DOCSLIB.ORG

Scyphozoa: Pelagiidae: Chrysaora) in the Easternmost Mediterranean Sea

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Scyphozoa: Pelagiidae: Chrysaora) in the Easternmost Mediterranean Sea BioInvasions Records (2020) Volume 9, Issue 3: 482–489 CORRECTED PROOF Rapid Communication First record of a non-native pelagiid jellyfish (Scyphozoa: Pelagiidae: Chrysaora) in the easternmost Mediterranean Sea Jacob Douek1, Guy Paz1, Baruch Rinkevich1, Roy Gevili2 and Bella S. Galil3,* 1Israel Oceanographic & Limnological Research, National Institute of Oceanography, Haifa 31080, Israel 2Rogozin 54/26 Ashdod 77440, Israel 3Steinhardt Museum of Natural History, Tel Aviv University, Tel Aviv 69978, Israel. Author e-mails: [email protected] (JD), [email protected] (GP), [email protected] (BR), [email protected] (RG), [email protected] (BSG) *Corresponding author Citation: Douek J, Paz G, Rinkevich B, Gevili R, Galil BS (2020) First record of a Abstract non-native pelagiid jellyfish (Scyphozoa: Pelagiidae: Chrysaora) in the easternmost A single specimen of a pelagiid jellyfish collected next to Ashdod port, Israel, is Mediterranean Sea. BioInvasions Records referred to the genus Chrysaora Péron and Lesueur, 1810 based on molecular 9(3): 482–489, https://doi.org/10.3391/bir. examinations. Despite the inability to check morphological features of diagnostic 2020.9.3.04 value, molecular analyses based on the mitochondrial barcoding gene cytochrome Received: 17 December 2019 oxidase sub unit I (COI), 16S and 28S ribosomal DNA reveal marked dissimilarities Accepted: 21 June 2020 from both the Northeast Atlantic-Mediterranean native Chrysaora hysoscella Published: 2 July 2020 (Linnaeus, 1767) and the closest GeneBank/BoLD available congener, the West African C. africana (Vanhöffen, 1902). It is suggested that the species is new to Handling editor: Charles Martin science and non-native to the Mediterranean Sea, possibly the sixth introduced Thematic editor: April Blakeslee scyphozoan species reported in the Levant Sea. Copyright: © Douek et al. This is an open access article distributed under terms of the Creative Commons Attribution License Key words: scyphomedusae, Chrysaora pseudoocellata, alien species, molecular (Attribution 4.0 International - CC BY 4.0). tools, Levant Sea, citizen science OPEN ACCESS. Introduction For much of the previous century little attention had been paid to scyphozoan jellyfish in the easternmost Mediterranean Sea (Galil et al. 1990). As long as their impacts were inconspicuous, induced no direct economic cost or impinged on human welfare, jellyfish were ignored by local scientists, conservationists, policy makers and managers. However, in the 1980s the rapid spread and injurious impacts of the invasive Erythraean Rhopilema nomadica Galil, 1990 (Galil et al. 1990), helped raise awareness of the impacts of jellyfish. Recognizing the importance of monitoring the annual Rhopilema jellyfish swarms, a network of lifeguards, commercial fishermen, environmental wardens and members of the public whose interest was raised by articles in the popular media have kept track of jellyfish off the Mediterranean coast of Israel (Galil et al. 2017 and refs therein). These early “citizen science” surveys joined in 2001 the Mediterranean- wide CIESM JellyWatch Program (http://www.ciesm.org/marine/programs/ jellywatch.htm). These surveys proved to be a useful tool for monitoring Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 482 Non-native Chrysaora sp. off Israel Figure 1. Chrysaora sp. specimen freshly collected off Ashdod, Israel, July 2019. Photo: R. Gevili. both the spatial and temporal extent of Rhopilema swarms and the occurrence of gelatinous species, both native and non-native (Galil and Gevili 2013; Galil et al. 2009a, b, 2010, 2011, 2014, 2017) – proving it the most successful citizen science initiative tracking the Israeli marine environment. Here we report the presence of a previously unrecorded scyphozoan jellyfish species off the Mediterranean coast of Israel. Nuclear (28S rDNA), mitochondrial (cytochrome oxidase subunit I [COI]) and 16S ribosomal DNA markers were compared with scyphozoan sequences available in GenBank and BoLD and supported the specimen’s placement in the pelagiid genus Chrysaora Péron and Lesueur, 1810. The new finding is presumably the sixth non-native scyphozoan species recorded in the southeastern Mediterranean Sea, including Cassiopea andromeda Forskål, 1775 (Spanier 1989), Cotylorhiza erythraea Stiasny, 1920 (Galil et al. 2017), Marivagia stellata Galil & Gershwin, 2010 (Galil et al. 2010), Phyllorhiza punctata von Lendenfeld, 1884 (Galil et al. 1990), and Rhopilema nomadica Galil, 1990 (Galil et al. 1990). Materials and methods Study site and sampling Identification was based on freshly collected material (Figure 1). The specimen (umbrella diameter 7–9 cm) was sampled on July 11, 2019, near Ashdod Port, Israel (31.794°N; 34.628°E), and transported freshly frozen to the National Institute of Oceanography, Haifa. Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 483 Non-native Chrysaora sp. off Israel Table 1. Primers details for the PCR amplifications. Gene Primer name Sequence References COI HCO2198r 5’ TAAACTTCAGGGTGACCAAAAAATCA 3’ Folmer et al. (1994) COI LCO1490f 5’ CGTCAACAAATCATAAAGATATTGG 3’ Folmer et al. (1994) 28S Aa_L28S21 5' GAACRGCTCAAGCTTRAAATCT 3' Bayha et al. (2010) 28S Aa_H28S1078 5' GAAACTTCGGAGGGAACCAGCTAC 3' Bayha et al. (2010) 16S 16S-L 5' GACTGTTTACCAAAAACATA 3' Ender and Schierwater (2003) 16S Aa_H16S_1541H 5' AGATTTTAATGGTCGAACAGAC 3' Bayha et al. (2010) DNA extraction A tissue sample (0.5 cm3) was placed in 200 μl of RNA Save (cat: 01-891-1B, Biological Industry, Beit Haemek, Israel), followed by DNA extraction using MasterPure™ RNA purification kit (cat: MCR85102, Epicentre, Medison WI, USA) according to manufacture instructions, with the modification to avoid the usage of DNAase during the nucleic acid extraction steps. DNA was resuspended in 40 μl of nuclease free DDW. PCR amplification All PCR amplifications, for the mitochondrial cytochrome C oxidase subunit I (COI), 16S and 28S ribosomal DNA large subunit, were performed in 40 μl of reaction mixtures containing 1 μl of the extracted DNA, 20 μl of 2× Taq PCR MasterMix (cat: KT121221, Tiangen, Beijing, China) and 5 μM of each forward and reverse primers (Table 1). Reaction conditions (for all sets of primers) were as follows: 95 C for 5 min followed by 35 cycles of 95 C for 1 min, 45 C for 1 min and 72 C for 1 min and additional elongation step of 72 C for 10 min. The PCR products were screened on a 1.2% agarose gel. The PCR primers were further used for direct sequencing of the PCR products (Macrogen Inc, South Korea). Sequence analyses Forward and reverse sequences of the PCR products were aligned and corrected using DNA baser 4.12.0 (DNA Baser Sequence Assembler v4 [2013], Heracle BioSoft, www.DnaBaser.com) and BioEdit (Hall 1999). The corrected sequences for the COI, 16S and 28S, were, in the first step compared online to the GenBank database by BLAST comparison (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and to the BoLD platform (Barcode of Life Data Systems) identification system (http://v4.boldsystems.org/ index.php/IDS_OpenIdEngine) for the COI gene. Then, all available COI, 16S and 28S gene sequences for the genus Chrysaora deposited in the NCBI were downloaded and compared to the COI, 16S and 28S sequences of our sample, using BioEdit and ClustalX software (Thompson et al. 1997) for multiple alignment. One to two representative sequences of COI, 16S and 28S from each Chrysaora species were selected and compared to the current sample’s sequences for constructing maximum likelihood phylogenetic trees. This was employed by the best-fit substitution model using ModelTest Douek et al. (2020), BioInvasions Records 9(3): 482–489, https://doi.org/10.3391/bir.2020.9.3.04 484 Non-native Chrysaora sp. off Israel (Nei and Kumar 2000), implemented in MEGA version X software (Kumar et al. 2018), according to the lowest Bayesian information criteria (BIC; General Time Reversible, GTR+G+I was chosen for COI and 16S BIC 8389.998 and 6138.762 respectively and Kimura 2-parameter [K2+G], BIC- 5556.731 was chosen for the 28S gene). For all trees, 500 bootstrap replicate analysis was performed to obtain node support values. Estimates of evolutionary divergence between the selected sequences were conducted using the “p-distance method” in MAGE version X. Barcoding, vouchers, taxonomy and molecular data This study is part of the National Israeli Marine Barcoding project (BIM) at the Israel Oceanographic and Limnological research (IOLR). The data are uploaded to the IOLR site at https://isramar.ocean.org.il/IsraelBarcoding/ and to the GenBank databases at the National Center for Biotechnology Information, U.S., National Library of Medicine (NCBI) site at www.ncbi. nlm.nih.gov (accession Nos. MN927085, MN927086 and MN927087 for the COI 16S and 28S, respectively). Taxonomy, measurements, photos and the contiguous COI sequence and its trace files have been uploaded to the BoLD system database at http://v4.boldsystems.org/ as BoLD sample ID: BIM AP 090, process ID: BIM AP 759-20. The voucher has been preserved in 70% EtOH and deposited at the Steinhardt Museum of Natural History, Tel Aviv University with museum voucher ID: SMNHTAU CO37952. The DNA samples are kept at 4 °C at the National Institute of Oceanography, Haifa, Israel (IOLR). Results Sequence analysis of the COI, 16S and the 28S PCR products revealed 590 bp, 553 bp and 893 bp length sequences, respectively. A comparison of the COI sequence with the BoLD database revealed no results. Comparisons of the three genes to the NCBI GenBank database suggested the Israeli specimen as most likely a Chrysaora species with high similarity (about 90.3% for COI, 94.4 for 16S and 98.7% for 28S) to Chrysaora africana (Vanhöffen, 1902) isolates KMB1144 and KMB1145 from the coast of Namibia (Bayha et al. 2017) and to Chrysaora sp. M0D22654H_NGXXXGGI from the Gulf of Guinea, Nigeria (Gómez-Daglio and Dawson 2017). The latter voucher was identified as C.
Load more

Recommended publications
  • Research Funding (Total $2,552,481) $15,000 2019
    CURRICULUM VITAE TENNESSEE AQUARIUM CONSERVATION INSTITUTE 175 BAYLOR SCHOOL RD CHATTANOOGA, TN 37405 RESEARCH FUNDING (TOTAL $2,552,481) $15,000 2019. Global Wildlife Conservation. Rediscovering the critically endangered Syr-Darya Shovelnose Sturgeon. $10,000 2019. Tennessee Wildlife Resources Agency. Propagation of the Common Logperch as a host for endangered mussel larvae. $8,420 2019. Tennessee Wildlife Resources Agency. Monitoring for the Laurel Dace. $4,417 2019. Tennessee Wildlife Resources Agency. Examining interactions between Laurel Dace (Chrosomus saylori) and sunfish $12,670 2019. Trout Unlimited. Southern Appalachian Brook Trout propagation for reintroduction to Shell Creek. $106,851 2019. Private Donation. Microplastic accumulation in fishes of the southeast. $1,471. 2019. AZFA-Clark Waldram Conservation Grant. Mayfly propagation for captive propagation programs. $20,000. 2019. Tennessee Valley Authority. Assessment of genetic diversity within Blotchside Logperch. $25,000. 2019. Riverview Foundation. Launching Hidden Rivers in the Southeast. $11,170. 2018. Trout Unlimited. Propagation of Southern Appalachian Brook Trout for Supplemental Reintroduction. $1,471. 2018. AZFA Clark Waldram Conservation Grant. Climate Change Impacts on Headwater Stream Vertebrates in Southeastern United States $1,000. 2018. Hamilton County Health Department. Step 1 Teaching Garden Grants for Sequoyah School Garden. $41,000. 2018. Riverview Foundation. River Teachers: Workshops for Educators. $1,000. 2018. Tennessee Valley Authority. Youth Freshwater Summit $20,000. 2017. Tennessee Valley Authority. Lake Sturgeon Propagation. $7,500 2017. Trout Unlimited. Brook Trout Propagation. $24,783. 2017. Tennessee Wildlife Resource Agency. Assessment of Percina macrocephala and Etheostoma cinereum populations within the Duck River Basin. $35,000. 2017. U.S. Fish and Wildlife Service. Status surveys for conservation status of Ashy (Etheostoma cinereum) and Redlips (Etheostoma maydeni) Darters.
    [Show full text]
  • Title the SYSTEMATIC POSITION of the STAUROMEDUSAE Author(S
    THE SYSTEMATIC POSITION OF THE Title STAUROMEDUSAE Author(s) Uchida, Tohru PUBLICATIONS OF THE SETO MARINE BIOLOGICAL Citation LABORATORY (1973), 20: 133-139 Issue Date 1973-12-19 URL http://hdl.handle.net/2433/175784 Right Type Departmental Bulletin Paper Textversion publisher Kyoto University THE SYSTEMATIC POSITION OF THE STAUROMEDUSAE ToHRU UCHIDA Biological Laboratory, Imperial Household, Tokyo With 2 Text-figures The Stauromedusae have hitherto been referred together with the Cubomedusae to the subclass Scyphostomidae in the Scyphomedusae. Recently, however, the life cycle of the cubomedusa, Tripedalia cystophora became clear by WERNER, CuTRESS and STUDEBACKER (1971) and it was established that the Cubomedusae only stand in a quite separate position from other orders of Scyphomedusae. On the other hand, WERNER who published several papers on the Scyphozoan polyp, Stephanoscyphus (1966-1971) laid stress on the fact that Stephanoscyphus can be linked directly with the extinct fossil group of the Conulata and concluded that the Coronatae represent the most basic group of all living Scyphomedusae with the exception of Cubomedusae. Such being the case, the systematic position of the Stauromedusae remains proble­ matical. The present writer is of the opinion that the Stauromedusae are to be entitled to the Ephyridae and are closely related to the Discomedusae, though there occurs no strobilation in the order. The body of Stauromedusae is composed of two parts; the upper octomerous medusan part and the lower tetramerous scyphistoma portion. No strobilation and no ephyra. Throughout their life history, they lack pelagic life entirely; an egg develops to the solid blastula, which becomes to the planula.
    [Show full text]
  • Scyphomedusae of the North Atlantic (2)
    FICHES D’IDENTIFICATION DU ZOOPLANCTON Edittes par J. H. F-RASER Marine Laboratory, P.O. Box 101, Victoria Road Aberdeen AB9 8DB, Scotland FICHE NO. 158 SCYPHOMEDUSAE OF THE NORTH ATLANTIC (2) Families : Pelagiidae Cyaneidae Ulmaridae Rhizostomatidae by F. S. Russell Marine Biological Association The Laboratory, Citadel Hill Plymouth, Devon PL1 2 PB, England (This publication may be referred to in the following form: Russell, F. S. 1978. Scyphomedusae of the North Atlantic (2) Fich. Ident. Zooplancton 158: 4 pp.) https://doi.org/10.17895/ices.pub.5144 Conseil International pour 1’Exploration de la Mer Charlottenlund Slot, DK-2920 Charlottenlund Danemark MA1 1978 2 1 2 3' 4 6 5 Figures 1-6: 1. Pelagia noctiluca; 2. Chtysaora hysoscella; 3. Cyanea capillata; 3'. circular muscle; 4. Cyanea lamarckii - circular muscle; 5. Aurelia aurita; 6. Rhizostoma octopus. 3 Order S E M AE 0 ST0 M E AE Gastrovascular sinus divided by radial septa into separate rhopalar and tentacular pouches; without ring-canal. Family Pelagiidae Rhopalar and tentacular pouches simple and unbranched. Genus Pelagia PCron & Lesueur Pelagiidae with eight marginal tentacles alternating with eight marginal sense organs. 1. Pelugiu nocfilucu (ForskB1). Exumbrella with medium-sized warts of various shapes; marginal tentacles with longitudinal muscle furrows embedded in mesogloea; up to 100 mm in diameter. Genus Chrysaora Ptron & Lesueur Pelagiidae with groups of three or more marginal tentacles alternating with eight marginal sense organs. 2. Chrysuoru hysoscellu (L.). Exumbrella typically with 16 V-shaped radial brown markings with varying degrees of pigmentation between them; with dark brown apical circle or spot; with brown marginal lappets; 24 marginal tentacles in groups of three alternating with eight marginal sense organs.
    [Show full text]
  • Bioinvasions in the Mediterranean Sea 2 7
    Metamorphoses: Bioinvasions in the Mediterranean Sea 2 7 B. S. Galil and Menachem Goren Abstract Six hundred and eighty alien marine multicellular species have been recorded in the Mediterranean Sea, with many establishing viable populations and dispersing along its coastline. A brief history of bioinvasions research in the Mediterranean Sea is presented. Particular attention is paid to gelatinous invasive species: the temporal and spatial spread of four alien scyphozoans and two alien ctenophores is outlined. We highlight few of the dis- cernible, and sometimes dramatic, physical alterations to habitats associated with invasive aliens in the Mediterranean littoral, as well as food web interactions of alien and native fi sh. The propagule pressure driving the Erythraean invasion is powerful in the establishment and spread of alien species in the eastern and central Mediterranean. The implications of the enlargement of Suez Canal, refl ecting patterns in global trade and economy, are briefl y discussed. Keywords Alien • Vectors • Trends • Propagule pressure • Trophic levels • Jellyfi sh • Mediterranean Sea Brief History of Bioinvasion Research came suddenly with the much publicized plans of the in the Mediterranean Sea Saint- Simonians for a “Canal de jonction des deux mers” at the Isthmus of Suez. Even before the Suez Canal was fully The eminent European marine naturalists of the sixteenth excavated, the French zoologist Léon Vaillant ( 1865 ) argued century – Belon, Rondelet, Salviani, Gesner and Aldrovandi – that the breaching of the isthmus will bring about species recorded solely species native to the Mediterranean Sea, migration and mixing of faunas, and advocated what would though mercantile horizons have already expanded with be considered nowadays a ‘baseline study’.
    [Show full text]
  • Cnidaria: Cubozoa and Scyphozoa) from the Coast of Rio Grande Do Norte State, Northeast of Brazil
    Check List 5(1): 133–138, 2009. ISSN: 1809-127X LISTS OF SPECIES Neritic Jellyfishes (Cnidaria: Cubozoa and Scyphozoa) from the coast of Rio Grande do Norte state, northeast of Brazil Marcelo de Oliveira Soares 1, 4 André Carrara Morandini 2 Helena Matthews-Cascon 3 1 Universidade Federal do Rio Grande do Sul, Instituto de Geociências, Departamento de Paleontologia e Estratigrafia. CEP 91509-900. Porto Alegre, Rio Grande do Sul, Brazil. E-mail: [email protected] 2 Universidade Federal do Rio de Janeiro, Núcleo em Ecologia e Desenvolvimento Sócio-Ambiental de Macaé. Caixa Postal 119331. CEP 27910-970. Macaé, Rio de Janeiro, Brazil. 3 Universidade Federal do Ceará, Departamento de Biologia. CEP 60451-970. Fortaleza, Ceará, Brazil. 4. Universidade Federal do Piauí, Centro de Ciências da Natureza, Departamento de Ciências Naturais e Arqueologia. CEP 64049-550. Teresina, Piauí, Brazil. Abstract For the entire Brazilian coast, there are 22 published records of scyphozoans. On the other hand, only 35 species of cubozoans were described worldwide, four of them reported for the Brazilian coast. However, little is known about the species of cubozoans and scyphozoans in the Northeastern states of Brazil. The aim of this study was to perform a survey of the jellyfish (Cnidaria: Cubozoa and Scyphozoa) on the coast of Rio Grande do Norte state, Northeast of Brazil. Specimens were collected using trawl net on beaches in the counties of Natal (in 2003) and Tibaú (in 2004). For the Rio Grande do Norte coast there were few records of large jellyfish, and new records of the following cubozoan and scyphozoan species were verified: Chiropsalmus quadrumanus; Chrysaora lactea; Lychnorhiza lucerna and Stomolophus meleagris.
    [Show full text]
  • Pulse Perturbations from Bacterial Decomposition of Chrysaora Quinquecirrha (Scyphozoa: Pelagiidae)
    Hydrobiologia DOI 10.1007/s10750-012-1042-z JELLYFISH BLOOMS Pulse perturbations from bacterial decomposition of Chrysaora quinquecirrha (Scyphozoa: Pelagiidae) Jessica R. Frost • Charles A. Jacoby • Thomas K. Frazer • Andrew R. Zimmerman Ó Springer Science+Business Media B.V. 2012 Abstract Bacteria decomposed damaged and mor- become dominant, and cocci reproduced at a rate that ibund Chrysaora quinquecirrha Desor, 1848 releasing was 30% slower. These results, and those from a pulse of carbon and nutrients. Tissue decomposed in previous studies, suggested that natural assemblages 5–8 days, with 14 g of wet biomass exhibiting a half- may include bacteria that decompose medusae, as well life of 3 days at 22°C, which is 39 longer than as bacteria that benefit from the subsequent release of previous reports. Decomposition raised mean concen- carbon and nutrients. This experiment also indicated trations of organic carbon and nutrients above controls that proteins and other nitrogenous compounds are less by 1–2 orders of magnitude. An increase in nitrogen labile in damaged medusae than in dead or homoge- (16,117 lgl-1) occurred 24 h after increases in nized individuals. Overall, dense patches of decom- phosphorus (1,365 lgl-1) and organic carbon posing medusae represent an important, but poorly (25 mg l-1). Cocci dominated control incubations, documented, component of the trophic shunt that with no significant increase in numbers. In incubations diverts carbon and nutrients incorporated by gelati- of tissue, bacilli increased exponentially after 6 h to nous zooplankton into microbial trophic webs. Keywords Jellyfish Á Scyphomedusae Á Bacterial Guest editors: J. E.
    [Show full text]
  • Towards the Acoustic Estimation of Jellyfish Abundance
    MARINE ECOLOGY PROGRESS SERIES Vol. 295: 105–111, 2005 Published June 23 Mar Ecol Prog Ser Towards the acoustic estimation of jellyfish abundance Andrew S. Brierley1,*, David C. Boyer2, 6, Bjørn E. Axelsen3, Christopher P. Lynam1, Conrad A. J. Sparks4, Helen J. Boyer2, Mark J. Gibbons5 1Gatty Marine Laboratory, University of St. Andrews, Fife KY16 8LB, UK 2National Marine Information and Research Centre, PO Box 912, Swakopmund, Namibia 3Institute of Marine Research, PO Box 1870 Nordnes, 5817 Bergen, Norway 4Faculty of Applied Sciences, Cape Technikon, PO Box 652, Cape Town 8000, South Africa 5Zoology Department, University of Western Cape, Private Bag X 17, Bellville 7535, South Africa 6Present address: Fisheries & Environmental Research Support, Orchard Farm, Cockhill, Castle Cary, Somerset BA7 7NY, UK ABSTRACT: Acoustic target strengths (TSs) of the 2 most common large medusae, Chrysaora hysoscella and Aequorea aequorea, in the northern Benguela (off Namibia) have previously been estimated (at 18, 38 and 120 kHz) from acoustic data collected in conjunction with trawl samples, using the ‘comparison method’. These TS values may have been biased because the method took no account of acoustic backscatter from mesozooplankton. Here we report our efforts to improve upon these estimates, and to determine TS additionally at 200 kHz, by conducting additional sampling for mesozooplankton and fish larvae, and accounting for their likely contribution to the total backscatter. Published sound scattering models were used to predict the acoustic backscatter due to the observed numerical densities of mesozooplankton and fish larvae (solving the forward problem). Mean volume backscattering due to jellyfish alone was then inferred by subtracting the model-predicted values from the observed water-column total associated with jellyfish net samples.
    [Show full text]
  • Pelagia Benovici Sp. Nov. (Cnidaria, Scyphozoa): a New Jellyfish in the Mediterranean Sea
    Zootaxa 3794 (3): 455–468 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3794.3.7 http://zoobank.org/urn:lsid:zoobank.org:pub:3DBA821B-D43C-43E3-9E5D-8060AC2150C7 Pelagia benovici sp. nov. (Cnidaria, Scyphozoa): a new jellyfish in the Mediterranean Sea STEFANO PIRAINO1,2,5, GIORGIO AGLIERI1,2,5, LUIS MARTELL1, CARLOTTA MAZZOLDI3, VALENTINA MELLI3, GIACOMO MILISENDA1,2, SIMONETTA SCORRANO1,2 & FERDINANDO BOERO1, 2, 4 1Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Università del Salento, 73100 Lecce, Italy 2CoNISMa, Consorzio Nazionale Interuniversitario per le Scienze del Mare, Roma 3Dipartimento di Biologia e Stazione Idrobiologica Umberto D’Ancona, Chioggia, Università di Padova. 4 CNR – Istituto di Scienze Marine, Genova 5Corresponding authors: [email protected], [email protected] Abstract A bloom of an unknown semaestome jellyfish species was recorded in the North Adriatic Sea from September 2013 to early 2014. Morphological analysis of several specimens showed distinct differences from other known semaestome spe- cies in the Mediterranean Sea and unquestionably identified them as belonging to a new pelagiid species within genus Pelagia. The new species is morphologically distinct from P. noctiluca, currently the only recognized valid species in the genus, and from other doubtful Pelagia species recorded from other areas of the world. Molecular analyses of mitochon- drial cytochrome c oxidase subunit I (COI) and nuclear 28S ribosomal DNA genes corroborate its specific distinction from P. noctiluca and other pelagiid taxa, supporting the monophyly of Pelagiidae. Thus, we describe Pelagia benovici sp.
    [Show full text]
  • Assessing the Impact of Key Marine Invasive Non-Native Species on Welsh MPA Habitat Features, Fisheries and Aquaculture
    Assessing the impact of key Marine Invasive Non-Native Species on Welsh MPA habitat features, fisheries and aquaculture. Tillin, H.M., Kessel, C., Sewell, J., Wood, C.A. Bishop, J.D.D Marine Biological Association of the UK Report No. 454 Date www.naturalresourceswales.gov.uk About Natural Resources Wales Natural Resources Wales’ purpose is to pursue sustainable management of natural resources. This means looking after air, land, water, wildlife, plants and soil to improve Wales’ well-being, and provide a better future for everyone. Evidence at Natural Resources Wales Natural Resources Wales is an evidence based organisation. We seek to ensure that our strategy, decisions, operations and advice to Welsh Government and others are underpinned by sound and quality-assured evidence. We recognise that it is critically important to have a good understanding of our changing environment. We will realise this vision by: Maintaining and developing the technical specialist skills of our staff; Securing our data and information; Having a well resourced proactive programme of evidence work; Continuing to review and add to our evidence to ensure it is fit for the challenges facing us; and Communicating our evidence in an open and transparent way. This Evidence Report series serves as a record of work carried out or commissioned by Natural Resources Wales. It also helps us to share and promote use of our evidence by others and develop future collaborations. However, the views and recommendations presented in this report are not necessarily those of
    [Show full text]
  • Biological Interactions Between Fish and Jellyfish in the Northwestern Mediterranean
    Biological interactions between fish and jellyfish in the northwestern Mediterranean Uxue Tilves Barcelona 2018 Biological interactions between fish and jellyfish in the northwestern Mediterranean Interacciones biológicas entre meduas y peces y sus implicaciones ecológicas en el Mediterráneo Noroccidental Uxue Tilves Matheu Memoria presentada para optar al grado de Doctor por la Universitat Politècnica de Catalunya (UPC), Programa de doctorado en Ciencias del Mar (RD 99/2011). Tesis realizada en el Institut de Ciències del Mar (CSIC). Directora: Dra. Ana Maria Sabatés Freijó (ICM-CSIC) Co-directora: Dra. Verónica Lorena Fuentes (ICM-CSIC) Tutor/Ponente: Dr. Manuel Espino Infantes (UPC) Barcelona This student has been supported by a pre-doctoral fellowship of the FPI program (Spanish Ministry of Economy and Competitiveness). The research carried out in the present study has been developed in the frame of the FISHJELLY project, CTM2010-18874 and CTM2015- 68543-R. Cover design by Laura López. Visual design by Eduardo Gil. Thesis contents THESIS CONTENTS Summary 9 General Introduction 11 Objectives and thesis outline 30 Digestion times and predation potentials of Pelagia noctiluca eating CHAPTER1 fish larvae and copepods in the NW Mediterranean Sea 33 Natural diet and predation impacts of Pelagia noctiluca on fish CHAPTER2 eggs and larvae in the NW Mediterranean 57 Trophic interactions of the jellyfish Pelagia noctiluca in the NW Mediterranean: evidence from stable isotope signatures and fatty CHAPTER3 acid composition 79 Associations between fish and jellyfish in the NW CHAPTER4 Mediterranean 105 General Discussion 131 General Conclusion 141 Acknowledgements 145 Appendices 149 Summary 9 SUMMARY Jellyfish are important components of marine ecosystems, being a key link between lower and higher trophic levels.
    [Show full text]
  • First Records of Three Cepheid Jellyfish Species from Sri Lanka With
    Sri Lanka J. Aquat. Sci. 25(2) (2020): 45-55 http://doi.org/10.4038/sljas.v25i2.7576 First records of three cepheid jellyfish species from Sri Lanka with redescription of the genus Marivagia Galil and Gershwin, 2010 (Cnidaria: Scyphozoa: Rhizostomeae: Cepheidae) Krishan D. Karunarathne and M.D.S.T. de Croos* Department of Aquaculture and Fisheries, Faculty of Livestock, Fisheries and Nutrition, Wayamba University of Sri Lanka, Makandura, Gonawila (NWP), 60170, Sri Lanka. *Correspondence ([email protected], [email protected]) https://orcid.org/0000-0003-4449-6573 Received: 09.02.2020 Revised: 01.08.2020 Accepted: 17.08.2020 Published online: 15.09.2020 Abstract Cepheid medusae appeared in great numbers in the northeastern coastal waters of Sri Lanka during the non- monsoon period (March to October) posing adverse threats to fisheries and coastal tourism, but the taxonomic status of these jellyfishes was unknown. Therefore, an inclusive study on jellyfish was carried out from November 2016 to July 2019 for taxonomic identification of the species found in coastal waters. In this study, three species of cepheid mild stingers, Cephea cephea, Marivagia stellata, and Netrostoma setouchianum were reported for the first time in Sri Lankan waters. Moreover, the diagnostic description of the genus Marivagia is revised in this study due to the possessing of appendages on both oral arms and arm disc of Sri Lankan specimens, comparing with original notes and photographs of M. stellata. Keywords: Indian Ocean, invasiveness, medusae, morphology, taxonomy INTRODUCTION relationships with other fauna (Purcell and Arai 2001), and even dead jellyfish blooms can The class Scyphozoa under the phylum Cnidaria transfer mass quantities of nutrients into the sea consists of true jellyfishes.
    [Show full text]
  • An Invitation to Monitor Georgia's Coastal Wetlands
    An Invitation to Monitor Georgia’s Coastal Wetlands www.shellfish.uga.edu By Mary Sweeney-Reeves, Dr. Alan Power, & Ellie Covington First Printing 2003, Second Printing 2006, Copyright University of Georgia “This book was prepared by Mary Sweeney-Reeves, Dr. Alan Power, and Ellie Covington under an award from the Office of Ocean and Coastal Resource Management, National Oceanic and Atmospheric Administration. The statements, findings, conclusions, and recommendations are those of the authors and do not necessarily reflect the views of OCRM and NOAA.” 2 Acknowledgements Funding for the development of the Coastal Georgia Adopt-A-Wetland Program was provided by a NOAA Coastal Incentive Grant, awarded under the Georgia Department of Natural Resources Coastal Zone Management Program (UGA Grant # 27 31 RE 337130). The Coastal Georgia Adopt-A-Wetland Program owes much of its success to the support, experience, and contributions of the following individuals: Dr. Randal Walker, Marie Scoggins, Dodie Thompson, Edith Schmidt, John Crawford, Dr. Mare Timmons, Marcy Mitchell, Pete Schlein, Sue Finkle, Jenny Makosky, Natasha Wampler, Molly Russell, Rebecca Green, and Jeanette Henderson (University of Georgia Marine Extension Service); Courtney Power (Chatham County Savannah Metropolitan Planning Commission); Dr. Joe Richardson (Savannah State University); Dr. Chandra Franklin (Savannah State University); Dr. Dionne Hoskins (NOAA); Dr. Charles Belin (Armstrong Atlantic University); Dr. Merryl Alber (University of Georgia); (Dr. Mac Rawson (Georgia Sea Grant College Program); Harold Harbert, Kim Morris-Zarneke, and Michele Droszcz (Georgia Adopt-A-Stream); Dorset Hurley and Aimee Gaddis (Sapelo Island National Estuarine Research Reserve); Dr. Charra Sweeney-Reeves (All About Pets); Captain Judy Helmey (Miss Judy Charters); Jan Mackinnon and Jill Huntington (Georgia Department of Natural Resources).
    [Show full text]