sign in sign up
<<
Home , Bolinopsidae, Cepheidae (jellyfish), Chrysaora, Chrysaora hysoscella, Cotylorhiza, Discomedusae

BioInvasions Records (2020) Volume 9, Issue 3: 482–489

CORRECTED PROOF

Rapid Communication First record of a non-native pelagiid (: : ) in the easternmost

Jacob Douek1, Guy Paz1, Baruch Rinkevich1, Roy Gevili2 and Bella S. Galil3,* 1Israel Oceanographic & Limnological Research, National Institute of Oceanography, Haifa 31080, Israel 2Rogozin 54/26 Ashdod 77440, Israel 3Steinhardt Museum of Natural History, Tel Aviv University, Tel Aviv 69978, Israel. Author e-mails: [email protected] (JD), [email protected] (GP), [email protected] (BR), [email protected] (RG), [email protected] (BSG) *Corresponding author

Citation: Douek J, Paz G, Rinkevich B, Gevili R, Galil BS (2020) First record of a Abstract non-native pelagiid jellyfish (Scyphozoa: Pelagiidae: Chrysaora) in the easternmost A single specimen of a pelagiid jellyfish collected next to Ashdod port, Israel, is Mediterranean Sea. BioInvasions Records referred to the Chrysaora Péron and Lesueur, 1810 based on molecular 9(3): 482–489, https://doi.org/10.3391/bir. examinations. Despite the inability to check morphological features of diagnostic 2020.9.3.04 value, molecular analyses based on the mitochondrial barcoding gene cytochrome Received: 17 December 2019 oxidase sub unit I (COI), 16S and 28S ribosomal DNA reveal marked dissimilarities Accepted: 21 June 2020 from both the Northeast Atlantic-Mediterranean native Published: 2 July 2020 (Linnaeus, 1767) and the closest GeneBank/BoLD available congener, the West African C. africana (Vanhöffen, 1902). It is suggested that the is new to Handling editor: Charles Martin science and non-native to the Mediterranean Sea, possibly the sixth introduced Thematic editor: April Blakeslee scyphozoan species reported in the Levant Sea. Copyright: © Douek et al. This is an open access article distributed under terms of the Creative Commons Attribution License Key words: scyphomedusae, Chrysaora pseudoocellata, alien species, molecular (Attribution 4.0 International - CC BY 4.0). tools, Levant Sea, citizen science OPEN ACCESS. Introduction For much of the previous century little attention had been paid to scyphozoan jellyfish in the easternmost Mediterranean Sea (Galil et al. 1990). As long as their impacts were inconspicuous, induced no direct economic cost or impinged on human welfare, jellyfish were ignored by local scientists, conservationists, policy makers and managers. However, in the 1980s the rapid spread and injurious impacts of the invasive Erythraean Rhopilema nomadica Galil, 1990 (Galil et al. 1990), helped raise awareness of the impacts of jellyfish. Recognizing the importance of monitoring the annual Rhopilema jellyfish swarms, a network of lifeguards, commercial fishermen, environmental wardens and members of the public whose interest was raised by articles in the popular media have kept track of jellyfish off the Mediterranean coast of Israel (Galil et al. 2017 and refs therein). These early “citizen science” surveys joined in 2001 the Mediterranean- wide CIESM JellyWatch Program (http://www.ciesm.org/marine/programs/ jellywatch.htm). These surveys proved to be a useful tool for monitoring

Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 482 Non-native Chrysaora sp. off Israel

Figure 1. Chrysaora sp. specimen freshly collected off Ashdod, Israel, July 2019. Photo: R. Gevili.

both the spatial and temporal extent of Rhopilema swarms and the occurrence of gelatinous species, both native and non-native (Galil and Gevili 2013; Galil et al. 2009a, b, 2010, 2011, 2014, 2017) – proving it the most successful citizen science initiative tracking the Israeli marine environment. Here we report the presence of a previously unrecorded scyphozoan jellyfish species off the Mediterranean coast of Israel. Nuclear (28S rDNA), mitochondrial (cytochrome oxidase subunit I [COI]) and 16S ribosomal DNA markers were compared with scyphozoan sequences available in GenBank and BoLD and supported the specimen’s placement in the pelagiid genus Chrysaora Péron and Lesueur, 1810. The new finding is presumably the sixth non-native scyphozoan species recorded in the southeastern Mediterranean Sea, including andromeda Forskål, 1775 (Spanier 1989), erythraea Stiasny, 1920 (Galil et al. 2017), stellata Galil & Gershwin, 2010 (Galil et al. 2010), Phyllorhiza punctata von Lendenfeld, 1884 (Galil et al. 1990), and Rhopilema nomadica Galil, 1990 (Galil et al. 1990).

Materials and methods Study site and sampling Identification was based on freshly collected material (Figure 1). The specimen (umbrella diameter 7–9 cm) was sampled on July 11, 2019, near Ashdod Port, Israel (31.794°N; 34.628°E), and transported freshly frozen to the National Institute of Oceanography, Haifa.

Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 483 Non-native Chrysaora sp. off Israel

Table 1. Primers details for the PCR amplifications. Gene Primer name Sequence References COI HCO2198r 5’ TAAACTTCAGGGTGACCAAAAAATCA 3’ Folmer et al. (1994) COI LCO1490f 5’ CGTCAACAAATCATAAAGATATTGG 3’ Folmer et al. (1994) 28S Aa_L28S21 5' GAACRGCTCAAGCTTRAAATCT 3' Bayha et al. (2010) 28S Aa_H28S1078 5' GAAACTTCGGAGGGAACCAGCTAC 3' Bayha et al. (2010) 16S 16S-L 5' GACTGTTTACCAAAAACATA 3' Ender and Schierwater (2003) 16S Aa_H16S_1541H 5' AGATTTTAATGGTCGAACAGAC 3' Bayha et al. (2010)

DNA extraction A tissue sample (0.5 cm3) was placed in 200 μl of RNA Save (cat: 01-891-1B, Biological Industry, Beit Haemek, Israel), followed by DNA extraction using MasterPure™ RNA purification kit (cat: MCR85102, Epicentre, Medison WI, USA) according to manufacture instructions, with the modification to avoid the usage of DNAase during the nucleic acid extraction steps. DNA was resuspended in 40 μl of nuclease free DDW.

PCR amplification All PCR amplifications, for the mitochondrial cytochrome C oxidase subunit I (COI), 16S and 28S ribosomal DNA large subunit, were performed in 40 μl of reaction mixtures containing 1 μl of the extracted DNA, 20 μl of 2× Taq PCR MasterMix (cat: KT121221, Tiangen, Beijing, China) and 5 μM of each forward and reverse primers (Table 1). Reaction conditions (for all sets of primers) were as follows: 95 C for 5 min followed by 35 cycles of 95 C for 1 min, 45 C for 1 min and 72 C for 1 min and additional elongation step of 72 C for 10 min. The PCR products were screened on a 1.2% agarose gel. The PCR primers were further used for direct sequencing of the PCR products (Macrogen Inc, South Korea).

Sequence analyses Forward and reverse sequences of the PCR products were aligned and corrected using DNA baser 4.12.0 (DNA Baser Sequence Assembler v4 [2013], Heracle BioSoft, www.DnaBaser.com) and BioEdit (Hall 1999). The corrected sequences for the COI, 16S and 28S, were, in the first step compared online to the GenBank database by BLAST comparison (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and to the BoLD platform (Barcode of Life Data Systems) identification system (http://v4.boldsystems.org/ index.php/IDS_OpenIdEngine) for the COI gene. Then, all available COI, 16S and 28S gene sequences for the genus Chrysaora deposited in the NCBI were downloaded and compared to the COI, 16S and 28S sequences of our sample, using BioEdit and ClustalX software (Thompson et al. 1997) for multiple alignment. One to two representative sequences of COI, 16S and 28S from each Chrysaora species were selected and compared to the current sample’s sequences for constructing maximum likelihood phylogenetic trees. This was employed by the best-fit substitution model using ModelTest

Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 484 Non-native Chrysaora sp. off Israel

(Nei and Kumar 2000), implemented in MEGA version X software (Kumar et al. 2018), according to the lowest Bayesian information criteria (BIC; General Time Reversible, GTR+G+I was chosen for COI and 16S BIC 8389.998 and 6138.762 respectively and Kimura 2-parameter [K2+G], BIC- 5556.731 was chosen for the 28S gene). For all trees, 500 bootstrap replicate analysis was performed to obtain node support values. Estimates of evolutionary divergence between the selected sequences were conducted using the “p-distance method” in MAGE version X.

Barcoding, vouchers, and molecular data This study is part of the National Israeli Marine Barcoding project (BIM) at the Israel Oceanographic and Limnological research (IOLR). The data are uploaded to the IOLR site at https://isramar.ocean.org.il/IsraelBarcoding/ and to the GenBank databases at the National Center for Biotechnology Information, U.S., National Library of Medicine (NCBI) site at www.ncbi. nlm.nih.gov (accession Nos. MN927085, MN927086 and MN927087 for the COI 16S and 28S, respectively). Taxonomy, measurements, photos and the contiguous COI sequence and its trace files have been uploaded to the BoLD system database at http://v4.boldsystems.org/ as BoLD sample ID: BIM AP 090, process ID: BIM AP 759-20. The voucher has been preserved in 70% EtOH and deposited at the Steinhardt Museum of Natural History, Tel Aviv University with museum voucher ID: SMNHTAU CO37952. The DNA samples are kept at 4 °C at the National Institute of Oceanography, Haifa, Israel (IOLR).

Results Sequence analysis of the COI, 16S and the 28S PCR products revealed 590 bp, 553 bp and 893 bp length sequences, respectively. A comparison of the COI sequence with the BoLD database revealed no results. Comparisons of the three genes to the NCBI GenBank database suggested the Israeli specimen as most likely a Chrysaora species with high similarity (about 90.3% for COI, 94.4 for 16S and 98.7% for 28S) to Chrysaora africana (Vanhöffen, 1902) isolates KMB1144 and KMB1145 from the coast of Namibia (Bayha et al. 2017) and to Chrysaora sp. M0D22654H_NGXXXGGI from the Gulf of Guinea, Nigeria (Gómez-Daglio and Dawson 2017). The latter voucher was identified as C. cf. hysoscella for 16S and 28S ribosomal genes, revealing database discrepancies. The next closest species in the NCBI list, C. pacifica (Goette, 1886), revealed much lower similarities (less than 84% for COI, 91% for 16S and 96% for 28S). Using “p -distance method” in MEGA version X, we evaluated the evolutionary divergences of the Israeli new Chrysaora sp. COI, 16S and the 28S sequences, each with 1–2 representative sequences from all Chrysaora species available in the GenBank (296, 180 and 77 sequences, for COI, 16S

Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 485 Non-native Chrysaora sp. off Israel

and the 28S, respectively). Results (Supplementary material Table S1) confirmed that for all three genes, the closest species to the Israeli Chrysaora sp. is C. africana (0.097 for COI, 0.057 for 16S and 0.012 for 28S). This finding is further supported by maximum likelihood phylogenetic trees conducted in MEGA version X (Figure 2). Comparison of the COI, 16S and 28S sequences to the C. hysoscella (Linnaeus, 1767) isolates KMB1448, KMB1449 and KMB1450 (from Cork, Ireland; Bayha et al. 2017), until recently the only Chrysaora species known from the Mediterranean Sea, revealed elevated divergences (0.169, 0.114 and 0.081 respectively; Table S1) as elevated divergence between C. africana and C. hysoscella (0.174, 0.107 and 0.075, respectively, Table S1). Sequence divergence within each species is minimal (almost 0.00 for all genes; data not shown).

Discussion Chrysaora is a species-rich genus, with some species poorly described and others infrequently reported. Its taxonomy is beset by problems “…with tangled synonymies and poor definition of its boundaries” (Morandini and Marques 2010). Recently published photographs of two unidentified Chrysaora spp. from the easternmost Mediterranean suggest the possible presence of congeners to C. hysoscella, but unfortunately in neither case were the specimens collected and preserved. Chrysaora cf. achlyos was described from a photograph taken in Saronikos Gulf, Greece, and considered by Langeneck et al. (2019) as a new non-native species in the Mediterranean Sea. The Greek specimen has a uniform brown-purplish umbrella with a darker rim (Langeneck et al. 2019, Fig. 1), whereas the umbrella of the specimen collected by us off the coast of Israel bears a pattern of radial brown stripes on a lighter background. Dragičević et al. (2019, Fig. 21) provide images of a specimen encountered on July 2019 on the southern coast of Israel, at a site 20 kms distant from Ashdod Port. Its umbrella bears a pattern of dark slim radial lines similar to our specimen. They hypothesize it “…may be a new Chrysaora species that has never been described before. This, however, can only be determined after a thorough morphological and molecular analysis” (Dragičević et al. 2019: 652). The Israeli specimen is closely similar (based on three genetic regions) to C. africana, yet, the similarities obtained with the COI (90.3%), 16S (94.4%) and 28S (98.7%) suggest it is not identical to C. africana, and is clearly distinguished from the Mediterranean species, C. hysoscella. Using barcoding gap analysis, Gómez-Daglio and Dawson (2017) suggested that the mean K2P intraspecific pairwise sequence distance within the Chrysaora is 0.005 ± 0.004 and the mean interspecific distance is 0.162 ± 0.05. Our pairwise sequence distance analysis for COI resulted in a distance of 0.097 with C. africana, clearly two orders of magnitude higher than the intraspecific

Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 486 Non-native Chrysaora sp. off Israel

Figure 2. Phylogenetic trees for the Israeli Chrysaora specimen compared with 1–2 representative sequences of COI, 16S and 28S (a, b and c, respectively) from all available Chrysaora species in the GenBank. noctiluca served as the outgroup species. The phylogenetic trees were conducted in MEGA version X for each of the three genes and for 500 bootstrap replicates. * = In the NCBI this accession number is identified as C. quinquecirrha.

Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 487 Non-native Chrysaora sp. off Israel

distance, and very close to the postulated interspecific distance. These results bolster the suggestion that the Israeli specimen likely represents a species new to science. It is highly unlikely that a relatively large (umbrella diameter 7–9 cm), conspicuously patterned (Figure 1) native coastal species, markedly different from all local scyphozoans in the southern Levant Sea, would remain unknown into the 21st century. As the Southeastern Mediterranean has been inundated by non-native biota, it is likely one as well. This would not be the first case a scyphozoan species new to science has been described as an alien in the Mediterranean: Marivagia stellata was collected off the Mediterranean coast of Israel (Galil et al. 2010), but its status as an Erythraean non-native was validated a few years later with the publication of records collected in the Arabian Sea (Galil et al. 2013; Gul et al. 2014). A modelling study of the impact of offshore marine infrastructure on Aurelia spp. populations found that gas production platforms enhance connectivity between their subpopulations in the Adriatic Sea and contribute to jellyfish blooms in some areas (Vodopivec et al. 2017). Larson and Arneson (1990) considered it plausible that transportation of the sessile scyphozoan stages of Phyllorhiza punctata and Anomalorhiza shawi Light, 1921 on ship hulls is a likely dispersal method. In view of the intensive development of extensive offshore gas fields in the Levant Basin and the proximity of Ashdod port, it is plausible either commercial shipping, production platforms, platform supply vessels, drill ships or other specialty vessels, may have served as the vector. Note added at proof: Following the publication of the sequences by Mutlu et al. (2020) we conclude that the Israeli specimen is the second record of Chrysaora pseudoocellata in the Mediterranean Sea, the first validated record from the southern Levant. Similarities with the Turkish specimen: COI = 99.66% (2 bp differences), 16S = 99.27% (4 bp) and 28S = 98.4% (13 bp, 1 indel).

Acknowledgements

This research was supported by the Ministry of Energy project no. 218-17-009. We are grateful to the reviewers for their advice and encouragement.

References

Bayha KM, Dawson MN, Collins AG, Barbeitos MS, Haddock SHD (2010) Evolutionary relationships among scyphozoan jellyfish families based on complete taxon sampling and phylogenetic analyses of 18S and 28S ribosomal DNA. Integrative and Comparative Biology 50: 436–455, https://doi.org/10.1093/icb/icq074 Bayha KM, Collins AG, Gaffney PM (2017) Multigene phylogeny of the scyphozoan jellyfish family Pelagiidae reveals that the common U.S. Atlantic sea nettle comprises two distinct species ( and C. chesapeakei). PeerJ 5: e3863, https://doi.org/10.7717/peerj.3863 Dragičević B, Anadoli O, Angel D, Benabdi M, Bitar G, Castriota L, Crocetta F, Deidun A, Dulčić J, Edelist D, Gerovasileiou V, Giacobbe S, Goruppi A, Guy-Haim T, Konstantinidis, E, Kuplik Z, Langeneck J, Macali A, Manitaras I, Michailidis N, Michaloudi E, Ovalis P, Perdikaris C, Pillon R, Piraino S, Renda W, Rizgalla J, Spinelli A, Tempesti J, Tiralongo F, Tirelli V, Tsiamis K, Turan C, Uygur N, Zava B, Zenetos A (2019) New Mediterranean Biodiversity Records 2019. Mediterranean Marine Science 20: 645–656, https://doi.org/10.12681/mms.20913 Ender A, Schierwater B (2003) Placozoa are not derived cnidarians: Evidence from molecular morphology. Molecular Biology and Evolution 20: 130–134, https://doi.org/10.1093/molbev/msg018

Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 488 Non-native Chrysaora sp. off Israel

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299 Galil BS, Gevili R (2013) A moveable feast: Beroe cucumis sensu Mayer, 1912 (; Beroida; Beroidae) preying on leidyi A. Agassiz, 1865 (Ctenophora; ; Bolinopsidae) off the Mediterranean coast of Israel. BioInvasions Records 2: 191–194, https://doi.org/10. 3391/bir.2013.2.3.03 Galil BS, Spanier E, Ferguson WW (1990) The Scyphomedusae of the Mediterranean coast of Israel, including two Lessepsian migrants new to the Mediterranean. Zoologische Mededelingen 64(7): 95–105 Galil BS, Kress N, Shiganova T (2009a) First record of Mnemiopsis leidyi A. Agassiz, 1865 (Ctenophora; Lobata; Mnemiidae) off the Mediterranean coast of Israel. Aquatic Invasions 4: 356–362, https://doi.org/10.3391/ai.2009.4.2.8 Galil BS, Shoval L, Goren M (2009b) Phyllorhiza punctata (Scyphozoa: Rhizostomeae: ) reappeared off the Mediterranean coast of Israel. Aquatic Invasions 4: 481–483, https://doi.org/ 10.3391/ai.2009.4.3.6 Galil BS, Gershwin LA, Douek J, Rinkevich B (2010) Marivagia stellata gen. et sp. nov. (Scyphozoa: Rhizostomeae: ), another alien jellyfish from the Mediterranean coast of Israel. Aquatic Invasions 5: 331–340, https://doi.org/10.3391/ai.2010.5.4.01 Galil BS, Gevili R, Shiganova T (2011) Not far behind: First record of Beroe ovata Mayer 1912 (Ctenophora; Beroida; Beroidae) off the Mediterranean coast of Israel. Aquatic Invasions 6: S89– S90, https://doi.org/10.3391/ai.2011.6.S1.020 Galil BS, Kumar BA, Riyas AJ (2013) Marivagia stellata Galil and Gershwin, 2010 (Scyphozoa: Rhizostomeae: Cepheidae), found off the coast of Kerala, India. BioInvasions Records 2: 317– 318, https://doi.org/10.3391/bir.2013.2.4.09 Galil BS, Rothman S, Gevili R, Shiganova T (2014) First record of Leucothea multicornis (Quoy & Gaimard, 1825) (Ctenophora; Lobata; Leucothidae) in the Eastern Mediterranean. Marine Biodiversity Records 7: e89, https://doi.org/10.1017/S1755267214000979 Galil BS, Gershwin L-A, Zorea M, Rahav A, Rothman S B-S, Fine M, Lubinevsky H, Douek J, Paz G, Rinkevich B (2017) Cotylorhiza erythraea Stiasny, 1920 (Scyphozoa: Rhizostomeae: Cepheidae), yet another Erythraean jellyfish from the Mediterranean coast of Israel. Marine Biodiversity 47: 229–235, https://doi.org/10.1007/s12526-016-0449-6 Gómez-Daglio L, Dawson MN (2017) Species richness of (Scyphozoa: ) in the Tropical Eastern Pacific: missed taxa, molecules, and morphology match in a biodiversity hotspot. Invertebrate Systematics 31: 635–663, https://doi.org/10.1071/IS16055 Gul S, Moazzam M, Galil BS (2014) Occurrence of Marivagia stellata (Scyphozoa: Rhizostomeae: Cepheidae) along the coast of Pakistan, northern Arabian Sea. Marine Biodiversity Records 7, https://doi.org/10.1017/S1755267214001092 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series (Oxf) 41: 95–98 Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549, https://doi.org/10.1093/molbev/msy096 Langeneck J, Crocetta F, Doumpas N, Giovos I, Piraino S, Boero F (2019) First record of the non- native jellyfish Chrysaora cf. achlyos (: Pelagiidae) in the Mediterranean Sea. BioInvasions Records 8: 608–613, https://doi.org/10.3391/bir.2019.8.3.17 Larson RJ, Arneson AC (1990) Two medusae new to the coast of California: Carybdea marsupialis (Linnaeus, 1758), a cubomedusa and Phyllorhiza punctata von Ledenfeld, 1884, a rhizostome scyphomedusa. Bulletin of the Southern California Academy of Sciences 89: 130–136 Morandini AC, Marques AC (2010) Revision of the genus Chrysaora Péron & Lesueur, 1810 (Cnidaria: Scyphozoa). Zootaxa 2464: 1–97, https://doi.org/10.11646/zootaxa.2464.1.1 Mutlu E, Çağatay IT, Olguner MT, Yilmaz HE (2020) A new sea-nettle from the Eastern Mediterranean Sea: Chrysaora pseudoocellata sp. nov. (Scyphozoa, Pelagiidae). Zootaxa 4790: 229–244, https://doi.org/10.11646/zootaxa.4790.2.2 Nei M, Kumar S (2000) Molecular Evolution and Phylogenetics. Oxford University Press, New York, 332 pp Spanier E (1989) Swarming of jellyfishes along the Mediterranean coast of Israel. Israel Journal of Zoology 36(1): 55–56 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24: 4876–4882, https://doi.org/10.1093/nar/25.24.4876 Vodopivec M, Peliz ÁJ, Malej A (2017) Offshore marine constructions as propagators of moon jellyfish dispersal. Environmental Research Letters 12: 084003, https://doi.org/10.1088/1748-9326/aa75d9

Supplementary material The following supplementary material is available for this article: Table S1. Estimates of the evolutionary divergences between species. This material is available as part of online article from: http://www.reabic.net/journals/bir/2020/Supplements/BIR_2020_Douek_etal_SupplementaryMaterial.xlsx

Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 489