DOCSLIB.ORG

Identification of Epistatic Interactions Through Genome-Wide Association

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Epistatic Interactions Through Genome-Wide Association Luzón-Toro et al. BMC Medical Genomics (2015) 8:83 DOI 10.1186/s12920-015-0160-7 RESEARCH ARTICLE Open Access Identification of epistatic interactions through genome-wide association studies in sporadic medullary and juvenile papillary thyroid carcinomas Berta Luzón-Toro1,2, Marta Bleda2,3,4, Elena Navarro2,5, Luz García-Alonso3,6, Macarena Ruiz-Ferrer1,2, Ignacio Medina3,7, Marta Martín-Sánchez1,2, Cristina Y. Gonzalez3,6, Raquel M. Fernández1,2, Ana Torroglosa1,2, Guillermo Antiñolo1,2, Joaquin Dopazo2,3,8*† and Salud Borrego1,2*† Abstract Background: The molecular mechanisms leading to sporadic medullary thyroid carcinoma (sMTC) and juvenile papillary thyroid carcinoma (PTC), two rare tumours of the thyroid gland, remain poorly understood. Genetic studies on thyroid carcinomas have been conducted, although just a few loci have been systematically associated. Given the difficulties to obtain single-loci associations, this work expands its scope to the study of epistatic interactions that could help to understand the genetic architecture of complex diseases and explain new heritable components of genetic risk. Methods: We carried out the first screening for epistasis by Multifactor-Dimensionality Reduction (MDR) in genome-wide association study (GWAS) on sMTC and juvenile PTC, to identify the potential simultaneous involvement of pairs of variants in the disease. Results: We have identified two significant epistatic gene interactions in sMTC (CHFR-AC016582.2 and C8orf37-RNU1-55P) and three in juvenile PTC (RP11-648k4.2-DIO1, RP11-648k4.2-DMGDH and RP11-648k4.2-LOXL1). Interestingly, each interacting gene pair included a non-coding RNA, providing thus support to the relevance that these elements are increasingly gaining to explain carcinoma development and progression. Conclusions: Overall, this study contributes to the understanding of the genetic basis of thyroid carcinoma susceptibility in two different case scenarios such as sMTC and juvenile PTC. Keywords: Sporadic medullary thyroid carcinoma, Juvenile papillary thyroid carcinoma, Epistasis, Multifactor- dimensionality reduction, Genome-wide association study Background thyroid cells from which thyroid carcinomas are de- Thyroid carcinoma is the most common endocrine rived. Medullary thyroid carcinoma (MTC) arises from malignancy, which account for more than 1 % of all calcitonin-producing parafollicular cells (thyroid C new malignant tumors [1]. There are several histo- cells) and constitutes around 2–5%ofallthyroidneo- logical types and subtypes according to the endocrine plasias [2]. Approximately 25 % of MTC cases present an autosomal dominant inherited disorder named * Correspondence: [email protected]; [email protected] Multiple Endocrine Neoplasia type 2 (MEN 2), which † Equal contributors includes three different clinical phenotypes: MEN 2A, 2Centre for Biomedical Network Research on Rare Diseases (CIBERER), Seville, Spain MEN 2B, and familial MTC (FMTC) [3]. In >95 % of 1Department of Genetics, Reproduction and Fetal Medicine, Institute of the cases, the three forms of MEN 2 are caused by Biomedicine of Seville (IBIS), University Hospital Virgen del Rocío/CSIC/ specific gain-of-function germline mutations of the University of Seville, Seville, Spain RET Full list of author information is available at the end of the article proto-oncogene [3, 4]. The remaining 75 % of © 2015 Luzón-Toro et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Luzón-Toro et al. BMC Medical Genomics (2015) 8:83 Page 2 of 9 MTC occurs as a non-inherited sporadic lesion involvement of pairs of variants in both diseases. The without associated endocrinopathy (sporadic MTC, determination of genome-wide epistasis encompasses sMTC). Unlike hereditary forms, very little is known statistical and computational challenges [17]. Here, we about the genetic basis of sMTC. So far, studies have have used the Multifactor-dimensionality reduction been focused on the analysis of specific single nucleo- (MDR) method to detect gene-gene interactions (GxG) tide polymorphisms (SNPs)/haplotypes and significant in GWAS, which has already successfully been used in associations to sMTC have been described for differ- the detection of multiple and joint genetic factors associ- ent susceptibility genes, suggesting that this phenotype ated with complex traits [18]. may be caused by a combination of multiple common We report here the first study that combines a screen- genetic variants [5–7].However,mostofthemhave ing for epistasis by MDR in GWAS on these two rare failed to be replicated in other populations, maybe due thyroid carcinoma types. to the difficulty in collect enough patients to reach the necessary statistical power [6]. Methods Nonmedullary thyroid carcinoma (NMTC) comprises Patients and controls thyroid carcinomas of follicular cell origin and among Two different series of Spanish patients were recruited them papillary thyroid carcinoma (PTC) and follicular for this study: one with 66 sMTC patients, with absence thyroid carcinoma represent the two most common sub- of personal or family history suggestive of MEN 2 and types (85 and 10 %, respectively) [8]. Regarding PTC, the absence of traditional germline MEN 2-defining RET age is considered as one of the most important prognos- mutations and another with 38 jPTC (range from 5 to tic factors. Juvenile PTC (jPCT), a rare disease in chil- 24 years of age) with no history of head and/or neck dren and adolescents, presents with an aggressive initial irradiation (see Additional file 1: Table S1) and no famil- manifestation, though patients have an excellent overall iar aggregation. Additionally, 129 healthy controls com- prognosis, showing longer periods of survival and a prising unselected, unrelated, race, age, and sex-matched lower incidence of recurrence [9, 10]. However, PTC re- individuals without previous thyroid-related disease mains under-reported in children and adolescents and history were recruited and used as controls of both car- there is still disagreement about the standard treatment cinoma types. and optimal type of follow-up needed [9, 11]. The few All subjects underwent peripheral blood extraction for pathologic studies carried out in jPTC point to exposure genomic DNA isolation using MagNA Pure LC system to ionizing radiation as the only known environmental (Roche, Indianapolis, IN) according to the manufac- risk factor [12, 13]. Although it have reported several turer’s instructions. SNPs associated with the risk of PTC in the absence of A written informed consent was obtained from all the radiation, most of them were carried out with older participants for clinical and molecular genetic studies. patients (mean age around 45 years) and/or using som- The study was approved by the Ethics Committee for atic rather than germline DNA [6]. As in the case of clinical research in the University Hospital Virgen del sMTC, the molecular mechanisms that account for jPTC Rocío (Seville, Spain) and complies with the tenets of or explain the development of this tumour remain the declaration of Helsinki. largely unknown. Despite the success of GWAS [14] in the identifica- tion of hundreds of genetic variants associated to Genome-wide genotyping different diseases [15], its application to rare and DNA derived from peripheral blood was hybridized to multifactorial diseases still presents major drawbacks. Affymetrix Genome-Wide Human SNP 6.0 arrays. CEL Conventional GWAS approaches, based on single files were processed using Affymetrix Power Tools (APT markers, require of large cohorts, typically unavailable v1.15.0) and genotypes were obtained using the Birdseed in rare diseases. In fact, the prevalence of sMTC is approxi- (v2) calling algorithm. mately 7/100,000, according to Orphanet (see http:// www.orpha.net/orphacom/cahiers/docs/GB/Prevalence_of_ Data quality control rare_diseases_by_alphabetical_list.pdf) and there are no Quality control was carried out using PLINK software data available for PTC. Additionally, the complex genetic [19]. Individuals with more than 7 % of missing rate as nature of some diseases make single marker approaches well as those with excessive or reduced heterozygosity quite inefficient, while suggest taking approaches based on (+/-2 times the standard deviation of the mean) were systems biology [16]. removed. The data were also checked for duplicates We carried out a GWAS in two thyroid carcinoma and related individuals. Finally, divergent ancestry was types (sMTC and jPTC) followed by the detection of epi- checked using EIGENSTRAT [20] to detect possible static interactions to identify the potential simultaneous population stratification. Luzón-Toro et al. BMC Medical Genomics (2015) 8:83 Page 3 of 9 Markers with excessive missing rate (>5 %) were System (Applied Bio- systems, Foster City, California, discarded. SNPs with minor allele frequency < 1 % and/ USA) or not in Hardy-Weinberg equilibrium (in unaffected − samples; P <1×10 5) were also excluded. Functional interpretation
Load more

Recommended publications
  • Diet-Induced Obesity Mediated by the JNK/DIO2 Signal Transduction Pathway
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Diet-induced obesity mediated by the JNK/DIO2 signal transduction pathway Santiago Vernia,1 Julie Cavanagh-Kyros,1,2 Tamera Barrett,1,2 Dae Young Jung,1 Jason K. Kim,1,3 and Roger J. Davis1,2,4 1Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts 01605, USA; 2Howard Hughes Medical Institute, Worcester, Massachusetts 01605, USA; 3Department of Medicine, Division of Endocrinology, Metabolism, and Diabetes, University of Massachusetts Medical School, Worcester, Massachusetts 01605, USA The cJun N-terminal kinase (JNK) signaling pathway is a key mediator of metabolic stress responses caused by consuming a high-fat diet, including the development of obesity. To test the role of JNK, we examined diet- induced obesity in mice with targeted ablation of Jnk genes in the anterior pituitary gland. These mice exhibited an increase in the pituitary expression of thyroid-stimulating hormone (TSH), an increase in the blood concentration of thyroid hormone (T4), increased energy expenditure, and markedly reduced obesity compared with control mice. The increased amount of pituitary TSH was caused by reduced expression of type 2 iodothyronine deiodinase (Dio2), a gene that is required for T4-mediated negative feedback regulation of TSH expression. These data establish a molecular mechanism that accounts for the regulation of energy expenditure and the development of obesity by the JNK signaling pathway. [Keywords: DIO2; JNK; obesity; pituitary gland; thyroid hormone] Supplemental material is available for this article. Received June 5, 2013; revised version accepted October 3, 2013.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • WIPI-1 (38-W): Sc-100901
    SANTA CRUZ BIOTECHNOLOGY, INC. WIPI-1 (38-W): sc-100901 BACKGROUND APPLICATIONS WIPI-1 (WD repeat domain, phosphoinositide interacting-1), also known as WIPI-1 (38-W) is recommended for detection of WIPI-1 of mouse, rat and WIPI1, ATG18 or WIPI49, is a 446 amino acid protein that localizes to cyto- human origin by Western Blotting (starting dilution 1:200, dilution range plasmic vesicles, endosomes, clathrin-coated vesicles and the trans-Golgi 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein network. Ubiquitously expressed with highest expression in heart, testis, (1 ml of cell lysate)] and solid phase ELISA (starting dilution 1:30, dilution placenta, pancreas and skeletal muscle, WIPI-1 is thought to play a role in range 1:30-1:3000). autophagy and may regulate protein trafficking in certain recycling pathways. Suitable for use as control antibody for WIPI-1 siRNA (h): sc-72210, WIPI-1 In addition, WIPI-1 interacts with androgen and estrogen receptors (ARs and siRNA (m): sc-72211, WIPI-1 shRNA Plasmid (h): sc-72210-SH, WIPI-1 shRNA ERs, respectively) and, through this interaction, may modify receptor function. Plasmid (m): sc-72211-SH, WIPI-1 shRNA (h) Lentiviral Particles: sc-72210-V WIPI-1 contains three WD repeats and has a 7-bladed propeller structure and WIPI-1 shRNA (m) Lentiviral Particles: sc-72211-V. with a conserved motif that facilitates its interaction with other proteins. WIPI-1 is expressed as two isoforms, designated a and b, and its expression Molecular Weight of WIPI-1: 49 kDa.
    [Show full text]
  • A Family-Based Association Study of DIO2 and Children Mental Retardation in the Qinba Region of China
    Journal of Human Genetics (2012) 57, 14–17 & 2012 The Japan Society of Human Genetics All rights reserved 1434-5161/12 $32.00 www.nature.com/jhg ORIGINAL ARTICLE A Family-based Association Study of DIO2 and children mental retardation in the Qinba region of China Kejin Zhang1,4, Heng Xi1,2,4, Xiying Wang1, Yale Guo3, Shaoping Huang3, Zijian Zheng2, Fuchang Zhang1,2 and Xiaocai Gao1,2 Deiodinase enzyme II (DIO2) has an important role in individuals’ thyroid hormones’ level, the development of central and peripheral nervous systems and characterized by mental retardation (MR). The DIO2 gene was genotyped by using five haplotype-tagging single-nucleotide polymorphisms (SNPs) in 157 Chinese MR high-density family pedigrees, including 452 nuclear families and 41460 persons. The single marker and haplotype analyses were performed by Family-based Association Tests (FBAT). Three SNPs had P-values o0.05 in at least one inherited model survived with the correction. Several haplotypes composed of these SNPs were also associated with MR. The in silico analyses identified that one of the SNPs, rs1388378, may be a functional SNP. However, further in vitro studies of this SNP should be considered in elucidating its effect on gene expression and the possible role in MR susceptibility. Journal of Human Genetics (2012) 57, 14–17; doi:10.1038/jhg.2011.121; published online 3 November 2011 Keywords: deiodinase enzyme II (DIO2); Family Based Association Tests (FBAT); mental retardation (MR); thyroid hormone (TH) INTRODUCTION Deiodinase enzyme II (DIO2) has an important role in the Thyroid hormone is essential for the development of the brain and conversion of pro-hormone thyroxine (T4) to the active hormone nervous system both in the basic processes of neurogenesis and the 3,5,3¢-L-triiodothyronine (T3).
    [Show full text]
  • Skeletal Muscle Deiodinase Type 2 Regulation During Illness in Mice
    263 Skeletal muscle deiodinase type 2 regulation during illness in mice J Kwakkel, H C van Beeren, M T Ackermans1, M C Platvoet-ter Schiphorst, E Fliers, W M Wiersinga and A Boelen Department of Endocrinology and Metabolism, 1Laboratory of Endocrinology, Department of Clinical Chemistry, Academic Medical Center, University of Amsterdam, F5-165, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands (Correspondence should be addressed to J Kwakkel; Email: [email protected]) Abstract We have previously shown that skeletal muscle deiodinase During chronic inflammation the increased muscle D2 type 2 (D2) mRNA (listed as Dio2 in MGI Database) is expression is associated with the activation of the cAMP upregulated in an animal model of acute illness. However, pathway. The normalization of D2 5 days after turpentine human studies on the expression of muscle D2 during injection coincides with increased Wsb1 and tumor illness report conflicting data. Therefore, we evaluated the necrosis factor a expression. Muscle interleukin-1b (Il1b) expression of skeletal muscle D2 and D2-regulating factors expression correlated with decreased D2 mRNA expression in two mouse models of illness that differ in timing and after S. pneumoniae infection. In conclusion, muscle D2 severity of illness: 1) turpentine-induced inflammation, and expression is differentially regulated during illness, probably 2) Streptococcus pneumoniae infection. During turpentine- related to differences in the inflammatory response and type induced inflammation, D2 mRNA and activity increased of pathology. D2 mRNA and activity increases in skeletal compared to pair-fed controls, most prominently at day 1 muscle during the acute phase of chronic inflammation and 2, whereas after S.
    [Show full text]
  • Mouse Dio2 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Dio2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Dio2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Dio2 gene (NCBI Reference Sequence: NM_010050 ; Ensembl: ENSMUSG00000007682 ) is located on Mouse chromosome 12. 2 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 2 (Transcript: ENSMUST00000082432). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Dio2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-82B20 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele display elevated thyroxine (T4) and thyroid-stimulating hormone levels, changes in the metabolism and excretion of iodothyronines, and impaired adaptive thermogenesis. Exon 2 covers 72.18% of the coding region. Start codon is in exon 1, and stop codon is in exon 2. The size of intron 1 for 5'-loxP site insertion: 8072 bp. The size of effective cKO region: ~849 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy gRNA region Wildtype allele T A 5' gRNA region G 3' 1 2 Targeting vector T A G Targeted allele T A G Constitutive KO allele (After Cre recombination) Legends Exon of mouse Dio2 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Genome-Wide Association Study of Cardiac Structure and Systolic Function in African Americans the Candidate Gene Association Resource (Care) Study Ervin R
    Genome-Wide Association Study of Cardiac Structure and Systolic Function in African Americans The Candidate Gene Association Resource (CARe) Study Ervin R. Fox, University of Mississippi Solomon K. Musani, University of Mississippi Maja Barbalic, University of Texas Health Science Center Honghuang Lin, Boston University Bing Yu, University of Mississippi Kofo O. Ogunyankin, Northwestern University Nicholas L. Smith, University of Washington Abdullah Kutlar, Georgia Health Sciences University Nicole L. Glazer, Boston University Wendy S. Post, Johns Hopkins University Only first 10 authors above; see publication for full author list. Journal Title: Circulation: Cardiovascular Genetics Volume: Volume 6, Number 1 Publisher: American Heart Association | 2013-02-01, Pages 37-46 Type of Work: Article | Post-print: After Peer Review Publisher DOI: 10.1161/CIRCGENETICS.111.962365 Permanent URL: https://pid.emory.edu/ark:/25593/v8g7t Final published version: http://dx.doi.org/10.1161/CIRCGENETICS.111.962365 Copyright information: © 2013 American Heart Association, Inc. Accessed September 30, 2021 9:00 PM EDT NIH Public Access Author Manuscript Circ Cardiovasc Genet. Author manuscript; available in PMC 2014 February 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Circ Cardiovasc Genet. 2013 February 1; 6(1): 37–46. doi:10.1161/CIRCGENETICS.111.962365. Genome-Wide Association Study of Cardiac Structure and Systolic Function in African Americans: The Candidate Gene Association Resource (CARe) Study Ervin R. Fox, MD1,*, Solomon K. Musani, PhD1,*, Maja Barbalic, PhD2,*, Honghuang Lin, PhD3, Bing Yu, MS1, Kofo O. Ogunyankin, MD4, Nicholas L. Smith, PhD5, Abdullah Kutlar, MD6, Nicole L. Glazer, MD3, Wendy S.
    [Show full text]
  • Importance of Thyroid Hormone Level and Genetic
    www.nature.com/scientificreports OPEN Importance of Thyroid Hormone level and Genetic Variations in Deiodinases for Patients after Acute Myocardial Infarction: A Longitudinal Observational Study Nijole Kazukauskiene1, Daina Skiriute2, Olivija Gustiene3, Julius Burkauskas4 ✉ , Violeta Zaliunaite5, Narseta Mickuviene6 & Julija Brozaitiene4 This study aimed to examine the infuence of thyroid hormone (TH) levels and genetic polymorphisms of deiodinases on long-term outcomes after acute myocardial infarction (AMI). In total, 290 patients who have experienced AMI were evaluated for demographic, clinical characteristics, risk factors, TH and NT-pro-BNP. Polymorphisms of TH related genes were included deiodinase 1 (DIO1) (rs11206244-C/T, rs12095080-A/G, rs2235544-A/C), deiodinase 2 (DIO2) (rs225015-G/A, rs225014-T/C) and deiodinase 3 (DIO3) (rs945006-T/G). Both all-cause and cardiac mortality was considered key outcomes. Cox regression model showed that NT-pro-BNP (HR = 2.11; 95% CI = 1.18– 3.78; p = 0.012), the frst quartile of fT3, and DIO1 gene rs12095080 were independent predictors of cardiac-related mortality (HR = 1.74; 95% CI = 1.04–2.91; p = 0.034). The DIO1 gene rs12095080 AG genotype (OR = 3.97; 95% CI = 1.45–10.89; p = 0.005) increased the risk for cardiac mortality. Lower fT3 levels and the DIO1 gene rs12095080 are both associated with cardiac-related mortality after AMI. Recent clinical research in cardiovascular disease as well as in coronary artery disease (CAD) has provided evi- dence that altered thyroid hormone (TH) metabolism, including low total triiodothyronine (T3) syndrome or pre-existing subclinical primary hypothyroidism, is an important indicator of adverse short-term and long-term outcomes, including mortality1–5.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name WD repeat domain, phosphoinositide interacting 1 Gene Symbol WIPI1 Organism Human Gene Summary WD40 repeat proteins are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins such as WIPI1 have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids (Proikas-Cezanne et al. 2004 Gene Aliases ATG18, ATG18A, FLJ10055, WIPI49 RefSeq Accession No. NC_000017.10, NT_010783.15 UniGene ID Hs.463964 Ensembl Gene ID ENSG00000070540 Entrez Gene ID 55062 Assay Information Unique Assay ID qHsaCIP0030544 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000262139, ENST00000546360 Amplicon Context Sequence TTCTCATCATGACTGCTTCGTTTTGCCCTTCTGATTTCCACGGCACAAGATTATAG GAGGAAACTCATTCTCATCATCAAGACACACTGGTCCCGTCGCAAACTCATGTTC AGGAATAA Amplicon Length (bp) 89 Chromosome Location 17:66417908-66422280 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9995 cDNA Cq 21.43 cDNA Tm (Celsius) 80.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 35.07 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report WIPI1, Human Amplification Plot Amplification of cDNA
    [Show full text]
  • Targeting Melanoma-Initiating Cells by Caffeine: in Silico and in Vitro Approaches
    molecules Article Targeting Melanoma-Initiating Cells by Caffeine: In Silico and In Vitro Approaches Claudio Tabolacci 1,* , Martina Cordella 1, Stefania Rossi 1 , Marialaura Bonaccio 2 , Adriana Eramo 1, Carlo Mischiati 3 , Simone Beninati 4 , Licia Iacoviello 2,5 , Antonio Facchiano 6,† and Francesco Facchiano 1,† 1 Department of Oncology and Molecular Medicine, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy; [email protected] (M.C.); [email protected] (S.R.); [email protected] (A.E.); [email protected] (F.F.) 2 Department of Epidemiology and Prevention, IRCCS Neuromed, 86077 Pozzilli, Italy; [email protected] (M.B.); [email protected] (L.I.) 3 Department of Neuroscience and Rehabilitation, School of Medicine, University of Ferrara, 44121 Ferrara, Italy; [email protected] 4 Department of Biology, University of Rome Tor Vergata, 00133 Rome, Italy; [email protected] 5 Department of Medicine and Surgery, Research Center in Epidemiology and Preventive Medicine (EPIMED), University of Insubria, 21100 Varese-Como, Italy 6 Laboratory of Molecular Oncology, IDI-IRCCS, 00167 Rome, Italy; [email protected] * Correspondence: [email protected] † These authors contributed equally to this work. Abstract: The beneficial effects of coffee on human diseases are well documented, but the molecular mechanisms of its bioactive compounds on cancer are not completely elucidated. This is likely due to the large heterogeneity of coffee preparations and different coffee-based beverages, but also to Citation: Tabolacci, C.; Cordella, M.; the choice of experimental models where proliferation, differentiation and immune responses are Rossi, S.; Bonaccio, M.; Eramo, A.; differently affected.
    [Show full text]
  • Mice with Targeted Disruption of the Dio2 Gene Have
    Mice with Targeted Disruption of the Dio2 Gene Have Cold-Induced Overexpression of the Uncoupling Protein 1 Gene but Fail to Increase Brown Adipose Tissue Lipogenesis and Adaptive Thermogenesis Marcelo A. Christoffolete,1 Camila C.G. Linardi,2 Lucia de Jesus,1 Katia Naomi Ebina,3 Suzy D. Carvalho,2 Miriam O. Ribeiro,4 Rogerio Rabelo,2 Cyntia Curcio,1 Luciane Martins,3 Edna T. Kimura,3 and Antonio C. Bianco1 The Dio2 gene encodes the type 2 deiodinase (D2) that activates thyroxine (T4) to 3,3؅,5-triiodothyronine -T3), the disruption of which (Dio2؊/؊) results in brown dequate quantities of thyroid hormone are re) adipose tissue (BAT)-specific hypothyroidism in an oth- quired for the maintenance of basal energy erwise euthyroid animal. In the present studies, cold expenditure (1,2) and are also critical for ad- exposure increased Dio2؊/؊ BAT sympathetic stimula- A justments in energy homeostasis during acute tion ϳ10-fold (normal ϳ4-fold); as a result, lipolysis, as exposure to cold, without which survival is not possible well as the mRNA levels of uncoupling protein 1, (3). These adjustments in nonshivering adaptive thermo- guanosine monophosphate reductase, and peroxisome genesis are initiated by an increase in the activity of the proliferator–activated receptor ␥ coactivator 1, in- sympathetic nervous system (SNS). In human newborns creased well above the levels detected in the cold- ؊/؊ and other small mammals, brown adipose tissue (BAT) is exposed wild-type animals. The sustained Dio2 BAT the main site of the sympathetic-mediated adaptive ther- adrenergic hyperresponse suppressed the three- to mogenesis. During cold exposure, there is an acute ϳ50- fourfold stimulation of BAT lipogenesis normally seen fold increase in type 2 iodothyronine deiodinase (D2) after 24–48 h in the cold.
    [Show full text]
  • Molecular Cloning, Expression and Radiation Hybrid Mapping of the Bovine Deiodinase Type II (DIO2) and Deiodinase Type III (DIO3) Genes1
    SHORT COMMUNICATION doi:10.1111/j.1365-2052.2005.01282.x Molecular cloning, expression and radiation hybrid mapping of the bovine deiodinase type II (DIO2) and deiodinase type III (DIO3) genes1 E. E. Connor*, E. C. Laiakis*, V. M. Fernandes*, J. L. Williams† and A. V. Capuco* *Beltsville Agricultural Research Center, ARS, USDA, 10300 Baltimore Ave., Beltsville, MD 20705, USA. †Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, UK Summary Thyroid hormones play a critical role in mammalian development and metabolism. Their activity is regulated in a complex, tissue-specific manner by three isoforms of deiodinases. The goal of this study was to sequence the full-length bovine type II deiodinase (DIO2) and type III deiodinase (DIO3) cDNAs and characterize mRNA expression levels of each of the three deiodinase isoforms in several bovine tissues. Sequencing of bovine DIO2 and DIO3 cDNAs revealed a high degree of predicted amino acid sequence identity with their orthologs in other mammalian species and demonstrated the conservation of selenocysteine residues within the catalytic domains of both bovine proteins. Bovine DIO2 and DIO3 were posi- tioned on chromosomes 10 and 21, respectively, by radiation hybrid mapping. Expression patterns of the three deiodinase isoforms were similar for deiodinase type I (DIO1) and DIO2 to those observed in other species. Expression level of DIO3 transcripts was greatest in mammary gland and kidney, although low-level expression was detected in most tissues sampled. Results of this work will aid in the study of deiodinase gene expression and thyroid hormone regulation in cattle. Keywords deiodinase, gene expression, gene mapping, thyroid hormone metabolism.
    [Show full text]