyanin (Figure 3.1D-F, p<0.05) and TCDD (Figure 3.1 D,F; p<0.05) resulted in robust activation of CYP1a1, with greater effects of TCDD compared to pyocyanin. Exposure to -NF or TMF (alone), but not CH-223191, resulted in a significant increase of CYP1a1 mRNA abundance (Figure 3.1D, p<0.05). TCDD- induced stimulation of CYP1a1 mRNA abundance was antagonized by -NF; however, rather than inhibit effects of pyocyanin, combined incubation of 3T3-L1 cells with pyocyanin and α-NF resulted in a robust, synergistic increase of

CYP1a1 mRNA abundance (Figure 3.1D, p<0.05). TMF had no significant effect on pyocyanin-induced stimulation of CYP1a1 mRNA abundance (Figure 3.1E). In contrast, CH-223191 significantly attenuated both pyocyanin- and TCDD-induced stimulation of CYP1a1 mRNA abundance (Figure 3.1F, p<0.05).

3.4.2 Validation of the mouse model of adipocyte AhR deficiency

Previous studies described the generation and characterization of a mouse model of adipocyte AhR deficiency [247], focusing on the regulation of

AhR mRNA abundance in adipose but not in other tissues. To further validate the tissue specificity of AhR deficiency in a re-derived model of adipocyte AhR deficiency, we used transgenic ROSA26 Cre reporter mice expressing lacZ in all cells driven by the adiponectin promoter, with histochemical detection of - galactosidase activity as an index of AhR deficiency. Following removal of the floxed STOP cassette by Cre recombinase, the lacZ reporter gene, which codes

110

for the beta-galactosidase enzyme, is expressed. -galactosidase activity is detected using 5-bromo-4-chloro-3-indoyl-beta-D-galactopyranoside (X-gal), which forms a dark blue precipitate when cleaved by -galactosidase. Using this technique on tissues from this mouse model, BAT, EF, RPF, and SubQ adipose tissues from AhRAdQ mice were dark blue, indicating the presence of - galactosidase and, therefore, expression of Cre (Figure 3.1). In contrast, there was no blue color detected in kidney, lungs, stomach, or brains from AhRAdQ mice and their floxed littermate controls (Figure 3.1). Blue staining around the heart and aorta is likely epicardial fat, which mirrors previous findings of modest reductions of AhR mRNA abundance in hearts of AhRAdQ mice [247].

3.4.3 Adipocyte AhR deficiency in male mice attenuates effects of pyocyanin on

body weight and fat mass

Using the experimental design from previous studies demonstrating an effect of pyocyanin to regulate body weight and fat mass, we administered three doses (one week apart) of vehicle (VEH) or pyocyanin (PYO) to AhRfl/fl and

AhRAdQ male mice. AhRfl/fl male mice exhibited reductions in body weight following administration of pyocyanin, which was maintained through study endpoint (Figure 3.3A; p<0.05). Similarly, AhRAdQ male mice lost weight in response to pyocyanin administration, but the magnitude of pyocyanin-induced reductions in body weight was less compared to AhRfl/fl mice (Figure 3.3B). For example, AhRfl/fl mice had significant reductions in body weight from day 3 through the end of the study in response to pyocyanin, while AhRAdQ mice

111

exhibited significant reductions in body weight following the third dose of pyocyanin, which were not maintained by study endpoint (Figure 3.3A,B, p<0.05).

In mice of either genotype administered vehicle, there was no significant effect on fat or lean mass compared to baseline (day 0) (Figure 3.4A,B).

Administration of pyocyanin to AhRfl/fl male mice resulted in a significant reduction in body fat compared to baseline on days 14 and 21 (Figure 3.4A, p<0.05). Similarly, administration of pyocyanin to AhRAdQ male mice decreased body fat compared to baseline on days 7, 14 and 21 (Figure 3.4B, p<0.05).

Compared to vehicle controls, there were no significant reductions in fat mass of either genotype on days 0, 7 or 14 (Figure 3.4A,B). However, on day 21, both

AhRfl/fl and AhRAdQ mice exhibited significant reductions in body weight and fat mass compared to vehicle controls within genotype (Figure 3.4A,B, p<0.05).

Lean mass was not significantly different from baseline in mice of either genotype administered vehicle (Figure 3.4C,D). Administration of pyocyanin resulted in an increase in lean mass compared to baseline on days 14 and 21 in AhRfl/fl male mice, and on days 7 – 21 in AhRAdQ males (Figure 3.4C,D, p<0.05) . Moreover, on day 21 following pyocyanin both genotypes exhibited significant elevations in lean mass compared to vehicle controls within genotype (Figure 3.4C,D, p<0.05).

3.4.4 Pyocyanin does not alter glucose tolerance or adipose explant lipolysis of

AhRfl/fl or AhRAdQ male mice

Because of the modestly higher body weights of AhRAdQ male mice (VEH) compared to AhRfl/fl controls (Figure 3.3A,B), and because pyocyanin reduced

112

body weight, we quantified glucose tolerance. However, pyocyanin had no significant effect on glucose tolerance of male mice of either genotype compared to vehicle controls (Figure 3.5A-C). Similarly, pyocyanin had no significant effect on adipose explant lipolysis in male mice of either genotype compared to vehicle controls (Figure 3.6).

3.4.5 Adipocyte AhR deficiency abrogates pyocyanin-induced stimulation of

adipose CYP1a1 mRNA abundance in male mice

We previously observed an adipose-selective activation of CYP1a1 mRNA abundance in adipose tissue of male C57BL/6J mice following pyocyanin administration (see Chapter 2). Similar to previous findings, administration of pyocyanin to male AhRfl/fl resulted in a significant elevation of CYP1a1 mRNA abundance in adipose tissue, but not liver (Figure 3.7A,B, p<0.05). Moreover, pyocyanin-induced elevations of CYP1a1 mRNA abundance were not observed in adipose tissue from AhRAdQ male mice (Figure 3.7A).

3.4.6 Adipocyte AhR deficiency augments effects of pyocyanin to decrease

body weight and fat mass of female mice

On this genetic background, pyocyanin had no significant effect on body weight of AhRfl/fl female mice (Figure 3.8A). Paradoxically, pyocyanin administration significantly decreased body weights of AhRAdQ females, with significant reductions compared to vehicle controls on day 3 through study endpoint (Figure 3.8B, p<0.05).

113

Compared to baseline (day 0), administration of pyocyanin resulted in a significant reduction of fat mass in both genotypes on days 7 – 21 (Figure

3.9A,B, p<0.05). Moreover, fat mass of pyocyanin-treated AhRAdQ females was significantly decreased compared to vehicle controls on day 21 (Figure 3.9B, p<0.05).

Lean mass was significantly increased compared to baseline on days 14 and 21 following administration of pyocyanin to both genotypes (Figure 3.9C,D, p<0.05). However, there were no significant differences in lean mass of either genotype compared to vehicle controls at any time point examined (Figure

3.9C,D).

3.4.7 Neither adipocyte AhR deficiency nor pyocyanin influence glucose

tolerance of female mice, but adipocyte AhR deficiency abolishes effects

of pyocyanin to stimulate lipolysis of adipose tissue explants

Despite robust reductions of body weights of AhRAdQ females in response to pyocyanin (Figure 3.8B), there was no significant effect of either pyocyanin or adipocyte AhR deficiency on glucose tolerance (Figure 3.10A-C). Pyocyanin stimulated lipolysis of adipose tissue explants from AhRfl/fl females (Figure 3.11, p<0.05). In contrast, there was no effect of pyocyanin on adipose explant lipolysis of AhRAdQ females (Figure 3.11, p<0.05).

114

3.4.8 Pyocyanin-induced stimulation of adipose CYP1a1 mRNA abundance is

mediated by adipocyte AhR

Similar to males, pyocyanin administration resulted in a significant increase of CYP1a1 mRNA abundance in adipose tissue, but not livers of AhRfl/fl females (Figure 3.12A,B, p<0.05). In contrast, pyocyanin had no effect on

CYP1a1 mRNA abundance in adipose tissue from AhRAdQ females (Figure

3.12A).

3.5 Discussion

The major findings of this study are as follows: (1) pyocyanin-induced reductions of adipocyte differentiation do not appear to be AhR-mediated, despite indices of robust AhR activation by pyocyanin in adipocytes, (2) in male mice, adipocyte AhR partially contributes to pyocyanin-induced reductions in body weight and fat mass, (3) in female mice, adipocyte AhR deficiency paradoxically augments effects of pyocyanin to decrease body weight and fat mass, (4) pyocyanin-induced stimulation of CYP1a1 mRNA abundance in adipose tissue is adipocyte AhR mediated in both male and female mice. These results indicate that pyocyanin stimulates CYP1a1 expression in an adipose-selective manner through an AhR mechanism. However, the role of adipocyte AhR in pyocyanin- induced regulation of body weight and fat mass is sexually dimorphic. Male mice appear to partially respond to pyocyanin to decrease body weight and fat mass through adipocyte AhR, while females potentially utilize adipocyte AhR to limit influences of pyocyanin on the regulation of body weight and fat mass.

115

In agreement with previous findings [270] (see Chapter 2 Figures 2.5 and

2.6), results from this study demonstrate that pyocyanin stimulates CYP1a1 mRNA abundance in 3T3-L1 adipocytes as a marker of AhR activation. However, it was unclear from previous studies if effects of pyocyanin to reduce adipocyte differentiation (see chapter 2) were AhR-mediated. To define the role of AhR in effects of pyocyanin at adipocytes, we used three different AhR antagonists: -

NF, TMF, or CH-223191. AhR antagonists competitively bind to AhR, inhibiting nuclear translocation. However, several AhR antagonists possess partial agonist activity [261]; therefore, finding reliable and effective pharmacologic AhR antagonists has been problematic. - NF is a partial agonist of AhR that is able to antagonize the receptor at high concentrations by competitive inhibition [262].

Similarly, studies have reported partial agonist activity of TMF during prolonged exposures, with metabolism of TMF producing weak partial agonism [261]. In this study, in which cells had prolonged exposures to AhR antagonists, partial agonism by α-NF or TMF is likely as treatment with either antagonist (alone) stimulated CYP1a1 mRNA abundance in adipocytes. Moreover, α-NF resulted in a synergistic stimulation of CYP1a1 mRNA abundance in the presence of pyocyanin, suggesting agonist rather than antagonist effects of the compound. In contrast, CH-223191 is a potent pure competitive antagonist of AhR [263-265] and was able to antagonize CYP1a1 activation by both pyocyanin and TCDD; however, studies have reported that CH-223191 selectively antagonizes halogenated aromatic hydrocarbons (HAHs) (TCDD, PCB77, and PCB126) but not polycyclic aromatic hydrocarbons (PAHs), flavonoids, and indirubin [265].

116

Similarly, TMF exhibited preferential inhibition of HAHs [265]. Unlike TCDD and

PCBs, which contain chloride atoms attached to benzene rings, pyocyanin’s structure is not halogenated; therefore, the preferential inhibition of HAHs by these antagonists may prove ineffective against pyocyanin’s actions. A limitation of this study is reliance on a single mode of AhR interference (pharmacologic) as compared to genetic knockdown of the target to define effects of pyocyanin on adipocytes. However, our results suggest that while pyocyanin indeed stimulates markers of AhR activation in adipocytes that are abolished by pure AhR antagonists, the ability of the virulence factor to regulate adipocyte differentiation is not AhR-mediated.

In Chapter 2, we reported that administration of pyocyanin to male and female mice resulted in stimulation of CYP1a1 in adipose tissues, but not in liver, suggesting an adipose-selective mode of action of the compound. However, it was unclear if these effects of pyocyanin were AhR-mediated, and whether they were related to pyocyanin-induced regulation of body weight and fat mass.

Although pyocyanin’s effect to reduce differentiation of 3T3-L1 cells to adipocytes does not appear to be AhR-mediated, a change in differentiation was not the primary cachectic outcome observed in the in vivo models of chapter 2. We validated the mouse model of adipocyte-specific deficiency of AhR (AhRAdQ) and used these mice and their floxed littermate controls to determine if pyocyanin’s in vivo effects are AhR-mediated. If pyocyanin exerts its cachectic effects through

AhR, we would anticipate that removing AhR from adipocytes would protect mice from pyocyanin-induced reductions in body weight and fat mass.

117

We observed some differences in responses to pyocyanin of male and female mice in this study compared to findings from Chapter 2. Specifically, in this study AhRfl/fl males lost weight following the first dose of pyocyanin, while

C57BL/6J males (Chapter 2) required a second dose of pyocyanin to exhibit body weight reductions. Moreover, female AhRfl/fl mice of this study administered pyocyanin did not exhibit robust effects on body weight and fat mass, compared to a pronounced effect of pyocyanin to reduce body weight of C57BL/6J females

(Chapter 2). These differences in responses to pyocyanin between our studies could arise from several potential variables. For example, it is known that there are differences in AhR affinity between AhR alleles within different mouse strains

[382]. There are four variations of the AhR allele in mice, with 10-fold differences in affinity and activity of the receptor between the high-affinity Ahrb1 allele present in the C57BL/6J strain and the low-affinity Ahrd, which is present in DBA/2 mice and is most similar to human AhR [382, 383]. These allelic differences lead to large differences in expression of genes, such as CYP1a1 [384].These differences result in changes in body mass, fat mass, and fat metabolism between mouse strains, with high-affinity allele mice gaining more weight and adiposity [382]. Unpublished studies in our lab have demonstrated differential induction of CYP1a1 between male C57BL/6J and AhRfl/fl mice following PCB-77 exposure. The differential response to PCBs and pyocyanin observed between these two animal colonies may indicate a difference in the AhR alleles present, which could have been introduced into the colony if the AhRfl/fl mice or the adiponectin Cre mice possessed different AhR alleles than the C57BL/6J mice

118

purchased directly from Jackson Laboratories. For example, CYP1a1 expression in POF of AhRfl/fl females exposed to pyocyanin is one fold lower than CYP1a1 expression in POF from C57BL/6J females exposed to pyocyanin for the same duration, which could explain why AhRfl/fl females had less pyocyanin-induced weight loss than C57BL/6J females in Chapter 2.

Our results clearly indicate that pyocyanin induces an adipose-selective activation of CYP1a1 mRNA expression, indicative of AhR activation, in both male and female mice through adipocyte AhR. These results confirm the mouse model of adipocyte AhR deficiency, as pyocyanin-induction of CYP1a1 mRNA abundance was abolished in adipose tissue, but not in livers from mice with adipocyte AhR deficiency. Pyocyanin is an organic compound that is soluble in chloroform or DMSO, and is thus lipophilic. It is likely that pyocyanin induces an adipose-selective induction of CYP1a1 mRNA expression because of the compound’s sequestration in adipose lipids, similar to other persistent organic pollutants (see Chapter 2, Figures 2.5 and 2.6). Adipose tissue accumulation of pyocyanin may contribute to more pronounced effects of pyocyanin to activate

AhR in adipose than in liver of both male and female mice.

We previously demonstrated the ability of other AhR ligands, including coplanar PCBs, to impair glucose homeostasis [247, 385]. Thus, it was important to define the physiological relevance of pyocyanin-induced regulation of body weight in mice, and whether these effects were adipocyte AhR-mediated. If weight loss in pyocyanin-treated mice is healthy, we would anticipate a beneficial effect on glucose homeostasis following weight reduction [386, 387].

119

Unfortunately, despite reductions in body weight of pyocyanin-treated mice, there was no change in glucose tolerance. Furthermore, impaired glucose homeostasis is commonly reported in human patients and murine models of sepsis, with hyperglycemia occurring in the catecholamine-rich hypermetabolic stage of sepsis and hypoglycemia resulting in the hypodynamic stage [388-391]. The absence of an improvement in glucose homeostasis despite weight loss in pyocyanin-treated mice may reflect the impaired glucose tolerance observed in the hypermetabolic stage of sepsis [388-391].

Our results suggest that adipocyte AhR plays a sexually dimorphic role in the regulation of body weight following pyocyanin exposure. Adipocyte AhR partially mediates effects of pyocyanin to regulate body weight of male mice, while removal of the receptor potentiated body weight regulation by pyocyanin in females. These results suggest a protective role of adipocyte AhR in females that may be linked to clearance of pyocyanin, as removal of adipocyte AhR would limit CYP1a1 induction and therefore retard pyocyanin clearance. Indeed, previous studies demonstrated that male and female whole body AhR knockout mice succumbed more quickly to P. aeruginosa infection, which was believed to be due to reduced clearance of pyocyanin [270]. In this study, fat mass of female mice at baseline was modestly higher than males, suggesting potentially more accumulation of pyocyanin in adipose tissue of female than male mice. These results suggest that adipose tissue may serve as a primary site for both the storage and clearance of pyocyanin. A limitation of this study is that we did not measure pyocyanin levels in adipose tissue or plasma. However, since previous

120

studies using the same experimental design did not give rise to detectable levels of pyocyanin three weeks after the last injection (see Chapter 2), it is unclear whether differences in pyocyanin accumulation in adipose tissue between the sexes contributed to sexual dimorphism of the role of adipocyte AhR.

Regardless, these results suggest that in males, activation of adipocyte AhR by pyocyanin contributes to both induction of CYP1a1 (and resultant pyocyanin metabolism) and body weight regulation, while adipocyte AhR activation by pyocyanin in females may influence pyocyanin clearance (through CYP1a1 induction). Pyocyanin has physiological effects outside of its role as an AhR ligand that could contribute to regulation of body weight in male or female mice.

For example, pyocyanin produces reactive oxygen species, and oxidative stress is a known mechanism of cachexia, particularly in muscle wasting [392, 393].

These effects of pyocyanin may not require receptor activation.

In conclusion, pyocyanin stimulates CYP1a1 expression in adipose tissue of male and female mice, and this effect is AhR-mediated. However, effects of pyocyanin to reduce adipocyte differentiation do not appear to be AhR-mediated.

Moreover, while adipocyte AhR deficiency contributes to pyocyanin’s regulation of body weight and fat mass in male mice, removal of the receptor from adipocytes of female mice augmented cachexia-like effects of pyocyanin. Future studies should focus on mechanisms of sex differences and AhR-dependence of the effects of pyocyanin on body weight and fat mass.

121

Figure 3.1. AhR antagonists have no effect on pyocyanin-induced reductions of adipocyte differentiation but differentially affect CYP1a1 expression

Figure 3.1. AhR antagonists have no effect on pyocyanin-induced reductions of adipocyte differentiation but differentially affect CYP1a1 expression. (A-C) Oil Red O (ORO) absorbance (510nm, day 8 of differentiation protocol) of 3T3-L1 adipocytes treated with vehicle (VEH, 0 M), pyocyanin

(PYO, 100 M), or TCDD (10 nM) following a 1-hour pretreatment with of (A) -

NF (20 μM), (B) TMF (20 μM), or (C) CH-223191 (10 μM). (D-F) mRNA abundance of CYP1a1 in 3T3-L1 adipocytes incubated with vehicle (VEH, 0 M),

122

pyocyanin (PYO, 100 M), or TCDD (10 nM) following a 1-hour pretreatment with

(A) -NF (20 μM), (B) TMF (20 μM), or (C) CH-223191 (10 μM). Data are mean +

SEM from n = 3-8 wells/treatment. *, P<0.05 compared to 0 M (VEH). #, P<0.05 effect of antagonist.

123

Figure 3.2. Validation of mouse model of adipocyte-specific AhR deficiency

Figure 3.2. Validation of mouse model of adipocyte-specific AhR deficiency. Validation of adipocyte-specific Cre activation by detection of β- galactosidase activity in tissues from AhRfl/fl and AhRAdQ male mice. Blue staining in brown adipose tissue (BAT), epididymal fat (EF), retroperitoneal fat (RPF), and subcutaneous fat (SubQ) from AhRAdQ mice indicates adipose-specific activation of Cre under the adiponectin promoter.

124

Figure 3.3 Adipocyte deficiency of AhR attenuates weight loss in males administered pyocyanin

Figure 3.3. Adipocyte deficiency of AhR attenuates weight loss in males administered pyocyanin. Male AhRfl/fl and AhRAdQ mice received three injections (i.p.) of vehicle (VEH) or pyocyanin (40 mg/kg) one week apart with study endpoint occurring 2 weeks after the third injection. Body weights (g) of (A)

AhRfl/fl males and (B) AhRAdQ males treated with VEH or PYO. , indicates timing of ip injection. Data are mean + SEM from n = 8-11 mice/group. *, P<0.05 compared to VEH.

125

Figure 3.4 Adipocyte AhR does not affect body composition in chronically exposed males

Figure 3.4. Adipocyte AhR does not affect body composition in chronically exposed males. Male AhRfl/fl and AhRAdQ mice received three injections (i.p.) of vehicle (VEH) or pyocyanin (40 mg/kg) one week apart with study endpoint occurring 2 weeks after the third injection. EchoMRI was performed weekly before each injection. (A, B) Percent fat mass (fat mass (g) / body weight (g) x

100)) of (A) AhRfl/fl and (B) AhRAdQ males. (C, D) Percent lean mass (lean mass

(g) / body weight (g) x 100)) of (C) AhRfl/fl and (D) AhRAdQ males. Data are mean

+ SEM from n = 8-11 mice/group. *, P<0.05 AhRAdQ VEH compared to AhRAdQ

PYO. #, P<0.05 compared to baseline PYO.

126

Figure 3.5 Neither adipocyte AhR deficiency nor pyocyanin administration regulates glucose tolerance of male mice

Figure 3.5. Neither adipocyte AhR deficiency nor pyocyanin administration regulates glucose tolerance of male mice. (A,B) Blood glucose measurements for AhRfl/fl (A) and AhRAdQ (B) mice after glucose challenge. (C) Area under the curve (AUC) for blood glucose concentrations following administration of glucose in females of each genotype administered VEH or PYO (week 3, one week after final exposure). Data are mean + SEM from n = 8-11 mice/group.

127

Figure 3.6 . Adipocyte AhR does not influence lipolysis of adipose explants from male mice

Figure 3.6. Adipocyte AhR does not influence lipolysis of adipose explants from male mice. Lipolysis of epididymal fat (EF) explants as quantified by glycerol release at study endpoint, two weeks after the final exposure to pyocyanin. Data are mean + SEM from n = 8-11 mice/group.

128

Figure 3.7. Adipocyte AhR deficiency abolishes pyocyanin-induced elevations of CYP1a1 mRNA abundance in adipose tissue, but not livers of male mice

Figure 3.7. Adipocyte AhR deficiency abolishes pyocyanin-induced elevations of CYP1a1 mRNA abundance in adipose tissue, but not livers of male mice. Two weeks after final exposure, tissues were harvested from

AhRfl/fl and AhRAdQ males. mRNA abundance of CYP1a1 in (A) epididymal (EF) adipose tissue and (B) liver. Data are mean + SEM from n = 9-12 mice/group.

*, P<0.05 compared to VEH. #, P<0.05 effect of genotype.

129

Figure 3.8. Adipocyte AhR deficiency augments pyocyanin-induced reductions in body weight of female mice

Figure 3.8. Adipocyte AhR deficiency augments pyocyanin-induced reductions in body weight of female mice. Female AhRfl/fl and AhRAdQ mice received three IP injections of vehicle (VEH) or pyocyanin (40 mg/kg) one week apart with study endpoint occurring 2 weeks after the third injection. Body weights (g) in (A) AhRfl/fl females and (B) AhRAdQ females treated with VEH or

PYO. , indicates timing of ip injection. Data are mean + SEM from n = 9-12 mice/group. *, P<0.05 compared to VEH.

130

Figure 3.9. Adipocyte AhR deficiency augments pyocyanin-induced reductions in fat mass of female mice

Figure 3.9. Adipocyte AhR deficiency augments pyocyanin-induced reductions in fat mass of female mice. Female AhRfl/fl and AhRAdQ mice received three IP injections of vehicle (VEH) or pyocyanin (40 mg/kg) one week apart with study endpoint occurring 2 weeks after the third injection. (A, B)

Percent fat mass (fat mass (g) / body weight (g) x 100)) in (A) AhRfl/fl and (B)

AhRAdQ. (C, D) Percent lean mass (lean mass (g) / body weight (g) x 100)) in (C)

AhRfl/fl and (D) AhRAdQ. Data are mean + SEM from n = 9-12 mice/group. *,

P<0.05 AhRAdQ VEH compared to AhRAdQ PYO. #, P<0.05 compared to baseline

PYO.

131

Figure 3.10. Neither adipocyte AhR deficiency nor pyocyanin regulate glucose tolerance of female mice

Figure 3.10. Neither adipocyte AhR deficiency nor pyocyanin regulate glucose tolerance of female mice. (A,B) Blood glucose measurements for

AhRfl/fl (A) and AhRAdQ (B) mice after glucose challenge. (C) Area under the curve (AUC) for blood glucose concentrations following administration of glucose in females of each genotype administered VEH or PYO (week 3, one week after final exposure). Data are mean + SEM from n = 9-12 mice/group.

132

Figure 3.11. Adipocyte AhR deficiency abolishes pyocyanin-induced stimulation of lipolysis in adipose explants from female mice

Figure 3.11. Adipocyte AhR deficiency abolishes pyocyanin-induced stimulation of lipolysis in adipose explants from female mice. Lipolysis of periovarian fat (POF) explants as quantified by glycerol release at study endpoint, two weeks after the final exposure to pyocyanin. Data are mean + SEM from n = 9-12 mice/group.

133

Figure 3.12. Adipocyte AhR deficiency abolishes pyocyanin-induced elevations of CYP1a1 mRNA abundance in adipose tissue, but not livers of female mice

Figure 3.12. Adipocyte AhR deficiency abolishes pyocyanin-induced elevations of CYP1a1 mRNA abundance in adipose tissue, but not livers of female mice. Two weeks after final exposure, tissues were harvested from

AhRfl/fl and AhRAdQ females. mRNA abundance of CYP1a1 in (A) periovarian fat

(POF) and (B) liver. Data are mean + SEM from n = 9-12 mice/group. *, P<0.05 compared to VEH. #, P<0.05 effect of genotype.

134

Chapter 4 Overall Discussion

4.1 Discussion

4.1.1 Summary

This dissertation demonstrates a novel role of pyocyanin in the pathogenesis of cachexia and adipose wasting. By studying the effects of pyocyanin alone, these studies distinguish the virulence factor’s effects in isolation from the confounding effects of the other phenazines produced by P. aeruginosa. To our knowledge, these are the first studies administering pyocyanin via intraperitoneal injection and subsequently measuring the virulence factor in plasma and adipose tissue. We suggest that the in vivo model developed in this dissertation provides an experimental model of pyocyanin- induced cachexia. The model reproducibly results in cachexia and adipose wasting in two different murine strains. The effects of pyocyanin appear to be largely adipose-selective, with activation of CYP1a1 occurring in adipose tissue, but not in liver, the primary organ for metabolism of factors such as pyocyanin.

These findings, coupled with the detection of pyocyanin in adipose tissue after in vivo exposure, suggest pyocyanin might behave similarly to other AhR ligands, such as the lipophilic persistent organic pollutants that accumulate in adipose tissue and exert effects through adipocyte AhR. While some of pyocyanin’s cachectic mechanisms, such as lipolysis and weight loss, appear to be partially mediated through AhR, pyocyanin also exerts effects independently of the receptor. Furthermore, sexually dimorphic effects and variances in AhR

135

responsiveness based on timing of exposure and mouse strain complicate the understanding of pyocyanin’s mechanisms.

4.1.2 Pyocyanin contributes to adipose cachexia

While pyocyanin has largely been studied in bacterial lung infections in cystic fibrosis, little is known about pyocyanin’s function in sepsis arising from P. aeruginosa infection. There is evidence that pyocyanin activates AhR and contributes to the production of reactive oxygen species and inflammation, but its actions at adipocyte AhR remain unknown. We previously demonstrated that

AhR ligands reduce adipocyte differentiation and augment adipocyte inflammation [225]. Furthermore, AhR appears to regulate body weight [247]. As a putative AhR ligand released during bacterial infections, pyocyanin represents a novel target in the study of weight loss and lipoatrophy of septic cachexia.

Using in vitro and in vivo approaches, the studies in Chapter 2 attempted to address this gap in the literature by examining the ability of pyocyanin to activate adipocyte AhR and contribute to cachexia by inducing weight loss, changes in body composition, and inflammation.

Using 3T3-L1 cells and adipocyte-derived stem cells (ADSCs), we determined that pyocyanin can activate adipocyte AhR and reduce adipocyte differentiation at a concentration of 100 M in two different adipocyte model cell systems. In murine adipose explants, this same concentration of pyocyanin stimulated basal lipolysis. These in vitro studies demonstrated the ability of pyocyanin to alter adipocyte function and development through mechanisms

136

potentially linked to AhR activation. However, pyocyanin had differing effects on pre-/differentiating adipocytes and mature adipocytes. In order to elucidate pyocyanin’s physiological effects on body weight and adipose mass, and to determine if systemically-administered pyocyanin would influence adipocytes, we developed an in vivo model of pyocyanin-induced cachexia using intraperitoneal injection.

With this model, we studied the acute and chronic effects of pyocyanin on adipose cachexia in male and female C57BL/6J mice. Acutely, pyocyanin administration increased systemic inflammation and decreased body temperature, which coincided with trembling and reduced locomotive activity.

Therefore, pyocyanin may contribute to the hypothermia, shaking, and disorientation observed in septic patients. Even with normal body temperature and behavior restored 24 hours post-injection, pyocyanin-treated animals lost weight. This sustained weight loss could potentially be explained by pyocyanin’s effects on the adipocyte and lipid metabolism, as pyocyanin was detected in plasma and visceral adipose tissue 24-hours after exposure. Pyocyanin reduced respiratory exchange ratio (RER), energy expenditure, activity, and food intake. A reduction in RER indicated a shift towards the utilization of fat for fuel, a hallmark of septic cachexia [120, 159, 160]. Moreover, when ADSCs were harvested from the stromal vascular fraction of mice 24-hours following injection with pyocyanin, stem cells from both EF and SubQ depots exhibited reduced differentiation to adipocytes. These studies suggest that pyocyanin induces weight loss and

137

adipose cachexia through acute increases in inflammation and fat mobilization and reductions in stem cell adipocyte differentiation.

Chronically, pyocyanin resulted in significant weight and fat loss.

Pyocyanin largely affected the mass of visceral fat, with reductions in EF and

RPF tissue weight corresponding with an adipose-selective activation of AhR.

Interestingly, these chronic effects were not related to adipocyte differentiation, as ADSC from adipose tissue of mice administered pyocyanin exhibited normal adipocyte differentiation. Sustained adipose-selective activation of CYP1a1 two weeks after the final exposure suggests that, like other lipophilic AhR ligands, pyocyanin may be sequestered in the adipocyte lipid droplet, permitting persistent activation of adipocyte AhR.

Furthermore, pyocyanin had sexually dimorphic effects on adipose tissue.

Females lost more weight than males, and ADSCs from females administered pyocyanin had increased expression of AhR and TNF- compared to controls, effects that persisted three weeks after the last pyocyanin injection. While

ADSCs from chronically-treated males had unaltered gene expression, pyocyanin augmented basal lipolysis of EF explants in these males. Therefore, chronic pyocyanin exposure induces weight loss and adipose cachexia with sexually dimorphic mechanisms, with stimulated lipolysis in males and increased adipocyte inflammation in females. These divergent mechanisms of cachexia may contribute to the sex differences observed in sepsis survival [15, 16].

Overall, our findings indicate pyocyanin can alter adipocyte differentiation in vitro and in vivo, promote lipolysis, and augment inflammation, contributing to

138

weight loss and adipose cachexia via sexually and temporally dimorphic mechanisms. Therefore, future research should focus on understanding these potentially AhR-mediated mechanisms in order to develop novel treatment strategies for cachexia following P. aeruginosa infection in sepsis as well as other disease states, including cystic fibrosis.

4.1.3 Pyocyanin’s effects on adipose tissue are partially mediated through AhR

In Chapter 2, we established that pyocyanin, a Pseudomonas aeruginosa virulence factor, can activate adipocyte AhR in vitro and in vivo. The adipose- selective activation following pyocyanin treatment indicated a role of pyocyanin in adipose cachexia. Male and female C57BL/6J mice chronically exposed to pyocyanin lost body weight and fat mass with augmentations in lipolysis and inflammation. The studies in chapter 3 attempted to elucidate the mechanism of pyocyanin’s role in adipose cachexia, which we believed to be mediated through adipocyte AhR. To address pyocyanin’s mechanism of action on the adipocyte, we utilized in vitro and in vivo methods of interfering with the actions of adipocyte

AhR.

Pyocyanin was shown to activate AhR and CYP1a1 and reduce adipocyte differentiation in 3T3-L1 cells in Chapter 2. To determine if these effects occurred through adipocyte AhR, we utilized AhR antagonists to block pyocyanin’s binding to the receptor. Cells were pretreated with -NF (20 μM), TMF (20 μM), or CH-

223191 (10 μM) prior to exposure to 100M pyocyanin. None of the AhR antagonists blocked pyocyanin’s ability to reduce adipocyte differentiation.

However, CH-223191 did prevent pyocyanin’s induction of CYP1a1 mRNA

139

abundance. Interestingly, -NF pretreatment with pyocyanin resulted in a robust synergistic activation of CYP1a1 mRNA abundance. Synergistic activation of

CYP1a1 has been previously demonstrated in zebrafish embryos co-treated with

-NF and 6-Formylindolo[3,2-b]carbazole (FICZ), a potent AhR agonist [394].

The synergistic effect between pyocyanin and -NF could be explained by (1) partial agonism by -NF and (2) reduced metabolism of pyocyanin. Previous studies have reported partial agonist activity of -NF and TMF [261, 262], which are supported by results from our studies. Alternatively, inhibition of CYP1a1 by

-NF in zebrafish embryos has been shown to increase the half-life and levels of

FICZ by preventing its metabolism [394]. Therefore, by blocking metabolism of pyocyanin through CYP1 enzymes, -NF could maintain elevated in vitro concentrations of pyocyanin, resulting in continued AhR activation and CYP1a1 transcription.

CH-223191 attenuated CYP1a1 activation by both pyocyanin and the potent AhR agonist TCDD. However, CH-223191 has been demonstrated to selectively antagonize halogenated aromatic hydrocarbons but not polycyclic aromatic hydrocarbons, flavonoids, and indirubin [265]. Unlike TCDD, which contains chloride atoms, pyocyanin is not halogenated; therefore, CH-223191 may not effectively inhibit pyocyanin’s actions on the adipocyte due to its structure. These studies suggest that pyocyanin is an adipocyte AhR agonist, but its effect to reduce adipocyte differentiation does not appear to be AhR-mediated.

However, pyocyanin is likely a weak AhR agonist, and the partial agonism by many of the available AhR antagonists complicates the interpretation of the in

140

vitro findings. Future studies should test methods of antagonizing AhR other than competitive inhibition, including siRNA and isolating stromal vascular cells harvested from AhR knockout mice, to fully understand pyocyanin’s mechanism of action. If the cachexia induced by pyocyanin is not AhR-mediated, other mechanisms, such as the production of reactive oxygen species, will be explored as described below in the future directions.

To determine if pyocyanin’s effects on weight loss, fat loss, lipolysis, and inflammation occur through AhR, we repeated the chronic exposure studies from

Chapter 2 in a mouse model of adipocyte-specific deficiency of AhR. Although pyocyanin’s in vitro effect on adipocyte differentiation does not appear to be AhR- mediated, adipocyte differentiation was not a major contributor to pyocyanin- induced adipose cachexia of Chapter 2. We hypothesized that pyocyanin’s ability to reduce body weight and fat mass and increase adipose explant lipolysis in vivo is AhR-mediated and would be attenuated in mice lacking AhR in adipocytes

(AhRAdQ) as compared to their floxed littermate controls (AhRfl/fl).

In males, deficiency of adipocyte AhR diminished the amount of weight lost following chronic pyocyanin exposure, indicating a partial effect of adipocyte

AhR to regulate pyocyanin’s effect on body weight. This weight loss was not healthy, as no improvements in glucose tolerance were observed in the pyocyanin-treated mice experiencing weight loss. Moreover, pyocyanin’s adipose-selective activation of CYP1a1 was blocked in AhRAdQ males.

On the other hand, AhR deficiency in female mice potentiated pyocyanin’s effect to initiate weight loss. Pyocyanin stimulated lipolysis of adipose explants in

141

tissues from AhRfl/fl females, which was mitigated in AhRAdQ females, indicating that adipocyte AhR mediates pyocyanin’s effect on lipolysis. Despite this effect to reduce lipolysis, AhRAdQ females lost more weight than their floxed littermate controls, demonstrating another mechanism contributes to pyocyanin’s effect on weight loss. The effects of pyocyanin described in Chapter 2, including an acute reduction of RER and chronic induction of inflammation and AhR activation in

ADSCs from pyocyanin-treated females, could contribute to this weight loss in

AhRAdQ females. Moreover, oxidative stress contributes to cachexia [392, 393], and pyocyanin’s production of reactive oxygen species may lead to weight loss independent of receptor activation.

These results suggest that while pyocyanin is an AhR ligand capable of activating CYP1a1 in an adipose-selective manner, its role in cachexia is not entirely mediated through adipocyte AhR. Although AhR deficiency protects males from weight loss and females from increased lipolysis, pyocyanin is still able to exert effects on cachexia in the absence of adipocyte AhR in both sexes.

4.2 Limitations of the present study

The results of this dissertation suggest that while pyocyanin is an AhR ligand capable of activating CYP1a1 in an adipose-selective manner, its role in cachexia is not entirely mediated through adipocyte AhR. Although adipocyte

AhR appears to partially mediate weight loss and lipolysis, pyocyanin is still able to exert effects on cachexia in the absence of adipocyte AhR in both sexes.

Oxidative stress is a known mechanism of cachexia [392, 393]. Therefore,

142

pyocyanin’s other physiological effects, namely its ability to produce reactive oxygen species, could contribute to the weight loss and fat wasting observed in these studies. The lack of measurements for oxidative stress, inflammasome activation, and apoptosis is a limitation of these studies. Such measurements, described below in the future directions, would allow a more complete understanding of pyocyanin’s mechanism of adipose cachexia.

Additionally, the study of adipose cachexia is complicated by the obesity paradox, in which fat mass offers protection against sepsis [186-188]. If pyocyanin behaves similarly to other lipophilic, aromatic AhR ligands, pyocyanin could be sequestered in adipose tissue [52]. Increased adiposity could lead to greater adipose burden of pyocyanin in close proximity to adipocyte AhR. In cachexia, pyocyanin could be liberated from adipose tissue to exert systemic effects, similar to the mechanism observed with PCB-77 upon weight loss [52]. In consideration of these important roles of fat mass, it might have been more beneficial to match mice across study, strain, and sex for fat mass (as a percent of body weight) as opposed to age.

Any therapeutics created to target pyocyanin’s actions on the adipocyte will only be efficacious in treating septic patients with P. aeruginosa infection, as this is the only bacterium to produce pyocyanin. Therefore, pyocyanin is unlikely to play a role in sepsis originated from other types of infection, such as E. coli.

However, P. aeruginosa infection is also incredibly prevalent in cystic fibrosis patients, with 80% of cystic fibrosis patients colonized with the bacteria [395]. For this reason, much of the literature on pyocyanin focuses on its effects in the lung.

143

Cystic fibrosis patients also suffer from weight loss and wasting [396-398]; therefore, these findings could be applied to cystic fibrosis patients infected with

P. aeruginosa who are losing weight. In fact, understanding pyocyanin’s mechanisms in the regulation of body weight and lipid homeostasis would have clinical relevance for many disease states associated with P. aeruginosa infection.

Variations in AhR Responsiveness

Interpreting pyocyanin’s mechanism is complicated by different effects across length of exposure, sex, and strain, which could be explained by variations in AhR responsiveness. Response to AhR ligands is widely variable between species and within strains of the same species [399-402]. These variations in response can be partially explained by allelic differences in the AhR gene, with high- and low-affinity alleles producing a 10-fold difference in AhR ligand binding affinity and CYP1a1 expression levels [382, 383]. Unpublished studies in our lab have previously indicated differential induction of CYP1a1 expression by PCB-77 between male C57BL/6J and AhRfl/fl mice on a C57BL/6J background. Analysis of the AhR alleles present in each animal colony is necessary for appropriate comparisons across these strains.

Sex differences in AhR response to ligands have been described by our laboratory [403] and others [378-380]. In rats, females are more sensitive to

TCDD toxicity than males [400]. On the other hand, in C57BL/6J mice, males have been shown to be the more sensitive sex to TCDD-induced toxicities [379,

144

404]. Interestingly, in male and female mice treated with TCDD, females had relatively higher expression of CYP1a1 [379] despite previous studies indicating that CYP1a1 may be repressed by estrogen receptor  (ER) [405]. In these studies, there was a sexually dimorphic effect on the time at which maximal response to TCDD occurred, with the female response occurring earlier than the male’s [379]. Moreover, mice exhibit sexually dimorphic TCDD wasting, as males lose more weight and possess greater inflammatory cytokine expression than females exposed to the same dose of TCDD [400]. This can be partially explained by the effect of sex hormones on sensitivity to AhR ligands, with estrogen providing resistance against TCDD and testosterone augmenting sensitivity to TCDD toxicity [404]. The variation in the magnitude and timing of

AhR responsiveness between strains and between sexes provides context for the divergent effects seen in the acute and chronic studies of Chapter 2 as well as between sexes and mouse strains in both chapters.

Inhibition of AhR

Elucidating if pyocyanin’s effects are mediated through AhR has proven difficult due to problematic methods of inhibiting AhR activity. We used three different AhR antagonists to understand the role of AhR in pyocyanin’s in vitro effects on adipocytes because several antagonists, including -NF and TMF, have partial agonist activity [261, 262]. Indeed, partial agonist activity was evident in our results, as both of these antagonists increased CYP1a1 mRNA abundance when incubated alone with 3T3-L1 cells. Interestingly, treatment with

145

-NF and pyocyanin resulted in a synergistic activation of CYP1a1. Studies have previously reported synergistic CYP1a1 activation following co-treatment with -

NF and AhR ligands [394, 406, 407]. This synergism could result from partial

AhR agonism by -NF coupled with CYP1 enzyme inhibition by -NF leading to increased concentrations of AhR ligands as a result of reduced metabolism [394,

406, 407]. Depending on the concentration, -NF is able to either antagonize

AhR or activate the receptor by weak agonism or negative feedback from CYP1 inhibition [394].

In contrast, CH-223191, considered to be a competitive AhR antagonist

[263-265] without partial agonist activity, was able to block pyocyanin’s induction of CYP1a1. However, CH-223191, as well as TMF, have been shown to selectively antagonize halogenated aromatic hydrocarbons (HAHs), such as

TCDD, PCB77, and PCB126, but not polycyclic aromatic hydrocarbons (PAHs), flavonoids, or indirubin [265]. Although pyocyanin is aromatic, it lacks halogen atoms; therefore, these antagonists may be less effective at blocking all of the actions of pyocyanin mediated through AhR. This structural selectivity could explain why CH-223191 was able to attenuate pyocyanin’s induction of CYP1a1 but not its reduction of adipocyte differentiation. Further, antagonists that may work on a strong agonist such as TCDD may not be as effective on weak agonists, such as pyocyanin. Future studies should implement other methods of interrogating AhR, including siRNA, to test the ability to antagonize pyocyanin’s effects. Furthermore, similar to the adipose derived stem cells used in Chapter 2, stromal vascular cells from AhR knockout mice could be harvested and treated

146

with pyocyanin during differentiation. However, this method is problematic due to potential role of endogenous AhR in adipocyte differentiation [219, 225].

4.3 Future directions and conclusions

The studies described in this dissertation are the first to investigate pyocyanin’s ability to activate AhR on adipocytes as well as its putative role in cachexia resulting from P. aeruginosa infection. Because P. aeruginosa is a leading cause of sepsis, and septic cachexia currently lacks an efficacious treatment, it is important to understand the contribution of pyocyanin to adipose wasting and its mechanisms of action. Characterizing pyocyanin’s physiological effects on adipose tissue are not only critical for understanding adipose cachexia, but also allow for the development of novel therapeutic strategies for treating cachexia and improving outcomes in critically ill patients.

Several questions remain to fully understand pyocyanin’s mechanism of action to regulate body weight, fat mass, and potentially septic cachexia. First, the physiological effects of pyocyanin are not completely understood, and the toxicity of this compound is unknown. Although trypan blue staining of pyocyanin- treated 3T3-L1 cells was normal, the ability of pyocyanin to initiate apoptosis in adipocytes is unknown.

Second, more information is needed on pyocyanin binding to AhR and subsequent metabolism. Previous studies in liver cytosolic fractions determined the inhibition constant (Ki) of pyocyanin was 5.4M compared to a Ki of 40nM for

TCDD [270]. Understanding pyocyanin’s ability to bind AhR is further complicated

147

by the fact that the three-dimensional structure of AhR remains unknown. Studies have suggested pyocyanin is metabolized by AhR [270], but the metabolism of pyocyanin remains to be elucidated, and this dissertation is the first report of pyocyanin metabolites in vivo. These metabolites may be biologically active and could act at AhR, at another receptor, or through non-receptor mediated mechanisms, such as the production of reactive oxygen species. Furthermore, detection of pyocyanin in adipose tissue suggests the virulence factor may be sequestered between lipids in the triacylglycerol droplets of adipocytes, similar to other AhR agonists [52]. If pyocyanin accumulates in adipose tissue, cachexia and weight loss could release the virulence factor into systemic circulation, allowing action at a distinct receptor. This liberation of pyocyanin from adipose tissue could explain the sensitization effect of pyocyanin, where greater effects are observed upon second injection.

This dissertation reveals a potential pathophysiologically relevant role of pyocyanin in weight loss, adipose wasting, and inflammation that could contribute to cachexia following infection with P. aeruginosa. However, future studies are needed to more fully identify a role for pyocyanin as a cachexia-inducing, bacterial-derived virulence factor. Future directions could compare the levels of pyocyanin quantified in plasma and adipose tissue within this study to levels that are observed either systemically or in adipose tissue during infection with P. aeruginosa. These comparisons would facilitate an understanding of the pathophysiological relevance of the findings of this dissertation as well as inform

148

the dose and frequency of pyocyanin exposure in future experimental studies aimed at elucidating mechanisms of pyocyanin.

Furthermore, it is important to understand the pharmacodynamics and pharmacokinetics of pyocyanin, as there is limited information on the compound.

For example, it is suggested to harvest plasma from exposed animals at time points earlier than 24-hours, as implemented in the acute study in Chapter 2.

Collecting plasma at these earlier timepoints would allow the use of metabolomic analyses to determine metabolism of pyocyanin in the blood, similar to the methods used on urine that was collected one-hour post-injection. Sub- mandibular bleeds would permit collection of blood at several time points after pyocyanin injection. Coupled with urine collection, metabolomic analyses on these samples would yield a more complete understanding of pyocyanin’s metabolism and excretion, which is poorly understood but has important implications in understanding the pharmacodynamics of the compound.

Additionally, use of a HemaVet hematology system would permit analysis of the white blood cell counts of pyocyanin-exposed mice, complementing the plasma inflammatory cytokine panel performed in Chapter 2.

Pyocyanin’s effect on adipose tissue warrants future study to develop a more comprehensive understanding of the virulence factor’s role in adipose cachexia. We previously demonstrated a role of endogenous ligands of AhR to regulate body weight and adipocyte size [247]; furthermore, reduced adipocyte size is reported in cachexia [136, 142, 143]. Therefore, adipose tissue samples taken from pyocyanin-treated mice in these studies should be sectioned and

149

adipocyte size quantified. Given pyocyanin’s effect to induce loss of body weight and fat mass, we would anticipate smaller adipocyte size in pyocyanin-treated animals.

Furthermore, this dissertation describes the first studies examining levels and effects of pyocyanin in adipose tissue, revealing a novel area of study within the field of cachexia, sepsis, and P. aeruginosa infection. RNA sequencing and microarrays for inflammation lipid metabolism in adipose tissue on samples from pyocyanin-treated animals would yield a wealth of information. Due to pyocyanin’s ability to increase ROS [331], future studies should quantify levels of superoxide and hydrogen peroxide, as well as the activity of superoxide dismutase (SOD) and catalase (CAT), and glutathione peroxidase (GSH).

Studies have also identified malondialdehyde (MDA) as a marker of oxidative stress following intranasal administration of pyocyanin [321]. Additionally, the

NLRP3 inflammasome has been indicated as a mechanism of adipose cachexia in sepsis and burns [195, 408]. Pyocyanin has been shown to inhibit the NLRP3 inflammasome in macrophages [334]. However, pyocyanin’s influence on the inflammasome in vivo has not been studied. Future studies should investigate adipose NLRP3 inflammasome activation following pyocyanin exposure.

Another novel area of study is the impact of pyocyanin on the gut microbiome. Previous studies have demonstrated pyocyanin’s antibiotic and antifungal properties [310, 315, 322, 324]. Therefore, if pyocyanin reaches the intestines during P. aeruginosa infection, it could impact the microbiome by killing off beneficial gut bacteria. The intraperitoneal injection utilized in the animal

150

model of cachexia in these studies could expose the gut microbiome to pyocyanin. Alternative methods of exposure, such as oral gavage, could introduce pyocyanin to the digestive tract. If patients infected with P. aeruginosa are exposed to pyocyanin in their intestines, which is plausible given its detection in plasma, adipose, and urine, changes in gut microbiota could impact cachexia and outcomes of septic patients. Studies have demonstrated the ability of AhR ligands, including PCB-126, to increase intestinal inflammation and disrupt the gut microbiome by reducing bacterial diversity and altering gut metabolites [409,

410]. Gut microbiota, which modulate the innate and adaptive immune system and maintain gut-barrier function, are disrupted by sepsis to become a

“pathobiome” characterized by colonization of deleterious and opportunistic bacteria [411, 412]. Treatments targeting the microbiome have demonstrated protection against gut-derived sepsis by P. aeruginosa [413]. Therefore, a clear link exists between gut bacteria and bacterial sepsis. Furthermore, cachexia has recently been linked to changes in the microbiome. Leukemic cancer cachexia has been shown to negatively impact the gut microbiome even when the cancer occurs outside of the intestines [414]. The gut microbiome has been identified as a new therapeutic target for muscle wasting [414-416]; however, the connection between adipose wasting and the microbiome remains to be explored.

Moreover, we propose more rigorous methods of studying pyocyanin’s effects in the context of P. aeruginosa infection. P. aeruginosa is the only bacterium known to produce pyocyanin. However, there are several mutant strains that either over-produce, under-produce, or lack production of pyocyanin.

151

Moreover, the P. aeruginosa PA14 strains 09480 (increased production of all phenazines) and phn1/2 (no production of any phenazines) [270] could be used to distinguish the effect of all P. aeruginosa phenazines versus that of pyocyanin alone. The phzM mutant strain of P. aeruginosa contains a mutation in the phenazine biosynthesis gene phzM required for pyocyanin production; therefore, phzM mutants have nondetectable pyocyanin production [417] and will enable distinction between pyocyanin-dependent versus independent effects of bacterial sepsis to regulate adipose tissue mass, inflammation, and body weight.

Initial pilot studies would determine the optimal number of P. aeruginosa colony-forming units (CFUs) for IP injection to induce mid-grade sepsis associated with reductions in body weight and fat mass (similar to results administering pyocyanin alone). We would continue to utilize IP injection to induce sepsis because other methods, such as CLP, induce polymicrobial sepsis, and the presence of many other pathogenic bacteria would confound the study of the effects of P. aeruginosa and pyocyanin. This study design would elucidate the impact of pyocyanin in the context of P. aeruginosa infection as opposed to in isolation, as in the present studies. These studies would define the relative contribution of pyocyanin to adipose septic cachexia induced by P. aeruginosa and determine if these effects are AhR-mediated.

To define the role of adipocyte AhR in the effects of pyocyanin, we would use AhRfl/fl and AhRAdQ mice. Male and female mice of each genotype would receive intraperitoneal (IP) injection of vehicle, pyocyanin alone, wild type (WT)

P. aeruginosa, phzM mutant P. aeruginosa, or phzM mutant P. aeruginosa +

152

pyocyanin to induce sepsis. Additionally, we anticipate that IP injection of bacteria producing pyocyanin (WT P. aeruginosa, phzM mutant P. aeruginosa + pyocyanin, and pyocyanin alone) to AhRfl/fl mice would activate AhR in adipocytes, contributing to reductions in body weight and fat mass associated with increased inflammation in adipose tissue. If these effects of pyocyanin are

AhR-mediated, then they would be attenuated in AhRAdQ mice. Conversely, if an increase in inflammation is seen in AhRAdQ mice following sepsis and pyocyanin injection, this could be due to the detoxifying capabilities of AhR. This interesting result would suggest that adipocyte AhR contributes to clearance and degradation of pyocyanin through hydroxylation and excretion.

If pyocyanin’s effects are not mediated through adipocyte AhR, the whole body AhR knockout (KO) mouse model could be used to further study pyocyanin’s actions. Previous studies have investigated P. aeruginosa infection in whole body AhR KO mice and found that AhR KO mice are more susceptible to P. aeruginosa infection, which was believed to be linked to reduced clearance of pyocyanin [270]. However, body weight and fat mass changes were not quantified in this study, and pyocyanin itself has not been studied in whole body

AhR knockout mice.

The ultimate goal of the work presented in this dissertation is to discover novel interventions for the treatment of sepsis and adipose cachexia. As previously discussed, there is currently no FDA-approved medication for the treatment of sepsis or cachexia. Furthermore, due to growing rates of antibiotic resistance in sepsis-causing bacteria, new treatment strategies should aim to

153

target other pathways of infection, including compounds released by bacteria, such as pyocyanin, that mediate inflammation and cachexia. Of particular interest are nutrition therapies due to the lack of current efficacious nutritional approaches to preventing weight loss and fat loss in critically ill patients. If pyocyanin’s effects on adipose cachexia are AhR-mediated, AhR antagonists, such as resveratrol, could be used as a nutritional intervention. The plant polyphenol resveratrol is an AhR antagonist capable of attenuating the toxic effects of AhR ligands [418-420]. Previous studies in our laboratory have demonstrated resveratrol’s ability to protect against PCB-77 impairment of glucose homeostasis by improving insulin signaling in adipose tissue [418].

However, interventions that inhibit the CYP1 enzymes could inhibit the metabolism and excretion of pyocyanin, permitting its toxic effects to persist.

If pyocyanin’s effects are not AhR-mediated, alternative studies could elucidate dietary therapeutics to alleviate septic cachexia, such as omega-3 fatty acids, probiotics, and antioxidants. Omega-3 polyunsaturated fatty acids have been studied as a treatment for cachexia to promote weight gain and prevent wasting. Furthermore, omega-3s have been studied in the context of P. aeruginosa infection, and studies have found omega-3s can modulate inflammation and increase survival in chronic pneumonia [421, 422]. Additionally, therapeutics targeting the microbiome could prove efficacious for the treatment of septic cachexia. Oral administration of probiotic Bifidobacterium longum to mice prevented against gut-derived sepsis by P. aeruginosa [413]. Synbiotics, a combination of probiotic bacteria and prebiotic fiber, have been demonstrated to

154

improve intestinal homeostasis in leukemic mice with cachexia [414]. A combination of Lactobacillus reuteri and inulin improved the gut microbial ecosystem, reduced hepatic cancer cell proliferation and muscle wasting, improved cachexia, and prolonged survival in mouse models of cancer cachexia

[414]. Lactobacillus reuteri alone was also found to reduce systemic inflammation and muscle wasting in murine cachexia [416]. These effects of probiotics on cachexia, while promising, have focused solely on muscle wasting. Therefore, the study of probiotic interventions in adipose wasting represents a gap in the current literature that portends therapeutic benefits for cachectic patients.

Lastly, studies have suggested the use of antioxidant co-therapy in sepsis due to the contribution of oxidative stress to sepsis pathogenesis, namely augmented inflammation, increased risk of shock, and organ failure [352].

Retrospective clinical studies in septic patients revealed a protective effect of vitamin C against organ dysfunction and risk of shock and mortality [423].

Moreover, antioxidants have emerged as a promising therapeutic strategy in cancer cachexia [424]. Given the multifactorial nature of cachexia, combination treatment strategies are the most promising. In fact, a combination of omega-3 fatty acids, polyphenol-rich diet, and antioxidants in cancer patients with cachexia was shown to increase lean body mass, reduce ROS, IL-6, and TNF-α, and improve quality of life in a phase II nonrandomized study [425].

In conclusion, this dissertation demonstrates the in vitro and in vivo effects of pyocyanin to activate adipocyte AhR and contribute to adipose wasting and cachexia. These studies expand the scope of current knowledge of sepsis and

155

cachexia by describing the role of a sepsis-causing bacterial virulence factor on adipocyte differentiation, lipolysis, inflammation, weight loss, and adipose wasting. Taken together, these data suggest that pyocyanin exerts effects both through adipocyte AhR and independently of the receptor. These findings reveal novel targets for the treatment of cachexia, which could reduce sepsis mortality and improve outcomes in patients infected with P. aeruginosa.

156

References

1. Singer, M., et al., The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA, 2016. 315(8): p. 801-10.

2. Vincent, J.L., et al., The SOFA (Sepsis-related Organ Failure Assessment) score to describe organ dysfunction/failure. On behalf of the Working Group on Sepsis-Related Problems of the European Society of Intensive Care Medicine. Intensive Care Med, 1996. 22(7): p. 707-10.

3. Levy, M.M., et al., 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference. Intensive Care Med, 2003. 29(4): p. 530-8.

4. Malbrain, M., et al., Principles of fluid management and stewardship in septic shock: it is time to consider the four D's and the four phases of fluid therapy. Ann Intensive Care, 2018. 8(1): p. 66.

5. Cuthbertson, D.P., M.A. Angeles Valero Zanuy, and M.L. Leon Sanz, Post-shock metabolic response. 1942. Nutr Hosp, 2001. 16(5): p. 176-82; discussion 175-6.

6. Hotchkiss, R.S., G. Monneret, and D. Payen, Sepsis-induced immunosuppression: from cellular dysfunctions to immunotherapy. Nat Rev Immunol, 2013. 13(12): p. 862-74.

7. Angus, D.C. and T. van der Poll, Severe sepsis and septic shock. N Engl J Med, 2013. 369(21): p. 2063.

8. Wiersinga, W.J., et al., Host innate immune responses to sepsis. Virulence, 2014. 5(1): p. 36-44.

9. Bone, R.C., et al., Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest, 1992. 101(6): p. 1644-55.

10. Iskander, K.N., et al., Sepsis: multiple abnormalities, heterogeneous responses, and evolving understanding. Physiol Rev, 2013. 93(3): p. 1247-88.

11. Rhee, C. and M. Klompas, New Sepsis and Septic Shock Definitions: Clinical Implications and Controversies. Infect Dis Clin North Am, 2017. 31(3): p. 397-413.

12. Gul, F., et al., Changing Definitions of Sepsis. Turk J Anaesthesiol Reanim, 2017. 45(3): p. 129-138.

157

13. Sprung, C.L., R.M. Schein, and R.A. Balk, The new sepsis consensus definitions: the good, the bad and the ugly. Intensive Care Med, 2016. 42(12): p. 2024-2026.

14. Fleischmann, C., et al., Assessment of Global Incidence and Mortality of Hospital-treated Sepsis. Current Estimates and Limitations. Am J Respir Crit Care Med, 2016. 193(3): p. 259-72.

15. Rhee, C., et al., Incidence and Trends of Sepsis in US Hospitals Using Clinical vs Claims Data, 2009-2014. JAMA, 2017. 318(13): p. 1241-1249.

16. Martin, G.S., et al., The epidemiology of sepsis in the United States from 1979 through 2000. N Engl J Med, 2003. 348(16): p. 1546-54.

17. Walkey, A.J., T. Lagu, and P.K. Lindenauer, Trends in sepsis and infection sources in the United States. A population-based study. Ann Am Thorac Soc, 2015. 12(2): p. 216-20.

18. Yeh, R.W., et al., Population trends in the incidence and outcomes of acute myocardial infarction. N Engl J Med, 2010. 362(23): p. 2155-65.

19. Siegel, R.L., K.D. Miller, and A. Jemal, Cancer statistics, 2018. CA Cancer J Clin, 2018. 68(1): p. 7-30.

20. Website, C.f.D.C.a.P. Data and Reports. 2018 [cited 2019 January 21]; Available from: https://www.cdc.gov/sepsis/datareports/index.html.

21. Vincent, J.L., et al., Assessment of the worldwide burden of critical illness: the intensive care over nations (ICON) audit. Lancet Respir Med, 2014. 2(5): p. 380-6.

22. Epstein, L., et al., Varying Estimates of Sepsis Mortality Using Death Certificates and Administrative Codes--United States, 1999-2014. MMWR Morb Mortal Wkly Rep, 2016. 65(13): p. 342-5.

23. Danna, D.M., Hospital Costs Associated with Sepsis Compared with Other Medical Conditions. Crit Care Nurs Clin North Am, 2018. 30(3): p. 389- 398.

24. Torio, C.M. and R.M. Andrews, National Inpatient Hospital Costs: The Most Expensive Conditions by Payer, 2011: Statistical Brief #160, in Healthcare Cost and Utilization Project (HCUP) Statistical Briefs. 2006: Rockville (MD).

25. Angus, D.C., et al., Epidemiology of severe sepsis in the United States: analysis of incidence, outcome, and associated costs of care. Crit Care Med, 2001. 29(7): p. 1303-10.

158

26. Chalfin, D.B., et al., Cost-effectiveness of monoclonal antibodies to gram- negative endotoxin in the treatment of gram-negative sepsis in ICU patients. JAMA, 1993. 269(2): p. 249-54.

27. Hsieh, Y.C., et al., Metabolic modulators following trauma sepsis: sex hormones. Crit Care Med, 2007. 35(9 Suppl): p. S621-9.

28. Annane, D., et al., Current epidemiology of septic shock: the CUB-Rea Network. Am J Respir Crit Care Med, 2003. 168(2): p. 165-72.

29. (UK), N.G.C., Sepsis: Recognition, Assessment and Early Management . 2016: London.

30. Ranieri, V.M., et al., Drotrecogin alfa (activated) in adults with septic shock. N Engl J Med, 2012. 366(22): p. 2055-64.

31. Opal, S.M., et al., Systemic host responses in severe sepsis analyzed by causative microorganism and treatment effects of drotrecogin alfa (activated). Clin Infect Dis, 2003. 37(1): p. 50-8.

32. Akira, S., S. Uematsu, and O. Takeuchi, Pathogen recognition and innate immunity. Cell, 2006. 124(4): p. 783-801.

33. Armstrong, L., et al., Differential expression of Toll-like receptor (TLR)-2 and TLR-4 on monocytes in human sepsis. Clin Exp Immunol, 2004. 136(2): p. 312-9.

34. Harter, L., et al., Increased expression of toll-like receptor-2 and -4 on leukocytes from patients with sepsis. Shock, 2004. 22(5): p. 403-9.

35. Ferrara, J.L., S. Abhyankar, and D.G. Gilliland, Cytokine storm of graft- versus-host disease: a critical effector role for interleukin-1. Transplant Proc, 1993. 25(1 Pt 2): p. 1216-7.

36. Dinarello, C.A., Historical insights into cytokines. Eur J Immunol, 2007. 37 Suppl 1: p. S34-45.

37. Couper, K.N., D.G. Blount, and E.M. Riley, IL-10: the master regulator of immunity to infection. J Immunol, 2008. 180(9): p. 5771-7.

38. Opal, S.M. and V.A. DePalo, Anti-inflammatory cytokines. Chest, 2000. 117(4): p. 1162-72.

39. Dorresteijn, M.J., et al., C1-esterase inhibitor attenuates the inflammatory response during human endotoxemia. Crit Care Med, 2010. 38(11): p. 2139-45.

159

40. Bahador, M. and A.S. Cross, From therapy to experimental model: a hundred years of endotoxin administration to human subjects. J Endotoxin Res, 2007. 13(5): p. 251-79.

41. van Deventer, S.J., et al., Experimental endotoxemia in humans: analysis of cytokine release and coagulation, fibrinolytic, and complement pathways. Blood, 1990. 76(12): p. 2520-6.

42. Chousterman, B.G., F.K. Swirski, and G.F. Weber, Cytokine storm and sepsis disease pathogenesis. Semin Immunopathol, 2017. 39(5): p. 517- 528.

43. Janeway, C.A., Jr. and R. Medzhitov, Innate immune recognition. Annu Rev Immunol, 2002. 20: p. 197-216.

44. Walton, A.H., et al., Reactivation of multiple viruses in patients with sepsis. PLoS One, 2014. 9(2): p. e98819.

45. Kollef, K.E., et al., Predictors of 30-day mortality and hospital costs in patients with ventilator-associated pneumonia attributed to potentially antibiotic-resistant gram-negative bacteria. Chest, 2008. 134(2): p. 281- 287.

46. Otto, G.P., et al., The late phase of sepsis is characterized by an increased microbiological burden and death rate. Crit Care, 2011. 15(4): p. R183.

47. Hotchkiss, R.S., et al., Sepsis and septic shock. Nat Rev Dis Primers, 2016. 2: p. 16045.

48. Hotchkiss, R.S., et al., Apoptotic cell death in patients with sepsis, shock, and multiple organ dysfunction. Crit Care Med, 1999. 27(7): p. 1230-51.

49. Hotchkiss, R.S., et al., Prevention of lymphocyte cell death in sepsis improves survival in mice. Proc Natl Acad Sci U S A, 1999. 96(25): p. 14541-6.

50. Gentile, L.F., et al., Persistent inflammation and immunosuppression: a common syndrome and new horizon for surgical intensive care. J Trauma Acute Care Surg, 2012. 72(6): p. 1491-501.

51. Hu, D., et al., Persistent inflammation-immunosuppression catabolism syndrome, a common manifestation of patients with enterocutaneous fistula in intensive care unit. J Trauma Acute Care Surg, 2014. 76(3): p. 725-9.

160

52. Vanzant, E.L., et al., Persistent inflammation, immunosuppression, and catabolism syndrome after severe blunt trauma. J Trauma Acute Care Surg, 2014. 76(1): p. 21-9; discussion 29-30.

53. Mira, J.C., et al., Sepsis Pathophysiology, Chronic Critical Illness and PICS. Crit Care Med, 2017. 45(2): p. 253-262.

54. Wisplinghoff, H., et al., Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis, 2004. 39(3): p. 309-17.

55. Giske, C.G., et al., Clinical and economic impact of common multidrug- resistant gram-negative bacilli. Antimicrob Agents Chemother, 2008. 52(3): p. 813-21.

56. Tumbarello, M., et al., Multidrug-resistant Pseudomonas aeruginosa bloodstream infections: risk factors and mortality. Epidemiol Infect, 2011. 139(11): p. 1740-9.

57. Watanabe, R., et al., Efficacy of bacteriophage therapy against gut- derived sepsis caused by Pseudomonas aeruginosa in mice. Antimicrob Agents Chemother, 2007. 51(2): p. 446-52.

58. Yin, X.H., H. Mikamo, and T. Tamaya, Nosocomial infectious potency of imipenem-resistant Pseudomonas aeruginosa isolated from obstetric and gynecologic infections. J Infect Chemother, 2003. 9(1): p. 97-100.

59. Ramphal, R., Changes in the etiology of bacteremia in febrile neutropenic patients and the susceptibilities of the currently isolated pathogens. Clin Infect Dis, 2004. 39 Suppl 1: p. S25-31.

60. Hirsch, E.B. and V.H. Tam, Impact of multidrug-resistant Pseudomonas aeruginosa infection on patient outcomes. Expert Rev Pharmacoecon Outcomes Res, 2010. 10(4): p. 441-51.

61. Morales, E., et al., Hospital costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition. BMC Health Serv Res, 2012. 12: p. 122.

62. Morrison, A.J., Jr. and R.P. Wenzel, Epidemiology of infections due to Pseudomonas aeruginosa. Rev Infect Dis, 1984. 6 Suppl 3: p. S627-42.

63. Stoodley, B.J. and B.T. Thom, Observations on the intestinal carriage of Pseudomonas aeruginosa. J Med Microbiol, 1970. 3(3): p. 367-75.

64. Ohara, T. and K. Itoh, Significance of Pseudomonas aeruginosa colonization of the gastrointestinal tract. Intern Med, 2003. 42(11): p. 1072-6.

161

65. Tatterson, L.E., et al., CFTR and pseudomonas infections in cystic fibrosis. Front Biosci, 2001. 6: p. D890-7.

66. Kraemer, R., et al., Relative underweight in cystic fibrosis and its prognostic value. Acta Paediatr Scand, 1978. 67(1): p. 33-7.

67. van Heeckeren, A.M., et al., Effect of Pseudomonas infection on weight loss, lung mechanics, and cytokines in mice. Am J Respir Crit Care Med, 2000. 161(1): p. 271-9.

68. Fick, R.B., Lung humoral response to Pseudomonas species. Eur J Clin Microbiol Infect Dis, 1989. 8(1): p. 29-34.

69. Hanley, M.E. and J.E. Repine, Elastase and oxygen radicals: synergistic interactions. Agents Actions Suppl, 1993. 42: p. 39-47.

70. Miller, R.A. and B.E. Britigan, The formation and biologic significance of phagocyte-derived oxidants. J Investig Med, 1995. 43(1): p. 39-49.

71. Driscoll, J.A., S.L. Brody, and M.H. Kollef, The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections. Drugs, 2007. 67(3): p. 351-68.

72. Pesci, E.C., et al., Quinolone signaling in the cell-to-cell communication system of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A, 1999. 96(20): p. 11229-34.

73. Mahajan-Miklos, S., et al., Molecular mechanisms of bacterial virulence elucidated using a Pseudomonas aeruginosa-Caenorhabditis elegans pathogenesis model. Cell, 1999. 96(1): p. 47-56.

74. Mavrodi, D.V., et al., Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J Bacteriol, 2001. 183(21): p. 6454-65.

75. Reyes, E.A., et al., Identification of Pseudomonas aeruginosa by pyocyanin production on Tech agar. J Clin Microbiol, 1981. 13(3): p. 456- 8.

76. Meyer, J.M., Pyoverdines: pigments, siderophores and potential taxonomic markers of fluorescent Pseudomonas species. Arch Microbiol, 2000. 174(3): p. 135-42.

77. Oeyen, S.G., et al., Quality of life after intensive care: a systematic review of the literature. Crit Care Med, 2010. 38(12): p. 2386-400.

162

78. Needham, D.M., D.R. Feldman, and M.E. Kho, The functional costs of ICU survivorship. Collaborating to improve post-ICU disability. Am J Respir Crit Care Med, 2011. 183(8): p. 962-4.

79. Kahn, J.M., et al., The epidemiology of chronic critical illness in the United States*. Crit Care Med, 2015. 43(2): p. 282-7.

80. Kumar, A., et al., Initiation of inappropriate antimicrobial therapy results in a fivefold reduction of survival in human septic shock. Chest, 2009. 136(5): p. 1237-1248.

81. Zahar, J.R., et al., Outcomes in severe sepsis and patients with septic shock: pathogen species and infection sites are not associated with mortality. Crit Care Med, 2011. 39(8): p. 1886-95.

82. Kumar, A., et al., Early combination antibiotic therapy yields improved survival compared with monotherapy in septic shock: a propensity- matched analysis. Crit Care Med, 2010. 38(9): p. 1773-85.

83. Micek, S.T., et al., Empiric combination antibiotic therapy is associated with improved outcome against sepsis due to Gram-negative bacteria: a retrospective analysis. Antimicrob Agents Chemother, 2010. 54(5): p. 1742-8.

84. Vincent, J.L. and D. De Backer, Circulatory shock. N Engl J Med, 2014. 370(6): p. 583.

85. Rhodes, A., et al., Surviving Sepsis Campaign: International Guidelines for Management of Sepsis and Septic Shock: 2016. Intensive Care Med, 2017. 43(3): p. 304-377.

86. Avila, A.A., et al., The Use of Fluids in Sepsis. Cureus, 2016. 8(3): p. e528.

87. Weil, M.H. and H. Shubin, The "VIP" approach to the bedside management of shock. JAMA, 1969. 207(2): p. 337-40.

88. Alejandria, M.M., et al., Intravenous immunoglobulin for treating sepsis, severe sepsis and septic shock. Cochrane Database Syst Rev, 2013(9): p. CD001090.

89. Qiu, P., et al., The evolving experience with therapeutic TNF inhibition in sepsis: considering the potential influence of risk of death. Expert Opin Investig Drugs, 2011. 20(11): p. 1555-64.

90. Marshall, J.C., Why have clinical trials in sepsis failed? Trends Mol Med, 2014. 20(4): p. 195-203.

163

91. Buras, J.A., B. Holzmann, and M. Sitkovsky, Animal models of sepsis: setting the stage. Nat Rev Drug Discov, 2005. 4(10): p. 854-65.

92. Rittirsch, D., et al., Immunodesign of experimental sepsis by cecal ligation and puncture. Nat Protoc, 2009. 4(1): p. 31-6.

93. Fink, M.P., Animal models of sepsis. Virulence, 2014. 5(1): p. 143-53.

94. Kaneki, M., Metabolic Inflammatory Complex in Sepsis: Septic Cachexia as a Novel Potential Therapeutic Target. Shock, 2017.

95. Evans, W.J., et al., Cachexia: a new definition. Clin Nutr, 2008. 27(6): p. 793-9.

96. Vigano, A., et al., Quality of life and survival prediction in terminal cancer patients: a multicenter study. Cancer, 2004. 101(5): p. 1090-8.

97. Vigano, A., et al., Survival prediction in terminal cancer patients: a systematic review of the medical literature. Palliat Med, 2000. 14(5): p. 363-74.

98. Anker, S.D., W. Steinborn, and S. Strassburg, Cardiac cachexia. Ann Med, 2004. 36(7): p. 518-29.

99. Wheeler, D.A., et al., Weight loss as a predictor of survival and disease progression in HIV infection. Terry Beirn Community Programs for Clinical Research on AIDS. J Acquir Immune Defic Syndr Hum Retrovirol, 1998. 18(1): p. 80-5.

100. Tang, A.M., et al., Weight loss and survival in HIV-positive patients in the era of highly active antiretroviral therapy. J Acquir Immune Defic Syndr, 2002. 31(2): p. 230-6.

101. Sullivan, D.H., et al., Body weight change and mortality in a cohort of elderly patients recently discharged from the hospital. J Am Geriatr Soc, 2004. 52(10): p. 1696-701.

102. Pickering, W.P., et al., Nutrition in CAPD: serum bicarbonate and the ubiquitin-proteasome system in muscle. Kidney Int, 2002. 61(4): p. 1286- 92.

103. Argiles, J.M., et al., Cachexia: a problem of energetic inefficiency. J Cachexia Sarcopenia Muscle, 2014. 5(4): p. 279-86.

104. Costa, G., et al., Anorexia and weight loss in cancer patients. Cancer Treat Rep, 1981. 65 Suppl 5: p. 3-7.

164

105. Costa, G., Cachexia, the metabolic component of neoplastic diseases. Cancer Res, 1977. 37(7 Pt 2): p. 2327-35.

106. Evans, W.J. and C.P. Lambert, Physiological basis of fatigue. Am J Phys Med Rehabil, 2007. 86(1 Suppl): p. S29-46.

107. Callahan, L.A. and G.S. Supinski, Sepsis-induced myopathy. Crit Care Med, 2009. 37(10 Suppl): p. S354-67.

108. Schefold, J.C., J. Bierbrauer, and S. Weber-Carstens, Intensive care unit- acquired weakness (ICUAW) and muscle wasting in critically ill patients with severe sepsis and septic shock. J Cachexia Sarcopenia Muscle, 2010. 1(2): p. 147-157.

109. Hasselgren, P.O., et al., Total and myofibrillar protein breakdown in different types of rat skeletal muscle: effects of sepsis and regulation by insulin. Metabolism, 1989. 38(7): p. 634-40.

110. Long, C.L., et al., Urinary excretion of 3-methylhistidine: an assessment of muscle protein catabolism in adult normal subjects and during malnutrition, sepsis, and skeletal trauma. Metabolism, 1981. 30(8): p. 765- 76.

111. Cai, D., et al., IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell, 2004. 119(2): p. 285-98.

112. Hasselgren, P.O. and J.E. Fischer, Muscle cachexia: current concepts of intracellular mechanisms and molecular regulation. Ann Surg, 2001. 233(1): p. 9-17.

113. Hasselgren, P.O., et al., Novel aspects on the regulation of muscle wasting in sepsis. Int J Biochem Cell Biol, 2005. 37(10): p. 2156-68.

114. Stephens, N.A., et al., Sexual dimorphism modulates the impact of cancer cachexia on lower limb muscle mass and function. Clin Nutr, 2012. 31(4): p. 499-505.

115. Norman, K., et al., Effect of sexual dimorphism on muscle strength in cachexia. J Cachexia Sarcopenia Muscle, 2012. 3(2): p. 111-6.

116. Cohen, S., J.A. Nathan, and A.L. Goldberg, Muscle wasting in disease: molecular mechanisms and promising therapies. Nat Rev Drug Discov, 2015. 14(1): p. 58-74.

117. Byerley, L.O., et al., Evidence for a novel serum factor distinct from zinc alpha-2 glycoprotein that promotes body fat loss early in the development of cachexia. Nutr Cancer, 2010. 62(4): p. 484-94.

165

118. Das, S.K., et al., Adipose triglyceride lipase contributes to cancer- associated cachexia. Science, 2011. 333(6039): p. 233-8.

119. Kliewer, K.L., et al., Adipose tissue lipolysis and energy metabolism in early cancer cachexia in mice. Cancer Biol Ther, 2015. 16(6): p. 886-97.

120. Shaw, J.H. and R.R. Wolfe, Fatty acid and glycerol kinetics in septic patients and in patients with gastrointestinal cancer. The response to glucose infusion and parenteral feeding. Ann Surg, 1987. 205(4): p. 368- 76.

121. Klein, S. and R.R. Wolfe, Whole-body lipolysis and triglyceride-fatty acid cycling in cachectic patients with esophageal cancer. J Clin Invest, 1990. 86(5): p. 1403-8.

122. Zuijdgeest-van Leeuwen, S.D., et al., Lipolysis and lipid oxidation in weight-losing cancer patients and healthy subjects. Metabolism, 2000. 49(7): p. 931-6.

123. Agustsson, T., et al., Mechanism of increased lipolysis in cancer cachexia. Cancer Res, 2007. 67(11): p. 5531-7.

124. Ryden, M., et al., Lipolysis--not inflammation, cell death, or lipogenesis--is involved in adipose tissue loss in cancer cachexia. Cancer, 2008. 113(7): p. 1695-704.

125. Korber, J., et al., Increased lipid utilization in weight losing and weight stable cancer patients with normal body weight. Eur J Clin Nutr, 1999. 53(9): p. 740-5.

126. Dahlman, I., et al., Adipose tissue pathways involved in weight loss of cancer cachexia. Br J Cancer, 2010. 102(10): p. 1541-8.

127. Murphy, R.A., et al., Loss of adipose tissue and plasma phospholipids: relationship to survival in advanced cancer patients. Clin Nutr, 2010. 29(4): p. 482-7.

128. Dalal, S., et al., Relationships among body mass index, longitudinal body composition alterations, and survival in patients with locally advanced pancreatic cancer receiving chemoradiation: a pilot study. J Pain Symptom Manage, 2012. 44(2): p. 181-91.

129. Di Sebastiano, K.M., et al., Accelerated muscle and adipose tissue loss may predict survival in pancreatic cancer patients: the relationship with diabetes and anaemia. Br J Nutr, 2013. 109(2): p. 302-12.

166

130. Arruda, A.P., et al., Hypothalamic actions of tumor necrosis factor alpha provide the thermogenic core for the wastage syndrome in cachexia. Endocrinology, 2010. 151(2): p. 683-94.

131. Tsoli, M., et al., Activation of thermogenesis in brown adipose tissue and dysregulated lipid metabolism associated with cancer cachexia in mice. Cancer Res, 2012. 72(17): p. 4372-82.

132. Jaworski, K., et al., AdPLA ablation increases lipolysis and prevents obesity induced by high-fat feeding or leptin deficiency. Nat Med, 2009. 15(2): p. 159-68.

133. Ahmadian, M., et al., Adipose overexpression of desnutrin promotes fatty acid use and attenuates diet-induced obesity. Diabetes, 2009. 58(4): p. 855-66.

134. Bordicchia, M., et al., Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes. J Clin Invest, 2012. 122(3): p. 1022-36.

135. Petruzzelli, M., et al., A switch from white to brown fat increases energy expenditure in cancer-associated cachexia. Cell Metab, 2014. 20(3): p. 433-47.

136. Neves, R.X., et al., White adipose tissue cells and the progression of cachexia: inflammatory pathways. J Cachexia Sarcopenia Muscle, 2016. 7(2): p. 193-203.

137. Arner, P. and D. Langin, Lipolysis in lipid turnover, cancer cachexia, and obesity-induced insulin resistance. Trends Endocrinol Metab, 2014. 25(5): p. 255-62.

138. Ebadi, M. and V.C. Mazurak, Evidence and mechanisms of fat depletion in cancer. Nutrients, 2014. 6(11): p. 5280-97.

139. Bing, C., et al., Adipose atrophy in cancer cachexia: morphologic and molecular analysis of adipose tissue in tumour-bearing mice. Br J Cancer, 2006. 95(8): p. 1028-37.

140. Batista, M.L., Jr., et al., Heterogeneous time-dependent response of adipose tissue during the development of cancer cachexia. J Endocrinol, 2012. 215(3): p. 363-73.

141. Batista, M.L., Jr., et al., Cachexia-associated adipose tissue morphological rearrangement in gastrointestinal cancer patients. J Cachexia Sarcopenia Muscle, 2016. 7(1): p. 37-47.

167

142. Franco, F.O., et al., Cancer cachexia differentially regulates visceral adipose tissue turnover. J Endocrinol, 2017. 232(3): p. 493-500.

143. Batista, M.L., Jr., et al., Adipose tissue-derived factors as potential biomarkers in cachectic cancer patients. Cytokine, 2013. 61(2): p. 532-9.

144. Bertevello, P.S. and M.C. Seelaender, Heterogeneous response of adipose tissue to cancer cachexia. Braz J Med Biol Res, 2001. 34(9): p. 1161-7.

145. Nixon, D.W., et al., Resting energy expenditure in lung and colon cancer. Metabolism, 1988. 37(11): p. 1059-64.

146. Knox, L.S., et al., Energy expenditure in malnourished cancer patients. Ann Surg, 1983. 197(2): p. 152-62.

147. Lindmark, L., et al., Resting energy expenditure in malnourished patients with and without cancer. Gastroenterology, 1984. 87(2): p. 402-8.

148. Preiser, J.C., et al., Metabolic response to the stress of critical illness. Br J Anaesth, 2014. 113(6): p. 945-54.

149. Druml, W., G. Heinzel, and G. Kleinberger, Amino acid kinetics in patients with sepsis. Am J Clin Nutr, 2001. 73(5): p. 908-13.

150. Casaer, M.P. and T.R. Ziegler, Nutritional support in critical illness and recovery. Lancet Diabetes Endocrinol, 2015. 3(9): p. 734-45.

151. Holroyde, C.P., et al., Altered glucose metabolism in metastatic carcinoma. Cancer Res, 1975. 35(12): p. 3710-4.

152. Frayn, K.N., et al., Coordinated regulation of hormone-sensitive lipase and lipoprotein lipase in human adipose tissue in vivo: implications for the control of fat storage and fat mobilization. Adv Enzyme Regul, 1995. 35: p. 163-78.

153. Lafontan, M. and M. Berlan, Fat cell adrenergic receptors and the control of white and brown fat cell function. J Lipid Res, 1993. 34(7): p. 1057-91.

154. Ibrahim, M.M., Subcutaneous and visceral adipose tissue: structural and functional differences. Obes Rev, 2010. 11(1): p. 11-8.

155. Joyner, J.M., L.J. Hutley, and D.P. Cameron, Glucocorticoid receptors in human preadipocytes: regional and gender differences. J Endocrinol, 2000. 166(1): p. 145-52.

168

156. Rebuffe-Scrive, M., K. Lundholm, and P. Bjorntorp, Glucocorticoid hormone binding to human adipose tissue. Eur J Clin Invest, 1985. 15(5): p. 267-71.

157. Hellmer, J., et al., Mechanisms for differences in lipolysis between human subcutaneous and omental fat cells. J Clin Endocrinol Metab, 1992. 75(1): p. 15-20.

158. Arner, P., et al., Beta-adrenoceptor expression in human fat cells from different regions. J Clin Invest, 1990. 86(5): p. 1595-600.

159. Stoner, H.B., et al., The effect of sepsis on the oxidation of carbohydrate and fat. Br J Surg, 1983. 70(1): p. 32-5.

160. Nanni, G., et al., Increased lipid fuel dependence in the critically ill septic patient. J Trauma, 1984. 24(1): p. 14-30.

161. Askanazi, J., et al., Influence of total parenteral nutrition on fuel utilization in injury and sepsis. Ann Surg, 1980. 191(1): p. 40-6.

162. White, R.H., et al., Hormonal and metabolic responses to glucose infusion in sepsis studied by the hyperglycemic glucose clamp technique. JPEN J Parenter Enteral Nutr, 1987. 11(4): p. 345-53.

163. Levinson, M.R., et al., Free fatty acid turnover and lipolysis in septic mechanically ventilated cancer-bearing humans. Metabolism, 1988. 37(7): p. 618-25.

164. Pitkanen, O., et al., Nitrogen and energy balance in septic and injured intensive care patients: response to parenteral nutrition. Clin Nutr, 1991. 10(5): p. 258-65.

165. Gallin, J.I., D. Kaye, and W.M. O'Leary, Serum lipids in infection. N Engl J Med, 1969. 281(20): p. 1081-6.

166. Lefevre, G., et al., Individual free fatty acids and lactate uptake in the human heart during severe sepsis. Ann Clin Biochem, 1988. 25 ( Pt 5): p. 546-51.

167. Hauner, H., et al., Effects of tumour necrosis factor alpha (TNF alpha) on glucose transport and lipid metabolism of newly-differentiated human fat cells in cell culture. Diabetologia, 1995. 38(7): p. 764-71.

168. Tisdale, M.J., Cancer cachexia: metabolic alterations and clinical manifestations. Nutrition, 1997. 13(1): p. 1-7.

169. Benedict, C.R. and D.G. Grahame-Smith, Plasma noradrenaline and adrenaline concentrations and dopamine-beta-hydroxylase activity in

169

patients with shock due to septicaemia, trauma and haemorrhage. Q J Med, 1978. 47(185): p. 1-20.

170. Thiessen, S.E., et al., Role of Glucagon in Catabolism and Muscle Wasting of Critical Illness and Modulation by Nutrition. Am J Respir Crit Care Med, 2017. 196(9): p. 1131-1143.

171. Arner, P., Medicine. Lipases in cachexia. Science, 2011. 333(6039): p. 163-4.

172. Tappy, L. and R. Chiolero, Substrate utilization in sepsis and multiple organ failure. Crit Care Med, 2007. 35(9 Suppl): p. S531-4.

173. Levy, R.J., Mitochondrial dysfunction, bioenergetic impairment, and metabolic down-regulation in sepsis. Shock, 2007. 28(1): p. 24-8.

174. O'Neill, L.A. and E.J. Pearce, Immunometabolism governs dendritic cell and macrophage function. J Exp Med, 2016. 213(1): p. 15-23.

175. Kauppinen, A., et al., Antagonistic crosstalk between NF-kappaB and SIRT1 in the regulation of inflammation and metabolic disorders. Cell Signal, 2013. 25(10): p. 1939-48.

176. van Uden, P., N.S. Kenneth, and S. Rocha, Regulation of hypoxia- inducible factor-1alpha by NF-kappaB. Biochem J, 2008. 412(3): p. 477- 84.

177. D'Ignazio, L., D. Bandarra, and S. Rocha, NF-kappaB and HIF crosstalk in immune responses. FEBS J, 2016. 283(3): p. 413-24.

178. Haas, S.A., et al., Severe hyperlactatemia, lactate clearance and mortality in unselected critically ill patients. Intensive Care Med, 2016. 42(2): p. 202-10.

179. Levy, B., et al., Increased muscle-to-serum lactate gradient predicts progression towards septic shock in septic patients. Intensive Care Med, 2010. 36(10): p. 1703-9.

180. Fink, M.P., Bench-to-bedside review: Cytopathic hypoxia. Crit Care, 2002. 6(6): p. 491-9.

181. Williamson, J.R., et al., Hyperglycemic pseudohypoxia and diabetic complications. Diabetes, 1993. 42(6): p. 801-13.

182. Ilias, I., et al., Adipose Tissue Lactate Clearance but Not Blood Lactate Clearance Is Associated with Clinical Outcome in Sepsis or Septic Shock during the Post-Resuscitation Period. Metabolites, 2018. 8(2).

170

183. Abramson, D., et al., Lactate clearance and survival following injury. J Trauma, 1993. 35(4): p. 584-8; discussion 588-9.

184. Nguyen, H.B., et al., Early lactate clearance is associated with improved outcome in severe sepsis and septic shock. Crit Care Med, 2004. 32(8): p. 1637-42.

185. Calle, E.E., et al., Body-mass index and mortality in a prospective cohort of U.S. adults. N Engl J Med, 1999. 341(15): p. 1097-105.

186. Wurzinger, B., et al., The association between body-mass index and patient outcome in septic shock: a retrospective cohort study. Wien Klin Wochenschr, 2010. 122(1-2): p. 31-6.

187. Utzolino, S., et al., The obesity paradox in surgical intensive care patients with peritonitis. J Crit Care, 2014. 29(5): p. 887 e1-5.

188. Sakr, Y., et al., Being Overweight Is Associated With Greater Survival in ICU Patients: Results From the Intensive Care Over Nations Audit. Crit Care Med, 2015. 43(12): p. 2623-32.

189. Siegl, D., et al., Obesity-induced hyperleptinemia improves survival and immune response in a murine model of sepsis. Anesthesiology, 2014. 121(1): p. 98-114.

190. Goossens, C., et al., Premorbid obesity, but not nutrition, prevents critical illness-induced muscle wasting and weakness. J Cachexia Sarcopenia Muscle, 2017. 8(1): p. 89-101.

191. Lemieux, I., et al., Elevated C-reactive protein: another component of the atherothrombotic profile of abdominal obesity. Arterioscler Thromb Vasc Biol, 2001. 21(6): p. 961-7.

192. Pepys, M.B. and G.M. Hirschfield, C-reactive protein: a critical update. J Clin Invest, 2003. 111(12): p. 1805-12.

193. Curat, C.A., et al., Macrophages in human visceral adipose tissue: increased accumulation in obesity and a source of resistin and visfatin. Diabetologia, 2006. 49(4): p. 744-7.

194. Armellini, F., et al., Sonography detection of small intra-abdominal fat variations. Int J Obes, 1991. 15(12): p. 847-52.

195. Crowell, K.T., D.I. Soybel, and C.H. Lang, Inability to replete white adipose tissue during recovery phase of sepsis is associated with increased autophagy, apoptosis, and proteasome activity. Am J Physiol Regul Integr Comp Physiol, 2017. 312(3): p. R388-R399.

171

196. Wellhoener, P., et al., Metabolic alterations in adipose tissue during the early phase of experimental endotoxemia in humans. Horm Metab Res, 2011. 43(11): p. 754-9.

197. Haran, P.H., D.A. Rivas, and R.A. Fielding, Role and potential mechanisms of anabolic resistance in sarcopenia. J Cachexia Sarcopenia Muscle, 2012. 3(3): p. 157-62.

198. Hermans, G., et al., Effect of tolerating macronutrient deficit on the development of intensive-care unit acquired weakness: a subanalysis of the EPaNIC trial. Lancet Respir Med, 2013. 1(8): p. 621-629.

199. Samra, J.S., L.K. Summers, and K.N. Frayn, Sepsis and fat metabolism. Br J Surg, 1996. 83(9): p. 1186-96.

200. Evans, W.K., et al., Limited impact of total parenteral nutrition on nutritional status during treatment for small cell lung cancer. Cancer Res, 1985. 45(7): p. 3347-53.

201. Loprinzi, C.L., et al., Phase III evaluation of four doses of megestrol acetate as therapy for patients with cancer anorexia and/or cachexia. J Clin Oncol, 1993. 11(4): p. 762-7.

202. Loprinzi, C.L., et al., Body-composition changes in patients who gain weight while receiving megestrol acetate. J Clin Oncol, 1993. 11(1): p. 152-4.

203. Prado, C.M., et al., Central tenet of cancer cachexia therapy: do patients with advanced cancer have exploitable anabolic potential? Am J Clin Nutr, 2013. 98(4): p. 1012-9.

204. Schindler, K., et al., How nutritional risk is assessed and managed in European hospitals: a survey of 21,007 patients findings from the 2007- 2008 cross-sectional nutritionDay survey. Clin Nutr, 2010. 29(5): p. 552-9.

205. Nordenstrom, J., et al., Metabolic utilization of intravenous fat emulsion during total parenteral nutrition. Ann Surg, 1982. 196(2): p. 221-31.

206. Wretlind, A., Complete intravenous nutrition. Theoretical and experimental background. Nutr Metab, 1972. 14: p. Suppl:1-57.

207. Deutz, N.E., et al., Muscle protein synthesis in cancer patients can be stimulated with a specially formulated medical food. Clin Nutr, 2011. 30(6): p. 759-68.

208. Baldwin, C., The effectiveness of nutritional interventions in malnutrition and cachexia. Proc Nutr Soc, 2015. 74(4): p. 397-404.

172

209. Maccio, A., C. Madeddu, and G. Mantovani, Current pharmacotherapy options for cancer anorexia and cachexia. Expert Opin Pharmacother, 2012. 13(17): p. 2453-72.

210. Dodson, S., et al., Muscle wasting in cancer cachexia: clinical implications, diagnosis, and emerging treatment strategies. Annu Rev Med, 2011. 62: p. 265-79.

211. Seres, D.S., M. Valcarcel, and A. Guillaume, Advantages of enteral nutrition over parenteral nutrition. Therap Adv Gastroenterol, 2013. 6(2): p. 157-67.

212. Fong, Y.M., et al., Total parenteral nutrition and bowel rest modify the metabolic response to endotoxin in humans. Ann Surg, 1989. 210(4): p. 449-56; discussion 456-7.

213. Denison, M.S. and S.R. Nagy, Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu Rev Pharmacol Toxicol, 2003. 43: p. 309-34.

214. Fujii-Kuriyama, Y. and J. Mimura, Molecular mechanisms of AhR functions in the regulation of cytochrome P450 genes. Biochem Biophys Res Commun, 2005. 338(1): p. 311-7.

215. Guengerich, F.P., Cytochrome p450 and chemical toxicology. Chemical research in toxicology, 2007. 21(1): p. 70-83.

216. Hahn, M.E., Aryl hydrocarbon receptors: diversity and evolution. Chem Biol Interact, 2002. 141(1-2): p. 131-60.

217. Bunger, M.K., et al., Abnormal liver development and resistance to 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity in mice carrying a mutation in the DNA-binding domain of the aryl hydrocarbon receptor. Toxicol Sci, 2008. 106(1): p. 83-92.

218. Bunger, M.K., et al., Resistance to 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity and abnormal liver development in mice carrying a mutation in the nuclear localization sequence of the aryl hydrocarbon receptor. J Biol Chem, 2003. 278(20): p. 17767-74.

219. Alexander, D.L., et al., Aryl-hydrocarbon receptor is an inhibitory regulator of lipid synthesis and of commitment to adipogenesis. J Cell Sci, 1998. 111 ( Pt 22): p. 3311-22.

220. Gandhi, R., et al., Activation of the aryl hydrocarbon receptor induces human type 1 regulatory T cell-like and Foxp3(+) regulatory T cells. Nat Immunol, 2010. 11(9): p. 846-53.

173

221. Kerkvliet, N.I., et al., Activation of aryl hydrocarbon receptor by TCDD prevents diabetes in NOD mice and increases Foxp3+ T cells in pancreatic lymph nodes. Immunotherapy, 2009. 1(4): p. 539-47.

222. Mezrich, J.D., et al., An interaction between kynurenine and the aryl hydrocarbon receptor can generate regulatory T cells. J Immunol, 2010. 185(6): p. 3190-8.

223. Kimura, A., et al., Aryl hydrocarbon receptor regulates Stat1 activation and participates in the development of Th17 cells. Proc Natl Acad Sci U S A, 2008. 105(28): p. 9721-6.

224. Veldhoen, M., et al., The aryl hydrocarbon receptor links TH17-cell- mediated autoimmunity to environmental toxins. Nature, 2008. 453(7191): p. 106-9.

225. Arsenescu, V., et al., Polychlorinated biphenyl-77 induces adipocyte differentiation and proinflammatory adipokines and promotes obesity and atherosclerosis. Environ Health Perspect, 2008. 116(6): p. 761-8.

226. Phillips, M., et al., Inhibition of 3T3-L1 adipose differentiation by 2,3,7,8- tetrachlorodibenzo-p-dioxin. J Cell Sci, 1995. 108 ( Pt 1): p. 395-402.

227. Kim, D.W., et al., The RelA NF-kappaB subunit and the aryl hydrocarbon receptor (AhR) cooperate to transactivate the c-myc promoter in mammary cells. Oncogene, 2000. 19(48): p. 5498-506.

228. Vogel, C.F., et al., RelB, a new partner of aryl hydrocarbon receptor- mediated transcription. Mol Endocrinol, 2007. 21(12): p. 2941-55.

229. Safe, S., et al., Ah receptor agonists as endocrine disruptors: antiestrogenic activity and mechanisms. Toxicol Lett, 1998. 102-103: p. 343-7.

230. Ohtake, F., Y. Fujii-Kuriyama, and S. Kato, AhR acts as an E3 ubiquitin ligase to modulate steroid receptor functions. Biochem Pharmacol, 2009. 77(4): p. 474-84.

231. Ikuta, T., et al., Nuclear localization and export signals of the human aryl hydrocarbon receptor. J Biol Chem, 1998. 273(5): p. 2895-904.

232. Pollenz, R.S., The mechanism of AH receptor protein down-regulation (degradation) and its impact on AH receptor-mediated gene regulation. Chem Biol Interact, 2002. 141(1-2): p. 41-61.

233. Davarinos, N.A. and R.S. Pollenz, Aryl hydrocarbon receptor imported into the nucleus following ligand binding is rapidly degraded via the

174

cytosplasmic proteasome following nuclear export. J Biol Chem, 1999. 274(40): p. 28708-15.

234. Ma, Q. and K.T. Baldwin, 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced degradation of aryl hydrocarbon receptor (AhR) by the ubiquitin- proteasome pathway. Role of the transcription activaton and DNA binding of AhR. J Biol Chem, 2000. 275(12): p. 8432-8.

235. Roberts, B.J. and M.L. Whitelaw, Degradation of the basic helix-loop- helix/Per-ARNT-Sim homology domain dioxin receptor via the ubiquitin/proteasome pathway. J Biol Chem, 1999. 274(51): p. 36351-6.

236. Kanno, Y., et al., Identification of intracellular localization signals and of mechanisms underlining the nucleocytoplasmic shuttling of human aryl hydrocarbon receptor repressor. Biochem Biophys Res Commun, 2007. 364(4): p. 1026-31.

237. Hahn, M.E., L.L. Allan, and D.H. Sherr, Regulation of constitutive and inducible AHR signaling: complex interactions involving the AHR repressor. Biochem Pharmacol, 2009. 77(4): p. 485-97.

238. Mimura, J., et al., Identification of a novel mechanism of regulation of Ah (dioxin) receptor function. Genes Dev, 1999. 13(1): p. 20-5.

239. Karchner, S.I., et al., Regulatory interactions among three members of the vertebrate aryl hydrocarbon receptor family: AHR repressor, AHR1, and AHR2. J Biol Chem, 2002. 277(9): p. 6949-59.

240. Baba, T., et al., Structure and expression of the Ah receptor repressor gene. J Biol Chem, 2001. 276(35): p. 33101-10.

241. Yamamoto, J., et al., Characteristic expression of aryl hydrocarbon receptor repressor gene in human tissues: organ-specific distribution and variable induction patterns in mononuclear cells. Life Sci, 2004. 74(8): p. 1039-49.

242. Watanabe, T., et al., Human arylhydrocarbon receptor repressor (AHRR) gene: genomic structure and analysis of polymorphism in endometriosis. J Hum Genet, 2001. 46(6): p. 342-6.

243. Evans, B.R., et al., Repression of aryl hydrocarbon receptor (AHR) signaling by AHR repressor: role of DNA binding and competition for AHR nuclear translocator. Mol Pharmacol, 2008. 73(2): p. 387-98.

244. Ashida, H., et al., Flavones and flavonols at dietary levels inhibit a transformation of aryl hydrocarbon receptor induced by dioxin. FEBS Lett, 2000. 476(3): p. 213-7.

175

245. Zhang, S., C. Qin, and S.H. Safe, Flavonoids as aryl hydrocarbon receptor agonists/antagonists: effects of structure and cell context. Environ Health Perspect, 2003. 111(16): p. 1877-82.

246. Bjeldanes, L.F., et al., Aromatic hydrocarbon responsiveness-receptor agonists generated from indole-3-carbinol in vitro and in vivo: comparisons with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Proc Natl Acad Sci U S A, 1991. 88(21): p. 9543-7.

247. Baker, N.A., et al., Effects of Adipocyte Aryl Hydrocarbon Receptor Deficiency on PCB-Induced Disruption of Glucose Homeostasis in Lean and Obese Mice. Environ Health Perspect, 2015. 123(10): p. 944-50.

248. Allan, L.L. and D.H. Sherr, Constitutive activation and environmental chemical induction of the aryl hydrocarbon receptor/transcription factor in activated human B lymphocytes. Mol Pharmacol, 2005. 67(5): p. 1740-50.

249. Campbell, S.J., et al., The murine Cyp1a1 gene is expressed in a restricted spatial and temporal pattern during embryonic development. J Biol Chem, 2005. 280(7): p. 5828-35.

250. Yang, X., et al., Constitutive regulation of CYP1B1 by the aryl hydrocarbon receptor (AhR) in pre-malignant and malignant mammary tissue. J Cell Biochem, 2008. 104(2): p. 402-17.

251. Wincent, E., et al., The suggested physiologic aryl hydrocarbon receptor activator and cytochrome P4501 substrate 6-formylindolo[3,2-b]carbazole is present in humans. J Biol Chem, 2009. 284(5): p. 2690-6.

252. DiNatale, B.C., J.C. Schroeder, and G.H. Perdew, Ah receptor antagonism inhibits constitutive and cytokine inducible IL6 production in head and neck tumor cell lines. Mol Carcinog, 2011. 50(3): p. 173-83.

253. Opitz, C.A., et al., An endogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Nature, 2011. 478(7368): p. 197-203.

254. Nguyen, L.P. and C.A. Bradfield, The search for endogenous activators of the aryl hydrocarbon receptor. Chem Res Toxicol, 2008. 21(1): p. 102-16.

255. Adachi, J., et al., Indirubin and indigo are potent aryl hydrocarbon receptor ligands present in human urine. J Biol Chem, 2001. 276(34): p. 31475-8.

256. Kapitulnik, J. and F.J. Gonzalez, Marked endogenous activation of the CYP1A1 and CYP1A2 genes in the congenitally jaundiced Gunn rat. Mol Pharmacol, 1993. 43(5): p. 722-5.

176

257. Sinal, C.J. and J.R. Bend, Aryl hydrocarbon receptor-dependent induction of cyp1a1 by bilirubin in mouse hepatoma hepa 1c1c7 cells. Mol Pharmacol, 1997. 52(4): p. 590-9.

258. Phelan, D., et al., Activation of the Ah receptor signal transduction pathway by bilirubin and biliverdin. Arch Biochem Biophys, 1998. 357(1): p. 155-63.

259. Schaldach, C.M., J. Riby, and L.F. Bjeldanes, Lipoxin A4: a new class of ligand for the Ah receptor. Biochemistry, 1999. 38(23): p. 7594-600.

260. Seidel, S.D., et al., Activation of the Ah receptor signaling pathway by prostaglandins. J Biochem Mol Toxicol, 2001. 15(4): p. 187-96.

261. Murray, I.A., et al., Antagonism of aryl hydrocarbon receptor signaling by 6,2',4'-trimethoxyflavone. J Pharmacol Exp Ther, 2010. 332(1): p. 135-44.

262. Santostefano, M., et al., alpha-Naphthoflavone-induced CYP1A1 gene expression and cytosolic aryl hydrocarbon receptor transformation. Mol Pharmacol, 1993. 43(2): p. 200-6.

263. Choi, E.Y., et al., Development of novel CH223191-based antagonists of the aryl hydrocarbon receptor. Mol Pharmacol, 2012. 81(1): p. 3-11.

264. Kim, S.H., et al., Novel compound 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) prevents 2,3,7,8- TCDD-induced toxicity by antagonizing the aryl hydrocarbon receptor. Mol Pharmacol, 2006. 69(6): p. 1871-8.

265. Zhao, B., et al., CH223191 is a ligand-selective antagonist of the Ah (Dioxin) receptor. Toxicol Sci, 2010. 117(2): p. 393-403.

266. Palermo, C.M., C.A. Westlake, and T.A. Gasiewicz, Epigallocatechin gallate inhibits aryl hydrocarbon receptor gene transcription through an indirect mechanism involving binding to a 90 kDa heat shock protein. Biochemistry, 2005. 44(13): p. 5041-52.

267. Safe, S., C. Qin, and A. McDougal, Development of selective aryl hydrocarbon receptor modulators for treatment of breast cancer. Expert Opin Investig Drugs, 1999. 8(9): p. 1385-96.

268. Patel, R.D., et al., Ah receptor represses acute-phase response gene expression without binding to its cognate response element. Lab Invest, 2009. 89(6): p. 695-707.

269. Murray, I.A., et al., Development of a selective modulator of aryl hydrocarbon (Ah) receptor activity that exhibits anti-inflammatory properties. Chem Res Toxicol, 2010. 23(5): p. 955-66.

177

270. Moura-Alves, P., et al., AhR sensing of bacterial pigments regulates antibacterial defence. Nature, 2014. 512(7515): p. 387-92.

271. Li, Y., et al., Exogenous stimuli maintain intraepithelial lymphocytes via aryl hydrocarbon receptor activation. Cell, 2011. 147(3): p. 629-40.

272. La Merrill, M., et al., Toxicological function of adipose tissue: focus on persistent organic pollutants. Environ Health Perspect, 2013. 121(2): p. 162-9.

273. Shimba, S., et al., Depletion of arylhydrocarbon receptor during adipose differentiation in 3T3-L1 cells. Biochem Biophys Res Commun, 1998. 249(1): p. 131-7.

274. Shimba, S., et al., Transcriptional regulation of the AhR gene during adipose differentiation. Biol Pharm Bull, 2003. 26(9): p. 1266-71.

275. Shimba, S., T. Wada, and M. Tezuka, Arylhydrocarbon receptor (AhR) is involved in negative regulation of adipose differentiation in 3T3-L1 cells: AhR inhibits adipose differentiation independently of dioxin. J Cell Sci, 2001. 114(Pt 15): p. 2809-17.

276. Li, W., C.F. Vogel, and F. Matsumura, Studies on the cell treatment conditions to elicit lipolytic responses from 3T3-L1 adipocytes to TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin. J Cell Biochem, 2007. 102(2): p. 389- 402.

277. Brewster, D.W. and F. Matsumura, TCDD (2,3,7,8-tetrachlorodibenzo-p- dioxin) reduces lipoprotein lipase activity in the adipose tissue of the guinea pig. Biochem Biophys Res Commun, 1984. 122(2): p. 810-7.

278. Schiering, C., et al., Feedback control of AHR signalling regulates intestinal immunity. Nature, 2017. 542(7640): p. 242-245.

279. Cella, M. and M. Colonna, Aryl hydrocarbon receptor: Linking environment to immunity. Semin Immunol, 2015. 27(5): p. 310-4.

280. Quintana, F.J., The aryl hydrocarbon receptor: a molecular pathway for the environmental control of the immune response. Immunology, 2013. 138(3): p. 183-9.

281. Qiu, J., et al., The aryl hydrocarbon receptor regulates gut immunity through modulation of innate lymphoid cells. Immunity, 2012. 36(1): p. 92- 104.

282. Fernandez-Salguero, P., et al., Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science, 1995. 268(5211): p. 722-6.

178

283. Schmidt, J.V., et al., Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci U S A, 1996. 93(13): p. 6731-6.

284. Andreola, F., et al., Aryl hydrocarbon receptor knockout mice (AHR-/-) exhibit liver retinoid accumulation and reduced retinoic acid metabolism. Cancer Res, 1997. 57(14): p. 2835-8.

285. Zambrano-Zaragoza, J.F., et al., Th17 cells in autoimmune and infectious diseases. Int J Inflam, 2014. 2014: p. 651503.

286. Quintana, F.J., et al., Control of T(reg) and T(H)17 cell differentiation by the aryl hydrocarbon receptor. Nature, 2008. 453(7191): p. 65-71.

287. Veldhoen, M., et al., Natural agonists for aryl hydrocarbon receptor in culture medium are essential for optimal differentiation of Th17 T cells. J Exp Med, 2009. 206(1): p. 43-9.

288. Bettelli, E., M. Oukka, and V.K. Kuchroo, T(H)-17 cells in the circle of immunity and autoimmunity. Nat Immunol, 2007. 8(4): p. 345-50.

289. Funatake, C.J., et al., Cutting edge: activation of the aryl hydrocarbon receptor by 2,3,7,8-tetrachlorodibenzo-p-dioxin generates a population of CD4+ CD25+ cells with characteristics of regulatory T cells. J Immunol, 2005. 175(7): p. 4184-8.

290. Marshall, N.B. and N.I. Kerkvliet, Dioxin and immune regulation: emerging role of aryl hydrocarbon receptor in the generation of regulatory T cells. Ann N Y Acad Sci, 2010. 1183: p. 25-37.

291. Apetoh, L., et al., The aryl hydrocarbon receptor interacts with c-Maf to promote the differentiation of type 1 regulatory T cells induced by IL-27. Nat Immunol, 2010. 11(9): p. 854-61.

292. Kerkvliet, N.I., Recent advances in understanding the mechanisms of TCDD immunotoxicity. Int Immunopharmacol, 2002. 2(2-3): p. 277-91.

293. Sulentic, C.E. and N.E. Kaminski, The long winding road toward understanding the molecular mechanisms for B-cell suppression by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Sci, 2011. 120 Suppl 1: p. S171-91.

294. Boitano, A.E., et al., Aryl hydrocarbon receptor antagonists promote the expansion of human hematopoietic stem cells. Science, 2010. 329(5997): p. 1345-8.

179

295. Hirabayashi, Y. and T. Inoue, Aryl hydrocarbon receptor biology and xenobiotic responses in hematopoietic progenitor cells. Biochem Pharmacol, 2009. 77(4): p. 521-35.

296. Cua, D.J. and C.M. Tato, Innate IL-17-producing cells: the sentinels of the immune system. Nat Rev Immunol, 2010. 10(7): p. 479-89.

297. Lee, J.S., et al., AHR drives the development of gut ILC22 cells and postnatal lymphoid tissues via pathways dependent on and independent of Notch. Nat Immunol, 2011. 13(2): p. 144-51.

298. Kiss, E.A., et al., Natural aryl hydrocarbon receptor ligands control organogenesis of intestinal lymphoid follicles. Science, 2011. 334(6062): p. 1561-5.

299. Stockinger, B., et al., The aryl hydrocarbon receptor: multitasking in the immune system. Annu Rev Immunol, 2014. 32: p. 403-32.

300. Schroder, K. and J. Tschopp, The inflammasomes. Cell, 2010. 140(6): p. 821-32.

301. Davis, B.K., H. Wen, and J.P. Ting, The inflammasome NLRs in immunity, inflammation, and associated diseases. Annu Rev Immunol, 2011. 29: p. 707-35.

302. Huai, W., et al., Aryl hydrocarbon receptor negatively regulates NLRP3 inflammasome activity by inhibiting NLRP3 transcription. Nat Commun, 2014. 5: p. 4738.

303. Bauernfeind, F.G., et al., Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J Immunol, 2009. 183(2): p. 787-91.

304. Tian, Y., et al., Ah receptor and NF-kappaB interactions, a potential mechanism for dioxin toxicity. J Biol Chem, 1999. 274(1): p. 510-5.

305. Tian, Y., A.B. Rabson, and M.A. Gallo, Ah receptor and NF-kappaB interactions: mechanisms and physiological implications. Chem Biol Interact, 2002. 141(1-2): p. 97-115.

306. Kimura, A., et al., Aryl hydrocarbon receptor in combination with Stat1 regulates LPS-induced inflammatory responses. J Exp Med, 2009. 206(9): p. 2027-35.

307. Sekine, H., et al., Hypersensitivity of aryl hydrocarbon receptor-deficient mice to lipopolysaccharide-induced septic shock. Mol Cell Biol, 2009. 29(24): p. 6391-400.

180

308. Turner, J.M. and A.J. Messenger, Occurrence, biochemistry and physiology of phenazine pigment production. Adv Microb Physiol, 1986. 27: p. 211-75.

309. Lau, G.W., et al., The role of pyocyanin in Pseudomonas aeruginosa infection. Trends Mol Med, 2004. 10(12): p. 599-606.

310. Baron, S.S. and J.J. Rowe, Antibiotic action of pyocyanin. Antimicrob Agents Chemother, 1981. 20(6): p. 814-20.

311. O'Malley, Y.Q., K.J. Reszka, and B.E. Britigan, Direct oxidation of 2',7'- dichlorodihydrofluorescein by pyocyanin and other redox-active compounds independent of reactive oxygen species production. Free Radic Biol Med, 2004. 36(1): p. 90-100.

312. Reszka, K.J., et al., Oxidation of pyocyanin, a cytotoxic product from Pseudomonas aeruginosa, by microperoxidase 11 and hydrogen peroxide. Free Radic Biol Med, 2004. 36(11): p. 1448-59.

313. Gardner, P.R., Superoxide production by the mycobacterial and pseudomonad quinoid pigments phthiocol and pyocyanine in human lung cells. Arch Biochem Biophys, 1996. 333(1): p. 267-74.

314. Friedheim, E.A., Pyocyanine, an Accessory Respiratory Enzyme. J Exp Med, 1931. 54(2): p. 207-21.

315. Jayaseelan, S., D. Ramaswamy, and S. Dharmaraj, Pyocyanin: production, applications, challenges and new insights. World J Microbiol Biotechnol, 2014. 30(4): p. 1159-68.

316. Parsons, J.F., et al., Structural and functional analysis of the pyocyanin biosynthetic protein PhzM from Pseudomonas aeruginosa. Biochemistry, 2007. 46(7): p. 1821-8.

317. Van Delden, C. and B.H. Iglewski, Cell-to-cell signaling and Pseudomonas aeruginosa infections. Emerg Infect Dis, 1998. 4(4): p. 551-60.

318. Reimer, A., B. Edvaller, and B. Johansson, Concentrations of the Pseudomonas aeruginosa toxin pyocyanin in human ear secretions. Acta Otolaryngol Suppl, 2000. 543: p. 86-8.

319. Wilson, R., et al., Measurement of Pseudomonas aeruginosa phenazine pigments in sputum and assessment of their contribution to sputum sol toxicity for respiratory epithelium. Infect Immun, 1988. 56(9): p. 2515-7.

320. Cruickshank, C.N. and E.J. Lowbury, The effect of pyocyanin on human skin cells and leucocytes. Br J Exp Pathol, 1953. 34(6): p. 583-7.

181

321. Arora, D., et al., Pyocyanin induces systemic oxidative stress, inflammation and behavioral changes in vivo. Toxicol Mech Methods, 2018. 28(6): p. 410-414.

322. Baron, R., Molecular mechanisms of bone resorption by the osteoclast. Anat Rec, 1989. 224(2): p. 317-24.

323. Hassan, H.M. and I. Fridovich, Mechanism of the antibiotic action pyocyanine. J Bacteriol, 1980. 141(1): p. 156-63.

324. Kerr, J.R., et al., Pseudomonas aeruginosa pyocyanin and 1- hydroxyphenazine inhibit fungal growth. J Clin Pathol, 1999. 52(5): p. 385- 7.

325. Das, T. and M. Manefield, Pyocyanin promotes extracellular DNA release in Pseudomonas aeruginosa. PLoS One, 2012. 7(10): p. e46718.

326. O'Malley, Y.Q., et al., Subcellular localization of Pseudomonas pyocyanin cytotoxicity in human lung epithelial cells. Am J Physiol Lung Cell Mol Physiol, 2003. 284(2): p. L420-30.

327. Muller, M., Pyocyanin induces oxidative stress in human endothelial cells and modulates the glutathione redox cycle. Free Radic Biol Med, 2002. 33(11): p. 1527-33.

328. Cheluvappa, R., et al., The effect of Pseudomonas aeruginosa virulence factor, pyocyanin, on the liver sinusoidal endothelial cell. J Gastroenterol Hepatol, 2007. 22(8): p. 1350-1.

329. Britigan, B.E., et al., Interaction of the Pseudomonas aeruginosa secretory products pyocyanin and pyochelin generates hydroxyl radical and causes synergistic damage to endothelial cells. Implications for Pseudomonas- associated tissue injury. J Clin Invest, 1992. 90(6): p. 2187-96.

330. Rada, B. and T.L. Leto, Redox warfare between airway epithelial cells and Pseudomonas: dual oxidase versus pyocyanin. Immunol Res, 2009. 43(1- 3): p. 198-209.

331. Hall, S., et al., Cellular Effects of Pyocyanin, a Secreted Virulence Factor of Pseudomonas aeruginosa. Toxins (Basel), 2016. 8(8).

332. Suntres, Z.E., A. Omri, and P.N. Shek, Pseudomonas aeruginosa-induced lung injury: role of oxidative stress. Microb Pathog, 2002. 32(1): p. 27-34.

333. Rada, B., et al., Reactive oxygen species mediate inflammatory cytokine release and EGFR-dependent mucin secretion in airway epithelial cells exposed to Pseudomonas pyocyanin. Mucosal Immunol, 2011. 4(2): p. 158-71.

182

334. Virreira Winter, S. and A. Zychlinsky, The bacterial pigment pyocyanin inhibits the NLRP3 inflammasome through intracellular reactive oxygen and nitrogen species. J Biol Chem, 2018. 293(13): p. 4893-4900.

335. Fick, R.B., Jr., Pathogenesis of the pseudomonas lung lesion in cystic fibrosis. Chest, 1989. 96(1): p. 158-64.

336. Denning, G.M., et al., Pseudomonas pyocyanin increases interleukin-8 expression by human airway epithelial cells. Infect Immun, 1998. 66(12): p. 5777-84.

337. Leidal, K.G., K.L. Munson, and G.M. Denning, Small molecular weight secretory factors from Pseudomonas aeruginosa have opposite effects on IL-8 and RANTES expression by human airway epithelial cells. Am J Respir Cell Mol Biol, 2001. 25(2): p. 186-95.

338. McDermott, C., et al., Alterations in acetylcholine, PGE2 and IL6 release from urothelial cells following treatment with pyocyanin and lipopolysaccharide. Toxicol In Vitro, 2013. 27(6): p. 1693-8.

339. Usher, L.R., et al., Induction of neutrophil apoptosis by the Pseudomonas aeruginosa exotoxin pyocyanin: a potential mechanism of persistent infection. J Immunol, 2002. 168(4): p. 1861-8.

340. Joseph, B.Z., J.M. Routes, and L. Borish, Activities of superoxide dismutases and NADPH oxidase in neutrophils obtained from asthmatic and normal donors. Inflammation, 1993. 17(3): p. 361-70.

341. Sorenson, E.M. and J.P. Gallagher, The reducing agent dithiothreitol (DTT) does not abolish the inhibitory nicotinic response recorded from rat dorsolateral septal neurons. Neurosci Lett, 1993. 152(1-2): p. 137-40.

342. Hassett, D.J., et al., Response of Pseudomonas aeruginosa to pyocyanin: mechanisms of resistance, antioxidant defenses, and demonstration of a manganese-cofactored superoxide dismutase. Infect Immun, 1992. 60(2): p. 328-36.

343. Allen, L., et al., Pyocyanin production by Pseudomonas aeruginosa induces neutrophil apoptosis and impairs neutrophil-mediated host defenses in vivo. J Immunol, 2005. 174(6): p. 3643-9.

344. Zychlinsky, A. and P. Sansonetti, Perspectives series: host/pathogen interactions. Apoptosis in bacterial pathogenesis. J Clin Invest, 1997. 100(3): p. 493-5.

345. Savill, J.S., et al., Macrophage phagocytosis of aging neutrophils in inflammation. Programmed cell death in the neutrophil leads to its recognition by macrophages. J Clin Invest, 1989. 83(3): p. 865-75.

183

346. Nutman, J., et al., Studies on the mechanism of T cell inhibition by the Pseudomonas aeruginosa phenazine pigment pyocyanine. J Immunol, 1987. 138(10): p. 3481-7.

347. Ulmer, A.J., et al., Inhibitory and stimulatory effects of Pseudomonas aeruginosa pyocyanine on human T and B lymphocytes and human monocytes. Infect Immun, 1990. 58(3): p. 808-15.

348. Lauredo, I.T., et al., Mechanism of pyocyanin- and 1-hydroxyphenazine- induced lung neutrophilia in sheep airways. J Appl Physiol (1985), 1998. 85(6): p. 2298-304.

349. Hao, Y., et al., Pseudomonas aeruginosa pyocyanin causes airway goblet cell hyperplasia and metaplasia and mucus hypersecretion by inactivating the transcriptional factor FoxA2. Cell Microbiol, 2012. 14(3): p. 401-15.

350. Furukawa, S., et al., Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest, 2004. 114(12): p. 1752-61.

351. Bjorklund, G., et al., Cancer-associated cachexia, reactive oxygen species, and nutrition therapy. Curr Med Chem, 2018.

352. Prauchner, C.A., Oxidative stress in sepsis: Pathophysiological implications justifying antioxidant co-therapy. Burns, 2017. 43(3): p. 471- 485.

353. Ran, H., D.J. Hassett, and G.W. Lau, Human targets of Pseudomonas aeruginosa pyocyanin. Proc Natl Acad Sci U S A, 2003. 100(24): p. 14315-20.

354. Kanthakumar, K., et al., Mechanisms of action of Pseudomonas aeruginosa pyocyanin on human ciliary beat in vitro. Infect Immun, 1993. 61(7): p. 2848-53.

355. Argiles, J.M., et al., Consensus on cachexia definitions. J Am Med Dir Assoc, 2010. 11(4): p. 229-30.

356. Marques, M., et al., Critical illness induces nutrient-independent adipogenesis and accumulation of alternatively activated tissue macrophages. Crit Care, 2013. 17(5): p. R193.

357. Caldwell, C.C., et al., Pseudomonas aeruginosa exotoxin pyocyanin causes cystic fibrosis airway pathogenesis. Am J Pathol, 2009. 175(6): p. 2473-88.

358. Rodbell, M., Metabolism of Isolated Fat Cells. I. Effects of Hormones on Glucose Metabolism and Lipolysis. J Biol Chem, 1964. 239: p. 375-80.

184

359. Moseti, D., A. Regassa, and W.K. Kim, Molecular Regulation of Adipogenesis and Potential Anti-Adipogenic Bioactive Molecules. Int J Mol Sci, 2016. 17(1).

360. Sharma, V.M. and V. Puri, Mechanism of TNF-alpha-induced lipolysis in human adipocytes uncovered. Obesity (Silver Spring), 2016. 24(5): p. 990.

361. Souza, S.C., et al., TNF-alpha induction of lipolysis is mediated through activation of the extracellular signal related kinase pathway in 3T3-L1 adipocytes. J Cell Biochem, 2003. 89(6): p. 1077-86.

362. Jackson, E., et al., Adipose Tissue as a Site of Toxin Accumulation. Compr Physiol, 2017. 7(4): p. 1085-1135.

363. Remick, D.G. and H. Xioa, Hypothermia and sepsis. Front Biosci, 2006. 11: p. 1006-13.

364. Minasyan, H., Sepsis and septic shock: Pathogenesis and treatment perspectives. J Crit Care, 2017. 40: p. 229-242.

365. Tsalik, E.L., et al., Discriminative value of inflammatory biomarkers for suspected sepsis. J Emerg Med, 2012. 43(1): p. 97-106.

366. Cavaillon, J.M., et al., Cytokine cascade in sepsis. Scand J Infect Dis, 2003. 35(9): p. 535-44.

367. Gouel-Cheron, A., et al., Early interleukin-6 and slope of monocyte human leukocyte antigen-DR: a powerful association to predict the development of sepsis after major trauma. PLoS One, 2012. 7(3): p. e33095.

368. Wu, H.P., et al., Serial cytokine levels in patients with severe sepsis. Inflamm Res, 2009. 58(7): p. 385-93.

369. Kellum, J.A., et al., Understanding the inflammatory cytokine response in pneumonia and sepsis: results of the Genetic and Inflammatory Markers of Sepsis (GenIMS) Study. Arch Intern Med, 2007. 167(15): p. 1655-63.

370. Zlotnik, A. and K.W. Moore, Interleukin 10. Cytokine, 1991. 3(5): p. 366- 71.

371. Muchamuel, T., et al., IL-13 protects mice from lipopolysaccharide- induced lethal endotoxemia: correlation with down-modulation of TNF- alpha, IFN-gamma, and IL-12 production. J Immunol, 1997. 158(6): p. 2898-903.

372. Baumhofer, J.M., et al., Gene transfer with IL-4 and IL-13 improves survival in lethal endotoxemia in the mouse and ameliorates peritoneal macrophages immune competence. Eur J Immunol, 1998. 28(2): p. 610-5.

185

373. Nicoletti, F., et al., Prevention of endotoxin-induced lethality in neonatal mice by interleukin-13. Eur J Immunol, 1997. 27(6): p. 1580-3.

374. Matsukawa, A., et al., Expression and contribution of endogenous IL-13 in an experimental model of sepsis. J Immunol, 2000. 164(5): p. 2738-44.

375. Uhlen, M., et al., Proteomics. Tissue-based map of the human proteome. Science, 2015. 347(6220): p. 1260419.

376. Carver, L.A., J.B. Hogenesch, and C.A. Bradfield, Tissue specific expression of the rat Ah-receptor and ARNT mRNAs. Nucleic Acids Res, 1994. 22(15): p. 3038-44.

377. The Human Protein Atlas AhR [cited 2019 March 4]; Available from: https://www.proteinatlas.org/ENSG00000106546-AHR/tissue.

378. Lee, J., et al., Male and female mice show significant differences in hepatic transcriptomic response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. BMC Genomics, 2015. 16: p. 625.

379. Prokopec, S.D., et al., Sex-related differences in murine hepatic transcriptional and proteomic responses to TCDD. Toxicol Appl Pharmacol, 2015. 284(2): p. 188-96.

380. Nault, R., et al., Loss of liver-specific and sexually dimorphic gene expression by aryl hydrocarbon receptor activation in C57BL/6 mice. PLoS One, 2017. 12(9): p. e0184842.

381. Agbor, L.N., K.M. Elased, and M.K. Walker, Endothelial cell-specific aryl hydrocarbon receptor knockout mice exhibit hypotension mediated, in part, by an attenuated angiotensin II responsiveness. Biochem Pharmacol, 2011. 82(5): p. 514-23.

382. Kerley-Hamilton, J.S., et al., Obesity is mediated by differential aryl hydrocarbon receptor signaling in mice fed a Western diet. Environ Health Perspect, 2012. 120(9): p. 1252-9.

383. Poland, A., D. Palen, and E. Glover, Analysis of the four alleles of the murine aryl hydrocarbon receptor. Mol Pharmacol, 1994. 46(5): p. 915-21.

384. Thomas, R.S., et al., Sequence variation and phylogenetic history of the mouse Ahr gene. Pharmacogenetics, 2002. 12(2): p. 151-63.

385. Baker, N.A., et al., Coplanar polychlorinated biphenyls impair glucose homeostasis in lean C57BL/6 mice and mitigate beneficial effects of weight loss on glucose homeostasis in obese mice. Environ Health Perspect, 2013. 121(1): p. 105-10.

186

386. Golay, A., et al., Effect of weight loss on glucose disposal in obese and obese diabetic patients. Int J Obes, 1985. 9(3): p. 181-91.

387. Weiss, E.P., et al., Improvements in glucose tolerance and insulin action induced by increasing energy expenditure or decreasing energy intake: a randomized controlled trial. Am J Clin Nutr, 2006. 84(5): p. 1033-42.

388. Hahn, P.Y., et al., Sustained elevation in circulating catecholamine levels during polymicrobial sepsis. Shock, 1995. 4(4): p. 269-73.

389. Yelich, M.R., Glucoregulatory, hormonal, and metabolic responses to endotoxicosis or cecal ligation and puncture sepsis in the rat: a direct comparison. Circ Shock, 1990. 31(3): p. 351-63.

390. Maitra, S.R., M.M. Wojnar, and C.H. Lang, Alterations in tissue glucose uptake during the hyperglycemic and hypoglycemic phases of sepsis. Shock, 2000. 13(5): p. 379-85.

391. Ferreira, F.B.D., et al., Glucose homeostasis in two degrees of sepsis lethality induced by caecum ligation and puncture in mice. Int J Exp Pathol, 2017. 98(6): p. 329-340.

392. Abrigo, J., et al., Role of Oxidative Stress as Key Regulator of Muscle Wasting during Cachexia. Oxid Med Cell Longev, 2018. 2018: p. 2063179.

393. Laviano, A., et al., Oxidative stress and wasting in cancer. Curr Opin Clin Nutr Metab Care, 2007. 10(4): p. 449-56.

394. Wincent, E., et al., Biological effects of 6-formylindolo[3,2-b]carbazole (FICZ) in vivo are enhanced by loss of CYP1A function in an Ahr2- dependent manner. Biochem Pharmacol, 2016. 110-111: p. 117-29.

395. Mogayzel, P.J., Jr. and P.A. Flume, Update in cystic fibrosis 2009. Am J Respir Crit Care Med, 2010. 181(6): p. 539-44.

396. Dodge, J.A. and D. Turck, Cystic fibrosis: nutritional consequences and management. Best Pract Res Clin Gastroenterol, 2006. 20(3): p. 531-46.

397. Sharma, R., et al., Wasting as an independent predictor of mortality in patients with cystic fibrosis. Thorax, 2001. 56(10): p. 746-50.

398. Stephenson, A.L., et al., Longitudinal trends in nutritional status and the relation between lung function and BMI in cystic fibrosis: a population- based cohort study. Am J Clin Nutr, 2013. 97(4): p. 872-7.

399. Henck, J.M., et al., 2,3,7,8-tetrachlorodibenzo-p-dioxin: acute oral toxicity in hamsters. Toxicol Appl Pharmacol, 1981. 59(2): p. 405-7.

187

400. Pohjanvirta, R., M. Unkila, and J. Tuomisto, Comparative acute lethality of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), 1,2,3,7,8- pentachlorodibenzo-p-dioxin and 1,2,3,4,7,8-hexachlorodibenzo-p-dioxin in the most TCDD-susceptible and the most TCDD-resistant rat strain. Pharmacol Toxicol, 1993. 73(1): p. 52-6.

401. Schwetz, B.A., et al., Toxicology of chlorinated dibenzo-p-dioxins. Environ Health Perspect, 1973. 5: p. 87-99.

402. Unkila, M., et al., Dose response and time course of alterations in tryptophan metabolism by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in the most TCDD-susceptible and the most TCDD-resistant rat strain: relationship with TCDD lethality. Toxicol Appl Pharmacol, 1994. 128(2): p. 280-92.

403. Jackson, E.N., et al., Sex differences in effects of aryl hydrocarbon deficiency to mitigate polychlorinated biphenyl-induced glucose impairment during weight loss in obese mice. Environ Health Perspect, 2019. Provisional Acceptance.

404. Pohjanvirta, R., et al., Unexpected gender difference in sensitivity to the acute toxicity of dioxin in mice. Toxicol Appl Pharmacol, 2012. 262(2): p. 167-76.

405. Marques, M., L. Laflamme, and L. Gaudreau, Estrogen receptor alpha can selectively repress dioxin receptor-mediated gene expression by targeting DNA methylation. Nucleic Acids Res, 2013. 41(17): p. 8094-106.

406. Pushparajah, D.S. and C. Ioannides, Antagonistic and synergistic interactions during the binding of binary mixtures of polycyclic aromatic hydrocarbons to the aryl hydrocarbon receptor. Toxicol In Vitro, 2018. 50: p. 54-61.

407. Shimada, T., et al., Different mechanisms for inhibition of human cytochromes P450 1A1, 1A2, and 1B1 by polycyclic aromatic inhibitors. Chem Res Toxicol, 2007. 20(3): p. 489-96.

408. Vinaik, R., M. Stanojcic, and M.G. Jeschke, NLRP3 Inflammasome Modulates Post-Burn Lipolysis and Hepatic Fat Infiltration via Fatty Acid Synthase. Sci Rep, 2018. 8(1): p. 15197.

409. Petriello, M.C., et al., Dioxin-like PCB 126 increases intestinal inflammation and disrupts gut microbiota and metabolic homeostasis. Environ Pollut, 2018. 242(Pt A): p. 1022-1032.

410. Hoffman, J.B., M.D. Flythe, and B. Hennig, Environmental pollutant- mediated disruption of gut microbial metabolism of the prebiotic inulin. Anaerobe, 2019. 55: p. 96-102.

188

411. Haak, B.W. and W.J. Wiersinga, The role of the gut microbiota in sepsis. Lancet Gastroenterol Hepatol, 2017. 2(2): p. 135-143.

412. Alverdy, J.C. and M.A. Krezalek, Collapse of the Microbiome, Emergence of the Pathobiome, and the Immunopathology of Sepsis. Crit Care Med, 2017. 45(2): p. 337-347.

413. Matsumoto, T., et al., Oral administration of Bifidobacterium longum prevents gut-derived Pseudomonas aeruginosa sepsis in mice. J Appl Microbiol, 2008. 104(3): p. 672-80.

414. Bindels, L.B., et al., Synbiotic approach restores intestinal homeostasis and prolongs survival in leukaemic mice with cachexia. ISME J, 2016. 10(6): p. 1456-70.

415. Bindels, L.B. and N.M. Delzenne, Muscle wasting: the gut microbiota as a new therapeutic target? Int J Biochem Cell Biol, 2013. 45(10): p. 2186-90.

416. Varian, B.J., et al., Beneficial bacteria inhibit cachexia. Oncotarget, 2016. 7(11): p. 11803-16.

417. Cezairliyan, B., et al., Identification of Pseudomonas aeruginosa phenazines that kill Caenorhabditis elegans. PLoS Pathog, 2013. 9(1): p. e1003101.

418. Baker, N.A., et al., Resveratrol protects against polychlorinated biphenyl- mediated impairment of glucose homeostasis in adipocytes. J Nutr Biochem, 2013. 24(12): p. 2168-74.

419. Casper, R.F., et al., Resveratrol has antagonist activity on the aryl hydrocarbon receptor: implications for prevention of dioxin toxicity. Mol Pharmacol, 1999. 56(4): p. 784-90.

420. Ishida, T., et al., Attenuation of 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity by resveratrol: a comparative study with different routes of administration. Biol Pharm Bull, 2009. 32(5): p. 876-81.

421. Tiesset, H., et al., Dietary (n-3) polyunsaturated fatty acids affect the kinetics of pro- and antiinflammatory responses in mice with Pseudomonas aeruginosa lung infection. J Nutr, 2009. 139(1): p. 82-9.

422. Pierre, M., et al., Omega-3 polyunsaturated fatty acids improve host response in chronic Pseudomonas aeruginosa lung infection in mice. Am J Physiol Lung Cell Mol Physiol, 2007. 292(6): p. L1422-31.

423. Marik, P.E., et al., Hydrocortisone, Vitamin C, and Thiamine for the Treatment of Severe Sepsis and Septic Shock: A Retrospective Before- After Study. Chest, 2017. 151(6): p. 1229-1238.

189

424. Mantovani, G., C. Madeddu, and A. Maccio, Cachexia and oxidative stress in cancer: an innovative therapeutic management. Curr Pharm Des, 2012. 18(31): p. 4813-8.

425. Mantovani, G., et al., Cancer-related anorexia/cachexia syndrome and oxidative stress: an innovative approach beyond current treatment. Cancer Epidemiol Biomarkers Prev, 2004. 13(10): p. 1651-9.

190

Vita

Nika Larian Education

2009-2013 Transylvania University, Lexington, KY Bachelor of Arts in Biology; French Language and Literature

Professional Positions Held

2013-2015 Laboratory Technician, University of Kentucky; Department of Pharmacology and Nutritional Sciences 2015-2019 Research Assistant, University of Kentucky; Department of Pharmacology and Nutritional Sciences. PI: Dr. Lisa Cassis 2018-2019 Academy of Nutrition and Dietetics Student Liaison 2019 Assistant Director of Legislative Affairs, NAGPS

Scholastic and Professional Honors

2010 Transylvania University Stephen Austin Award 2011 Transylvania University Henry Clay Award 2012 Transylvania University Junior Class Award 2012 Lexington Rotary Club’s Award for Academic Excellence 2013 Transylvania University Senior Class Award 2009-2014 Transylvania University William T. Young Scholarship 2015 Barnstable Brown Diabetes and Obesity Research Day Poster Award 2015-2017 T32 Predoctoral Scholar under NIH Training Grant on Metabolic Disease 2015-2018 UK Daniel Reedy Quality Achievement Award 2017 UK College of Medicine Fellowship for Excellence in Graduate Research 2017 UK Woman’s Club Fellowship 2018 Academy of Nutrition and Dietetics 2018 FNCE Outstanding Abstract Award

Publications

2014 Young AM, Larian N, Havens JR. Gender Differences in Circumstances Surrounding First Injection Experience of Rural Injection Drug Users. Drug and Alcohol Dependence 134:401-5, 2014. 2015 Baker NA, Shoemaker R, English V, Larian N, Sunkara M, Morris AJ, Walker M, Yiannikouris F, Cassis LA. Effects of Adipocyte Aryl Hydrocarbon Receptor Deficiency on PCB- Induced Disruption of Glucose Homeostasis in Lean and

191

Obese Mice. Environmental Health Perspectives 123(10):944-50, 2015. 2015 Yiannikouris F, Wang Y, Shoemaker R, Larian N, Thompson J, English VL, Charnigo R, Su W, Gong M, Cassis LA. Deficiency of angiotension in hepatocytes markedly decreases blood pressure in lean and obese male mice. Hypertension 66(4):836-42, 2015. 2017 Jackson E, Shoemaker R, Larian N, Cassis L. Adipose Tissue as a Site of Toxin Accumulation. Comprehensive Physiology 7(4):1085-1135, 2017. 2018 Larian N, Hoffman J, Hampton K, Police S. Nutrition News for the New Year. Health and Wellness 15(4):7, 2018. 2019 Jackson E, Thatcher S, Larian N, English V, Soman S, Morris A, Weng J, Stromberg A, Swanson H, Pearson K, Cassis L. Sex differences in effects of aryl hydrocarbon deficiency to mitigate polychlorinated biphenyl-induced glucose impairment during weight loss in obese mice. Environmental Health Perspectives.

Abstracts

2014 Deficiency of adipocyte aryl hydrocarbon receptor prevents polychlorinated biphenyl-induced disruptions in glucose homeostasis. Nika Larian, Nicki A. Baker, Victoria English, Robin Shoemaker, Manjula Sunkara, Andrew J. Morris, Mary Walker, Frederique Yiannikouris, Lisa A. Cassis. Gill Heart Research Day, October 2014. Lexington, KY. 2015 Deficiency of aryl hydrocarbon receptor in adipocytes augments the development of diet-induced obesity. Nika Larian, Nicki A. Baker, Robin Shoemaker, Victoria English, Lisa A. Cassis. Barnstable Brown Diabetes and Obesity Research Day, May 2015. Lexington, KY. 2015 Pyocyanin and indirubin, pathogen-associated ligands of the aryl hydrocarbon receptor, reduce differentiation of 3T3-L1 adipocytes. Nika Larian, Sean Thatcher, Lisa Cassis. Superfund Annual Research Meeting, 2015. San Juan, Puerto Rico. 2016 Pyocyanin and indirubin, pathogen-associated ligands of the aryl hydrocarbon receptor, reduce differentiation of 3T3-L1 adipocytes. Nika Larian, Sean Thatcher, Lisa Cassis. Barnstable Brown Diabetes and Obesity Research Day, May 2016. Lexington, KY. 2016 Pyocyanin, a pathogen-associated ligand of the aryl hydrocarbon receptor, reduces differentiation of 3T3-L1 adipocytes. Nika Larian, Sean Thatcher, Robin Shoemaker,

192

Lisa Cassis. Gill Heart Research Day, November 2016. Lexington, KY. 2017 Pyocyanin, a pathogen-associated ligand of the aryl hydrocarbon receptor, reduces differentiation of 3T3-L1 adipocytes. Nika Larian, Sean Thatcher, Robin Shoemaker, Lisa Cassis. Barnstable Brown Diabetes and Obesity Research Day, May 2017. Lexington, KY. 2017 Pyocyanin, a pathogen-associated ligand of the aryl hydrocarbon receptor, reduces differentiation of 3T3-L1 adipocytes. Nika Larian, Sean Thatcher, Lisa Cassis. Superfund Annual Research Meeting, December 2017. Philadelphia, PA. 2018 Pyocyanin, a pathogen-associated ligand of the aryl hydrocarbon receptor, reduces body weight and fat mass in male C57BL/6 mice. Nika Larian, Sean Thatcher, Mark Ensor, Lisa Cassis. Barnstable Brown Diabetes and Obesity Research Day, May 2018. Lexington, KY. 2018 Pyocyanin, a pathogen-associated ligand of the aryl hydrocarbon receptor, reduces body weight and fat mass in male C57BL/6 mice. Nika Larian, Sean Thatcher, Mark Ensor, Lisa Cassis. American Society for Nutrition 2018, June 2018. Boston, MA. 2018 Pyocyanin, a pathogen-associated ligand of the aryl hydrocarbon receptor, as a novel therapeutic target for septic cachexia. Nika Larian, Sean Thatcher, Mark Ensor, Lisa Cassis. Academy of Nutrition and Dietetics Food and Nutrition Conference and Expo, October 2018. Washington, DC.

193