Crosstalk Between Androgen-ZIP9 Signaling and Notch Pathway in Rodent Sertoli Cells

International Journal of Molecular Sciences

Article Crosstalk between Androgen-ZIP9 Signaling and Notch Pathway in Rodent Sertoli Cells

Alicja Kami ´nska 1 , Sylwia Marek 1, Laura Pardyak 1,2, Małgorzata Brzoskwinia 1, Barbara Bilinska 1 and Anna Hejmej 1,*

1 Department of Endocrinology, Institute of Zoology and Biomedical Research, Faculty of Biology, Jagiellonian University, 30-387 Kraków, Poland; [email protected] (A.K.); [email protected] (S.M.); [email protected] (L.P.); [email protected] (M.B.); [email protected] (B.B.) 2 Center of Experimental and Innovative Medicine, University of Agriculture in Krakow, 30-248 Kraków, Poland * Correspondence: [email protected]

Received: 18 August 2020; Accepted: 2 November 2020; Published: 5 November 2020

Abstract: Our recent study demonstrated altered expression of Notch ligands, receptors, and effector genes in testes of pubertal rats following reduced androgen production or signaling. Herein we aimed to explore the role of nuclear androgen receptor (AR) and membrane androgen receptor (Zrt- and Irt-like protein 9; ZIP9) in the regulation of Notch pathway activation in rodent Sertoli cells. Experiments were performed using TM4 and 15P-1 Sertoli cell lines and rat primary Sertoli cells (PSC). 8 6 We found that testosterone (10− M–10− M) increased the expression of Notch1 receptor, its active form Notch1 intracellular domain (N1ICD) (p < 0.05, p < 0.01, p < 0.001), and the effector genes Hey1 (p < 0.05, p < 0.01, p < 0.001) and Hes1 (p < 0.05, p < 0.001) in Sertoli cells. Knockdown of AR or ZIP9 as well as antiandrogen exposure experiments revealed that (i) action of androgens via both AR and ZIP9 controls Notch1/N1ICD expression and transcriptional activity of recombination signal binding protein (RBP-J), (ii) AR-dependent signaling regulates Hey1 expression, (iii) ZIP9-dependent pathway regulates Hes1 expression. Our findings indicate a crosstalk between androgen and Notch signaling in Sertoli cells and point to cooperation of classical and non-classical androgen signaling pathways in controlling Sertoli cell function.

Keywords: Notch; androgen; Sertoli cell; testis

1. Introduction Mammalian testis sperm production is a process supported and controlled by somatic cells of seminiferous epithelium, Sertoli cells. These cells are considered to be key mediators of androgen action in the control of spermatogenesis. In seminiferous tubules, the expression of androgen receptor (AR), a member of nuclear receptor subfamily 3, is restricted to Sertoli cells [1,2] and selective ablation of the AR in these cells leads to spermatogenic arrest, indicating that AR in Sertoli cells is crucial to maintain spermatogenesis [3]. Binding of testosterone (major testicular androgen produced by interstitial tissue of the testis) to the AR triggers classical signaling pathway, inducing nuclear localization, dimerization, and interaction of hormone-receptor complex with androgen response element, a DNA sequence located in the regulatory region of androgen regulated genes [4]. In addition, alternative pathways may account for rapid eﬀects of androgens via cytoplasmic or membrane-localized AR [5]. It is now well established that in adult males AR signaling in Sertoli cells is required for Sertoli cell maturation, the maintenance of the blood-testis barrier, Sertoli cell-spermatid adhesion, completion of meiosis and spermiation [6].

Int. J. Mol. Sci. 2020, 21, 8275; doi:10.3390/ijms21218275 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2020, 21, 8275 2 of 22

In 2014, a member of the Zrt and Irt-like protein zinc transporter family ZIP9 was demonstrated to display specific, high-affinity binding of testosterone. Both functions of ZIP9, zinc transport and testosterone-induced activation of second messengers, are mediated through G proteins [7]. In AR-deficient rat Sertoli cell line, 93RS2, testosterone binding to ZIP9 stimulated extracellular signal-regulated protein kinase 1/2 (ERK1/2), cAMP-response element binding protein (CREB), and activating transcription factor 1 (ATF-1) phosphorylation and regulated the expression of tight junction proteins claudin-1 and claudin-5 [8]. Recently, we have found that ZIP9 is also localized to Sertoli cells in mouse and bank vole seminiferous epithelium [9,10]. In bank vole, a seasonally breeding rodent, expression level of ZIP9 during reproductive quiescence was correlated with testes regression status [10]. In dogs, the levels of ZIP9 in the testes were abrogated after long-term gonadotropin-releasing hormone-agonist treatment, which indicates that expression of this protein depends on the activity of hypothalamic-pituitary-gonadal axis [11]. The role of ZIP9 in testis pathology has not been described yet. To date, the presence of ZIP9 and its involvement in the regulation of apoptosis [12] and metastasis [13] of prostate and breast cancer cells have been demonstrated. However, it has been recently found that ZIP9 immunoreactivity does not show a significant difference between cancerous and non-cancerous breast and prostate specimens [14]. Apart from hormonal signals, Sertoli cell physiology is controlled by local interactions, including paracrine signaling, gap junctional communication and contact-dependent signaling [15]. The last of these is represented by a Notch signaling pathway triggered by the interaction of Notch receptors with Jagged or Delta-like ligands localized in the plasma membranes of adjacent cells. Proper Notch pathway activity in Sertoli cells is crucial for determination of germ cell fate during early testis development and controls spermatogonial differentiation in adult testis [16,17]. Notch1/HEY1/HES1 pathway is involved in the control of glial-derived neurotrophic factor production and Cyp26b1 expression in Sertoli cells [17,18]. Disruption of Notch signaling in adult testis results in increased apoptosis and spermatogenesis defects [19]. In contrast to many signaling pathways, Notch pathway lacks intermediate steps and does not exploit downstream secondary messengers for signal amplification. Binding of a ligand to Notch receptor results in receptor cleavage and translocation of Notch intracellular domain (NICD) to the nucleus, where it interacts with a transcription factor recombination signal binding protein (RBP-J), and Mastermind-like 1 [20]. The Notch co-activator complex induces the expression of target genes belonging to hairy/enhancer of split (Hes) and Hes-related with YRPW (Tyr-Arg-Pro-Trp) motif 1 (Hey) families [21]. Despite its simplicity, outcomes of the pathway activation may be diverse even in the same cell type due to its complex regulation at different levels [22,23]. Studies using various tissues and cellular models demonstrated that this pathway may also crosstalk with other signaling pathways and such interactions may determine the final outcome [24–27]. Androgens were identified as factors modulating activity of Notch signaling in several cell types. Long-term testosterone enanthate treatment increased the expression of activated Notch1 in muscle satellite cells of older men consistent with increased satellite cell replication [28]. The importance for androgen-Notch interaction for the course of prostate development and morphogenesis was also demonstrated [29,30]. DeFalco et al. [31] found that in mice testosterone plays a role in maintaining the balance between progenitor cells and differentiated fetal Leydig cells, regulating levels of JAG1 and Notch2. In respect to androgen action in Sertoli cells, particular attention was devoted to genes related to the development of the blood-testis barrier [32]. Our recent study demonstrated that Notch pathway in Sertoli cells is involved in the regulation of blood-testis barrier proteins, claudins, in androgen-dependent manner. Using RNAi technique to reduce the expression of androgen receptors, we provided evidence that the effects of Notch signaling on claudin-5 and claudin-11 are dependent on the activation of ZIP9 or AR, respectively [9]. Notably, this was the first report on ZIP9 regulation by the Notch pathway. We have also found that reduced androgen production or signaling alters the expression of Notch receptors, ligands and effector genes in testes of pubertal rats [33]. To provide Int. J. Mol. Sci. 2020, 21, 8275 3 of 22 deeper insight in androgen-Notch crosstalk in mammalian testis and reveal the mechanisms involved in this interaction, we aimed to explore the role of nuclear and membrane androgen receptors in the Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 3 of 23 regulation of Notch pathway activation in rodent Sertoli cells in vitro. in this interaction, we aimed to explore the role of nuclear and membrane androgen receptors in the 2. Resultsregulation of Notch pathway activation in rodent Sertoli cells in vitro. Firstly, to investigate whether Notch pathway activity in Sertoli cells is directly regulated by 2. Results androgens, relative level of Notch1 expression, activated form of Notch1 receptor (N1ICD) and the expression ofFirstly, the targetto investigate genes Hey1whetherand NotchHes1 pathwaywere determined activity in Sertoli in two cells murine is directly Sertoli regulated cell linesby TM4 androgens, relative level of Notch1 expression, activated form of Notch1 receptor (N1ICD) and the (from 11–13 day-old mice; expressing both the AR and ZIP9) and 15P-1 (from 6 month-old mice; expression of the target genes Hey1 and Hes1 were determined in two murine Sertoli cell lines TM4 lacking the(from AR, 11–13 but day-old expressing mice; ZIP9).expressing We foundboth the that AR testosterone,and ZIP9) and in 15P-1 the range(from 6 of month-old serum and mice; testicular 8 6 concentrationslacking the 10 AR,− M–10 but expressing− M[34 ZIP9).–36], We increased found that mRNA testosterone, and proteinin the range expression of serum and of testicularNotch1/N1ICD (p < 0.05,concentrationsp < 0.01, p < 100.001),−8 M–10−Hey16 M [34–36],(p < 0.05, increasedp < 0.01,mRNAp and< 0.001) protein and expressionHes1 (p of< Notch10.05, /N1ICDp < 0.001) (p < in both cell lines0.05, (Figure p < 0.01,1a–d). p < 0.001), The lowestHey1 (p < concentration 0.05, p < 0.01, p capable< 0.001) and of eHes1ffectively (p < 0.05, activating p < 0.001) in Notch both cell pathway lines (Figure 1a–d). The lowest concentration capable of effectively activating Notch pathway (10−8 (10 8 M) was used in further experiments. − M) was used in further experiments.

Figure 1. The effect of testosterone on Notch1, Hey1 and Hes1 mRNA, and Notch1 intracellular domain Figure 1. The effect of testosterone on Notch1, Hey1 and Hes1 mRNA, and Notch1 intracellular domain (N1ICD), HEY1 and HES1 protein expression in TM4 and 15P-1 Sertoli cell lines. Cells were treated (N1ICD),with HEY1 a vehicle and (control, HES1 protein C), 10−8 M, expression 10−7 M or 10 in−6 TM4M testosterone and 15P-1 (T) Sertolifor 24 h cell(a,b)lines. Relative Cells expression were treated 8 7 6 with a vehicleof mRNAs (control, (RQ) was C), determined 10− M, 10 using− M quantitative or 10− M real-time testosterone RT-PCR (T) analysis for 24. hThe (a ,expressionb) Relative values expression of mRNAsof the (RQ) individual was determined genes were normalized using quantitative to the mean real-time expression RT-PCR of Rn18s analysis., B2m, Gapdh The and expression Actb. (c,d) values of the individualWestern blot genes detection were of the normalized proteins. The to relative the mean level expression of studied proteins of Rn18s was, B2mnormalized, Gapdh to andβ- Actb. (c,d) Westernactin. The blot protein detection levels of within the proteins. the control The group relative were arbitrarily level of studied set at 1. proteinsThe histograms was normalized are the to quantitative representation of data (mean ± SD) of three independent experiments, each in triplicate. β-actin. The protein levels within the control group were arbitrarily set at 1. The histograms are the Significant differences from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. quantitative representation of data (mean SD) of three independent experiments, each in triplicate. ± SignificantNext, di fftoerences determine from the control involvement values of are AR denoted and ZIP9 as in * p the< 0.05,regulation ** p < of0.01, Notch and pathway *** p < 0.001.activity we knocked down each of the receptors using RNAi technique. In TM4 cells, knockdown of either Next, to determine the involvement of AR and ZIP9 in the regulation of Notch pathway activity we knocked down each of the receptors using RNAi technique. In TM4 cells, knockdown of either AR or ZIP9 partly abrogated the effect of testosterone on RBP-J activity (Figure2a) and Notch1/N1ICD level Int. J. Mol. Sci. 2020, 21, 8275 4 of 22 Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 4 of 23

AR or ZIP9 partly abrogated the effect of testosterone on RBP-J activity (Figure 2a) and Notch1/N1ICD (Figure2c,e) ( p < 0.05, p < 0.01, p < 0.001), which suggests that both receptors modulate Notch signaling level (Figure 2c,e) (p < 0.05, p < 0.01, p < 0.001), which suggests that both receptors modulate Notch activity.signaling In Ar-silenced activity. cells,In Ar-silenced weaker immunoﬂuorescencecells, weaker immunofluoresc signalence of N1ICD signal of was N1ICD observed was observed mainly in cell nuclei,mainly whereas in cell ZIP9 nuclei, knockdown whereas ZIP9 caused knockdown signal caus reductioned signal in reduction both nuclei in both and nuclei cytoplasm and cytoplasm (Figure 3a) when compared(Figure 3a) towhen the compared control. In to 15P-1the control. cells, InZip9 15P-1silencing cells, Zip9 fully silencing blocked fully testosterone-induced blocked testosterone- Notch pathwayinduced activation Notch (p pathway< 0.001) activation (Figure2b,d,f) (p < and0.001) N1ICD (Figure signal 2b,d,f) almost and N1ICD totally signal disappeared almost totally (Figure 3b). Qualitativedisappeared analyses (Figure of N1ICD 3b). Qualitative signal were analyses conﬁrmed of N1ICD using signal quantitative were confirmed image using analysis quantitative (Figure 3c,d). image analysis (Figure 3c,d).

Figure 2. The effect of androgen receptor (AR) and ZIP9 knockdown on Notch pathway activity, FigureNotch1 2. The mRNA effect and of N1ICD androgen expression receptor in TM4 (AR) (a and,c,e) and ZIP9 15P-1 knockdown (b,d,f) Sertoli on cells. Notch (a,b pathway) Cells were activity, Notch1transfectedmRNA and with N1ICD 2 × 10−12 expression M of recombination in TM4 signal (a,c,e )binding and 15P-1 protein (b ,(RBP-J)d,f) Sertoli reporter cells. and ( a5, b× )10 Cells−8 M were transfectednon-targeting with 2 siRNA10 12 (control),M of recombination AR-siRNA (AR-Kd) signal or binding ZIP9-siRNA protein (ZIP9-Kd). (RBP-J) After reporter 16 h andcells 5were10 8 M × − × − non-targetingtreated with siRNA 10−8 (control),M testosterone AR-siRNA (T) or vehicle (AR-Kd) (C). Cells or ZIP9-siRNA were harvested (ZIP9-Kd). after a 24 h After incubation 16 h cellsand were the ratio of 8firefly-derived luminescence over renilla-derived luminescence was determined. Data are treated with 10− M testosterone (T) or vehicle (C). Cells were harvested after a 24 h incubation and the ratiomeans of firefly-derived ± SD for a single luminescence experiment done over renilla-derivedin triplicate. (c–f) luminescence Cells were treated was with determined. transfection Data are reagent alone (C), transfection reagent + non-targeting siRNA (negative control, NT), transfection means SD for a single experiment done in triplicate. (c–f) Cells were treated with transfection reagent reagent± + AR siRNA or ZIP9 siRNA. After 24 h 10−8 M T or vehicle was added to the culture. (c,d) alone (C), transfection reagent + non-targeting siRNA (negative control, NT), transfection reagent + Relative expression of mRNAs (RQ) was determined using real-time RT-PCR analysis. The expression 8 AR siRNAvalues or of ZIP9 the individual siRNA. Aftergenes 24were h 10no−rmalizedM T or to vehiclethe mean was expression added of to Rn18s the culture., B2m, Gapdh (c,d )and Relative expressionActb. of(e,f mRNAs) Western (RQ) blot detection was determined of the proteins. using The real-time relative level RT-PCR of studied analysis. protein The was expression normalized values of the individual genes were normalized to the mean expression of Rn18s, B2m, Gapdh and Actb. (e,f) Western blot detection of the proteins. The relative level of studied protein was normalized to β-actin. The protein levels within the control group were arbitrarily set at 1. The histograms are the quantitative representation of data (mean SD) of three independent experiments, each in triplicate. ± Significant differences from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 5 of 23

to β-actin. The protein levels within the control group were arbitrarily set at 1. The histograms are the Int. J. Mol.quantitative Sci. 2020, 21 representation, 8275 of data (mean ± SD) of three independent experiments, each in triplicate. 5 of 22 Significant differences from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001.

FigureFigure 3. Immunofluorescence3. Immunofluorescence analysis analysis of N1ICDof N1ICD expression expression in TM4 in (TM4a,c) and (a,c 15P-1) and (b15P-1,d) cells (b,d following) cells ARfollowing or ZIP9 knockdown. AR or ZIP9 Cells knockdown. were transfected Cells were with tr transfectionansfected with reagent transfecti aloneon (C), reagent transfection alone reagent(C), transfection8 reagent + 5 × 10−8 M AR siRNA (AR-Kd) or ZIP9 siRNA (ZIP9-Kd). After8 24 h 10−8 M T or + 5 10− M AR siRNA (AR-Kd) or ZIP9 siRNA (ZIP9-Kd). After 24 h 10− M T or vehicle was vehicle× was added to the culture. Cells were fixed after a 24 h incubation. (a,b) Representative added to the culture. Cells were fixed after a 24 h incubation. (a,b) Representative microphotographs microphotographs of TM4 and 15P-1 cultures. Arrows indicate positive signal. Sertoli cell nuclei were of TM4 and 15P-1 cultures. Arrows indicate positive signal. Sertoli cell nuclei were stained with stained with 4′,6-diamidino-2-phenylindole (DAPI; blue). Right panels in controls (C) represent the 40,6-diamidino-2-phenylindole (DAPI; blue). Right panels in controls (C) represent the merged images. merged images. Scale bar = 25 µm. (c,d) The fluorescence intensity was quantified using ImageJ and Scale bar = 25 µm. (c,d) The fluorescence intensity was quantified using ImageJ and displayed in displayed in corrected total cell fluorescence (CTCF). Histograms represent the mean ± SD. Significant corrected total cell fluorescence (CTCF). Histograms represent the mean SD. Significant differences differences from control values are denoted as * p < 0.05, ** p < 0.01, and ***± p < 0.001. from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. Further, we tested the effect of pharmacological anti-androgens hydroxyflutamide (HF) and Further, we tested the effect of pharmacological anti-androgens hydroxyflutamide (HF) and bicalutamide (Bic) on Notch pathway activation in Sertoli cell lines and primary Sertoli cells (PSC). bicalutamide (Bic) on Notch pathway activation in Sertoli cell lines and primary Sertoli cells (PSC). HF is an active metabolite of pure AR antagonist, flutamide, which does not block membrane- HF is an active metabolite of pure AR antagonist, flutamide, which does not block membrane-initiated initiated androgen actions [12,37–39]. In contrast, Bic was demonstrated to inhibit activation of both androgenAR and actionsZIP9 [40,41]. [12,37 –39]. In contrast, Bic was demonstrated to inhibit activation of both AR and ZIP9 [40HF,41 partly]. blocked testosterone effect on RBP-J transcriptional activity in TM4 cells (p < 0.01) (FigureHF partly 4a) but blocked had no testosteroneeffect in 15P-1 e cellsffect (Figure on RBP-J 4b). transcriptional Bic effectively inhibited activity intestosterone-induced TM4 cells (p < 0.01) (FigureRBP-J4 a)activity but had in both no e cellularffect in models 15P-1 cells studied (Figure (p < 40.001)b). Bic (Figure e ffectively 4a,b). inhibited testosterone-induced RBP-J activityThe effect in bothof testosterone cellular models on Notch1 studied/N1ICD (p < expression0.001) (Figure was4 a,b).partly suppressed by HF in both TM4The (p e ff< ect0.01; of Figure testosterone 4c,f,l) and on Notch1PSC (p/ N1ICD< 0.01; expressionFigure 4e,h,n), was whereas partly suppressedBic completely by HFinhibited in both TM4testosterone-induced (p < 0.01; Figure 4Notch1c,f,l) and/N1ICD PSC expression ( p < 0.01; in Figure all cellular4e,h,n), models whereas studied Bic ( completelyp < 0.001; Figure inhibited 4c– testosterone-inducedh,l–n). Loss of immunofluorescenceNotch1/N1ICD expression signal of N1ICD in all cellular following models Bic exposure studied ( pwas< 0.001; seen (Figure Figure4 4i–k).c–h,l–n). Loss of immunofluorescence signal of N1ICD following Bic exposure was seen (Figure4i–k).

Int. J. Mol. Sci. 2020, 21, 8275 6 of 22

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 6 of 23

Figure 4. The effect of hydroxyflutamide (HF) and bicalutamide (Bic) on Notch pathway activity, Figure 4. The eﬀect of hydroxyﬂutamide (HF) and bicalutamide (Bic) on Notch pathway activity, Notch1 mRNA and N1ICD expression in TM4 (a,c,f,i,l), 15P-1 (b,d,g,j,m), and primary (PSC; e,h,k,n) Notch1 mRNA and N1ICD expression in TM4 (a,c,f,i,l), 15P-1 (b,d,g,j,m), and primary (PSC; e,h,k,n) Sertoli cells. (a,b) TM4 and 15P-1 cells were transfected with 2 × 10−12 M of RBP-J reporter. After 24 h Sertoli cells. (a,b) TM4 and 15P-1 cells were transfected with 2 10 12 M of RBP-J reporter. After 24 h cells were treated with 10−8 M testosterone (T), 10−4 M hydroxyflutamide× − (HF), 10−6 M bicalutamide (Bic) or vehicle (C). Cells were harvested after a 24 h and the ratio of firefly-derived luminescence

Int. J. Mol. Sci. 2020, 21, 8275 7 of 22

8 4 6 cells were treated with 10− M testosterone (T), 10− M hydroxyflutamide (HF), 10− M bicalutamide (Bic) or vehicle (C). Cells were harvested after a 24 h and the ratio of firefly-derived luminescence over renilla-derived luminescence was determined. Data are means SD for a single experiment Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 7 of 23 8 4 ± 6 done in triplicate. (c–k) Cells were treated 10− M T, 10− HF, HF + T, 10− M Bic, Bic + T or vehicle (C) forover 24 renilla-derived h. (c–e) Relative luminescence expression was determined. of mRNAs Da (RQ)ta are was means determined ± SD for a single using experiment real-time done RT-PCR analysis.in triplicate. The expression (c–k) Cellsvalues were treated of the 10 individual−8 M T, 10−4 HF, genes HFwere + T, 10 normalized−6 M Bic, Bic + to T theor vehicle mean (C) expression for 24 of Rn18sh., B2m(c–e), RelativeGapdh and expressionActb.(f of–h mRNAs) Western (RQ) blot was detection determined of the using proteins. real-time The RT-PCR relative analysis. level of The studied proteinexpression was normalized values of the to βindividual-actin. The genes protein were normalized levels within to the the mean control expression group wereof Rn18s arbitrarily, B2m, set at 1.Gapdh The histograms and Actb. (f– areh) Western the quantitative blot detection representation of the proteins. of The data relative (mean level SD)of studied of three protein independent was ± experiments,normalized each to β in-actin. triplicate. The protein (i–k) levels Immunofluorescence within the control analysis group were of N1ICD arbitrarily expression. set at 1. The Arrows indicatehistograms positive are signal. the quantitative Scale bar representation= 10 µm. (ofl– ndata) The (mean fluorescence ± SD) of three intensity independent was quantifiedexperiments, using each in triplicate. (i–k) Immunofluorescence analysis of N1ICD expression. Arrows indicate positive ImageJ and displayed in corrected total cell fluorescence (CTCF). Histograms represent the mean SD. signal. Scale bar = 10 µm. (l–n) The fluorescence intensity was quantified using ImageJ and displayed ± Significant differences from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. in corrected total cell fluorescence (CTCF). Histograms represent the mean ± SD. Significant differences from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. Finally, we examined the effect of androgen receptor signaling inhibition on the expression of Notch pathwayFinally, we effector examined genes theHes1 effectand of androgenHey1. AR rece knockdownptor signaling in inhibition TM4 cells on abolished the expression the e offfect of testosteroneNotch pathway on Hey1 effectormRNA genes and Hes1 protein and Hey1 expression. AR knockdown (p < 0.001), in TM4 whereas cells abolished ZIP9 knockdown the effect hadof no effecttestosterone (Figure5a–d). on Hey1 mRNA and protein expression (p < 0.001), whereas ZIP9 knockdown had no effect (Figure 5a–d).

FigureFigure 5. The 5. The eﬀ effectect of of AR AR andand ZIP9 ZIP9 knockdown knockdown on Hey1 on Hey1 mRNAmRNA and HEY1 and protein HEY1 expression protein expression in TM4 in TM4( a,,cc)) and and 15P-1 15P-1 ( (bb,d,d) )Sertoli Sertoli cells. cells. Cells Cells were were treated treated with with tran transfectionsfection reagent reagent alone alone (C), transfection (C), transfection −8 −8 reagent + 5 × 108 M non-targeting siRNA (negative control, NT), transfection reagent + 5 × 10 M AR 8 reagent + 5 10− M non-targeting siRNA (negative control, NT), transfection reagent + 5 10− M siRNA (AR-Kd)× or ZIP9 siRNA (ZIP9-Kd). After 24 h 10−8 M T or vehicle was added to the culture.× AR siRNA (AR-Kd) or ZIP9 siRNA (ZIP9-Kd). After 24 h 10 8 M T or vehicle was added to the (a,b) Relative expression of mRNAs (RQ) was determined using− real-time RT-PCR analysis. The culture.expression (a,b) Relative values of expression the individual of mRNAs genes we (RQ)re normalized was determined to the mean using expression real-time of RT-PCR Rn18s, B2m analysis., The expressionGapdh and Actb values. (c,d of) Western the individual blot detection genes of were the proteins. normalized The relative to the mean level of expression studied protein of Rn18s was, B2m, Gapdhnormalizedand Actb .(toc ,βd-actin.) Western The blotprotein detection levels within of the proteins.the control The group relative were levelarbitrarily of studied set at protein1. The was normalizedhistograms to β -actin.are the Thequantitative protein representation levels within the of data control (mean group ± SD) were of three arbitrarily independent set at 1.experiments, The histograms are theeach quantitative in triplicate. representation Significant differences of data (mean from controlSD) of values three are independent denoted as experiments, * p < 0.05, ** p each < 0.01, in and triplicate. ± Significant*** p < 0.001. differences from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001.

Int. J. Mol. Sci. 2020, 21, 8275 8 of 22 Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 8 of 23

ImmunoﬂuorescenceImmunofluorescence revealed decreased signal only in Ar-silenced cells (Figure(Figure6 6a,c).a,c). InIn 15P-115P-1 cells testosterone-stimulated expressionexpression ofof HEY1HEY1 waswas notnot aaffectedﬀected byby Zip9Zip9silencing silencing (Figure(Figure4 b,d).4b,d).

Figure 6.6.Immunofluorescence Immunofluorescence analysis analysis of HEY1of HEY1 expression expression in TM4 in (aTM4,c) and (a 15P-1,c) and (b ,15P-1d) cells (b following,d) cells ARfollowing or ZIP9 AR knockdown. or ZIP9 Cellsknockdown. were transfected Cells were with tr transfectionansfected with reagent transfecti alone (C),on transfectionreagent alone reagent (C), −8 −8 +transfection5 10 8 M reagent AR siRNA + 5 (AR-Kd)× 10 M orAR ZIP9 siRNA siRNA (AR-Kd) (ZIP9-Kd). or ZIP9 After siRNA 24 h (ZIP9-Kd). 10 8 M T or After vehicle 24 wash 10 added M T or to × − − thevehicle culture. was Cells added were to fixedthe culture. after a 24 Cells h incubation. were fixed (a,b )after Representative a 24 h incubation. microphotographs (a,b) Representative of TM4 and 15P-1microphotographs cultures. Arrows of TM4 indicate and 15P-1 positive cultures. signal. Arrows Sertoli cell indicate nuclei positive were stained signal. with Sertoli DAPI cell (blue). nuclei Rightwere panelsstained in with controls DAPI (C) (blue). represent Right the panels merged in images.controls Scale(C) represent bar = 25 µthem. merged (c,d) The images. fluorescence Scale intensitybar = 25 wasµm. quantified(c,d) The fluorescence using ImageJ intensity and displayed was quantified in corrected using totalImageJ cell and fluorescence displayed in (CTCF). corrected Histograms total cell representfluorescence the (CTCF). mean HistogramsSD. Significant represent differences the mean from ± SD. control Significant values aredifferences denoted from as ** controlp < 0.01, values and ± ***arep denoted< 0.001. as ** p < 0.01, and *** p < 0.001.

In TM4TM4 andand PSCs, PSCs, HF HF completely completely abolished abolished the the effect effect of testosterone of testosterone on Hey1 on expressionHey1 expression (p < 0.001). (p < Similar0.001). Similar effect waseffect observed was observed for Bic for ( pBic< (0.01)p < 0.01) (Figure (Figure7a,c,d,f). 7a,c,d,f). Immunofluorescence Immunofluorescence signal signal was was clearly reduced reduced in in both both HF HF and and Bic Bic treated treated cells cells (Figur (Figuree 7g,i,j,l).7g,i,j,l). In contrast, In contrast, Bic had Bic hadno effect no e onffect basal on basaland testosterone-stimulated and testosterone-stimulated Hey1Hey1 expressionexpression in 15P-1 in 15P-1 cells, cells, which which was was also also demonstrated demonstrated by immunofluorescenceimmunofluorescence (Figure7 7b,e,h,k).b,e,h,k). ThisThis indicatesindicates thatthat AR-mediatedAR-mediated signalingsignaling isis involvedinvolved inin thethe regulation of Hey1 inin SertoliSertoli cells,cells, whereaswhereas ZIP9ZIP9 isis notnot implicated.implicated.

Int. J. Mol. Sci. 2020, 21, 8275 9 of 22

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 9 of 23

Figure 7. The effect of hydroxyflutamide (HF) and bicalutamide (Bic) on Hey1 mRNA and HEY1 Figure 7. The effect of hydroxyflutamide (HF) and bicalutamide (Bic) on Hey1 mRNA and HEY1 protein protein expression in TM4 (a,d,g,j), 15P-1 (b,e,h,k), and primary (PSC; c,f,j,l) Sertoli cells. Cells were expression in TM4 (a,d,g,j), 15P-1 (b,e,h,k), and primary (PSC; c,f,j,l) Sertoli cells. Cells were treated −8 −4 −6 treated8 with 10 M testosterone4 (T), 10 HF, HF 6+ T, 10 M Bic, Bic + T or vehicle (C) for 24 h. (a–c) with 10− M testosterone (T), 10− HF, HF + T, 10− M Bic, Bic + T or vehicle (C) for 24 h. (a–c) Relative Relative expression of mRNAs (RQ) was determined using real-time RT-PCR analysis. The expression expression of mRNAs (RQ) was determined using real-time RT-PCR analysis. The expression values values of the individual genes were normalized to the mean expression of Rn18s, B2m, Gapdh and of the individual genes were normalized to the mean expression of Rn18s, B2m, Gapdh and Actb. Actb. (d–f) Western blot detection of the proteins. The relative level of studied protein was normalized (d–f) Western blot detection of the proteins. The relative level of studied protein was normalized to β-actin. The protein levels within the control group were arbitrarily set at 1. The histograms are the to β-actin. The protein levels within the control group were arbitrarily set at 1. The histograms quantitative representation of data (mean ± SD) of three independent experiments, each in triplicate. are the quantitative representation of data (mean SD) of three independent experiments, each in (g–i) Immunofluorescence analysis of HEY1 expression.± Arrows indicate positive signal. Scale bar = triplicate.10 µm. (j (–gl–) iThe) Immunofluorescence fluorescence intensity analysis was quantified of HEY1 using expression. ImageJ and Arrows displayed indicate in corrected positive total signal. µ Scalecell barfluorescence= 10 m. (CTCF). (j–l) The Histograms fluorescence represent intensity the mean was quantified± SD. Significant using differences ImageJ and from displayed control in corrected total cell fluorescence (CTCF). Histograms represent the mean SD. Significant differences values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. ± from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001.

Int. J. Mol. Sci. 2020, 21, 8275 10 of 22

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 10 of 23 In TM4 cells Ar silencing had no eﬀect on Hes1 expression (Figure8a,c), while ZIP9 knockdown In TM4 cells Ar silencing had no effect on Hes1 expression (Figure 8a,c), while ZIP9 knockdown signiﬁcantly reduced testosterone-stimulated Hes1 expression in both TM4 and 15P-1 cells (p < 0.05, significantly reduced testosterone-stimulated Hes1 expression in both TM4 and 15P-1 cells (p < 0.05, p < 0.001) (Figure8a–d). p < 0.001) (Figure 8a–d).

FigureFigure 8. TheThe effect effect of of AR AR and and ZIP9 ZIP9 knockdown knockdown on onHes1Hes1 mRNAmRNA and andHES1 HES1 proteinprotein expression expression in TM4 in TM4(a,c) (anda,c) and15P-1 15P-1 (b,d ()b Sertoli,d) Sertoli cells. cells. Cells Cells were were treated treated with with tran transfectionsfection reagent reagent alone alone (C), (C), transfection reagent + 5 × 10−8 8M non-targeting siRNA (negative control, NT), transfection reagent + 5 × 10−8 M8 AR reagent + 5 10− M non-targeting siRNA (negative control, NT), transfection reagent + 5 10− M siRNA (AR-Kd)× or ZIP9 siRNA (ZIP9-Kd). After 24 h 10−8 M T or8 vehicle was added to the× culture. AR siRNA (AR-Kd) or ZIP9 siRNA (ZIP9-Kd). After 24 h 10− M T or vehicle was added to the culture.(a,b) Relative (a,b) Relative expression expression of mRNAs of mRNAs (RQ) was (RQ) dete wasrmined determined using usingreal-time real-time RT-PCR RT-PCR analysis. analysis. The Theexpression expression values values of the of individual the individual genes genes were werenormalized normalized to the to mean the mean expression expression of Rn18s of Rn18s, B2m, B2mGapdh, Gapdh and Actband. (Actbc,d) Western.(c,d) Western blot detection blot detection of the proteins. of the proteins.The relative The level relative of studied level protein of studied was proteinnormalized was normalizedto β-actin. The to β protein-actin. Thelevels protein within levels the withincontrol thegroup control were group arbitrarily were arbitrarilyset at 1. The set athistograms 1. The histograms are the quantitative are the quantitative representation representation of data (mean of data± SD) (mean of three SD)independent of three independentexperiments, ± experiments,each in triplicate. each Significant in triplicate. differences Significant from diff controlerences values from controlare denoted values asare * p denoted< 0.05, ** asp < * 0.01,p < 0.05, and *****p p< <0.01, 0.001. and *** p < 0.001.

InIn testosterone-exposedtestosterone-exposed cells cells immunofluorescence immunofluorescence signal signal of HES1 of HES1 was localizedwas localized to both to cell both nuclei cell andnuclei cytoplasm and cytoplasm (Figure (Figure9a,b). In 9a,b).Ar-silenced In Ar-silenced TM4 cells TM4 signal cells wassignal maintained was maintained mainly mainly in cell nuclei,in cell whereasnuclei, whereas ZIP9 knockdown ZIP9 knockdown resulted resulted in marked in reductionmarked reduction of signal of intensity signal intensity in cell cytoplasm, in cell cytoplasm, and loss ofand the loss signal of the in signal most cell in most nuclei cell of nuclei both TM4 of both and TM4 15P-1 and (Figure 15P-19 a,b).(Figure Qualitative 9a,b). Qualitative analyses analyses of signals of weresignals confirmed were confirmed using quantitative using quantitative analysis anal of fluorescenceysis of fluorescence intensity intensity (Figure9 c,d).(Figure 9c,d).

Int. J. Mol. Sci. 2020, 21, 8275 11 of 22 Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 11 of 23

Figure 9.9.Immunofluorescence Immunofluorescence analysis analysis of HES1of HES1 expression expression in TM4 in (aTM4,c) and (a 15P-1,c) and (b ,15P-1d) cells (b following,d) cells ARfollowing or ZIP9 AR knockdown. or ZIP9 Cellsknockdown. were transfected Cells were with tr transfectionansfected with reagent transfecti alone (C),on transfectionreagent alone reagent (C), −8 −8 +transfection5 10 8 M reagent AR siRNA + 5 (AR-Kd)× 10 M orAR ZIP9 siRNA siRNA (AR-Kd) (ZIP9-Kd). or ZIP9 After siRNA 24 h (ZIP9-Kd). 10 8 M T or After vehicle 24 wash 10 added M T or to × − − thevehicle culture. was Cells added were to fixedthe culture. after a 24 Cells h incubation. were fixed (a,b )after Representative a 24 h incubation. microphotographs (a,b) Representative of TM4 and 15P-1microphotographs cultures. Arrows of TM4 indicate and 15P-1 positive cultures. signal. Arrows Sertoli cell indicate nuclei positive were stained signal. with Sertoli DAPI cell (blue). nuclei Rightwere panelsstained in with controls DAPI (C) (blue). represent Right the panels merged in images.controls Scale(C) represent bar = 25 µthem. merged (c,d) The images. fluorescence Scale intensitybar = 25 wasµm. quantified(c,d) The fluorescence using ImageJ intensity and displayed was quantified in corrected using totalImageJ cell and fluorescence displayed in (CTCF). corrected Histograms total cell representfluorescence the (CTCF). mean HistogramsSD. Significant represent differences the mean from ± SD. control Significant values aredifferences denoted from as ** controlp < 0.01, values and ± ***arep denoted< 0.001. as ** p < 0.01, and *** p < 0.001.

In testosterone-treated TM4 and PSC cells the expression of Hes1/HES1/HES1 was not aaffectedffected by HF (Figure(Figure 1010a,c,d,f),a,c,d,f), whereas Bic inhibited the eeffectffect of testosteronetestosterone on Hes1 mRNA and HES1 protein expression in all cellular models models ( (pp << 0.01,0.01, pp << 0.001)0.001) (Figure (Figure 10a–f). 10a–f). In InTM4 TM4 and and PSC PSC cells cells exposed exposed to toHF HF immunofluorescence immunofluorescence signal signal was was detected detected mainly mainly in cell in cellnuclei nuclei (Figure (Figure 10g,i). 10 g,i).In Bic In treated Bic treated cells cellsloss of loss nuclear of nuclear HES1 HES1 staining staining was was found found (Figure (Figure 10g–i). 10g–i). Qualitative Qualitative analysis analysis revealed revealed significant significant reduction of fluorescencefluorescence intensity following Bic exposure when compared to cultures treated with testosterone alonealone ((pp << 0.01, p < 0.001)0.001) (Figure (Figure 10j–l).10j–l). Taken Taken to together,gether, these results suggest that Hes1 is regulated viavia ZIP9-dependentZIP9-dependent signalingsignaling inin rodentrodent SertoliSertoli cells.cells.

Int. J. Mol. Sci. 2020, 21, 8275 12 of 22

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 12 of 23

Figure 10. The effect of hydroxyflutamide (HF) and bicalutamide (Bic) on Hes1 mRNA and HES1 Figure 10. The effect of hydroxyflutamide (HF) and bicalutamide (Bic) on Hes1 mRNA and HES1 protein protein expression in TM4 (a,d,g,j), 15P-1 (b,e,h,k), and primary (PSC; c,f,i,l) Sertoli cells. Cells were expression in TM4 (a,d,g,j), 15P-1 (b,e,h,k), and primary (PSC; c,f,i,l) Sertoli cells. Cells were treated treated with 10−8 M testosterone (T), 10−4 HF, HF + T, 10−6 M Bic, Bic + T or vehicle (C) for 24 h. (a–c) with 10 8 M testosterone (T), 10 4 HF, HF + T, 10 6 M Bic, Bic + T or vehicle (C) for 24 h. (a–c) Relative Relative− expression of mRNAs (RQ)− was determined− using real-time RT-PCR analysis. The expression expression of mRNAs (RQ) was determined using real-time RT-PCR analysis. The expression values values of the individual genes were normalized to the mean expression of Rn18s, B2m, Gapdh and of the individual genes were normalized to the mean expression of Rn18s, B2m, Gapdh and Actb. Actb. (d–f) Western blot detection of the proteins. The relative level of studied protein was normalized (d–f) Western blot detection of the proteins. The relative level of studied protein was normalized to β-actin. The protein levels within the control group were arbitrarily set at 1. The histograms are the to β-actin. The protein levels within the control group were arbitrarily set at 1. The histograms quantitative representation of data (mean ± SD) of three independent experiments, each in triplicate. are the quantitative representation of data (mean SD) of three independent experiments, each in (g–i) Immunofluorescence analysis of HES1 expression.± Arrows indicate positive signal. Scale bar = triplicate. (g–i) Immunofluorescence analysis of HES1 expression. Arrows indicate positive signal. 10 µm. (j–l) The fluorescence intensity was quantified using ImageJ and displayed in corrected total Scale bar = 10 µm. (j–l) The fluorescence intensity was quantified using ImageJ and displayed in cell fluorescence (CTCF). Histograms represent the mean ± SD. Significant differences from control corrected total cell fluorescence (CTCF). Histograms represent the mean SD. Significant differences values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. ± from control values are denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001.

Int. J. Mol. Sci. 2020, 21, 8275 13 of 22

3. Discussion In the present paper we show that activity of Notch signaling is regulated by testosterone acting via both AR and ZIP9 receptors, thus providing evidence that a crosstalk between Notch and androgen pathways exists in Sertoli cells. Herein, we found that testosterone is a potent stimulator not only of Notch1 receptor expression, but also its activation, as demonstrated by increased N1ICD level, increased nuclear accumulation of N1ICD and enhanced RBP-J transcriptional activity. The stimulatory effect of androgens on Notch1 was previously described in myogenic progenitor cells during pubertal development [42]. In contrary, in ventral prostate of orchiectomized rats, inhibitory action of androgen on Notch1 signaling was reported [29]. Therefore, the effect of androgens on Notch1 signaling clearly depends on cellular context. Previous studies showed that epigenetic factors and availability of cofactors influence the AR-regulated transcriptome and finally determine the final response of the cell [43,44]. Moreover, several papers reported that testosterone binding to ZIP9 activates different G proteins and various downstream signaling events in cell type-specific manner [8,12,45,46]. In TM4 cells, Ar-silencing only partly blocked the effect of testosterone on Notch1 pathway activity, suggesting that AR-mediated action is not the only mechanism involved in testosterone effect on Notch pathway. In agreement, in both TM4 and PCS cells, HF (AR antagonist) was unable to totally block the effect of testosterone. An increase in Notch signaling activity following testosterone exposure was significantly lower in HF-treated cells than in vehicle-treated cells. Moreover, the stimulatory effect of testosterone on Notch signaling was also observed in 15P-1 cells, in which we detected no AR expression. Taken together, these results suggested that other receptor(s) besides the AR may be involved in the regulation of Notch pathway by testosterone. RT-PCR, western blotting and immunofluorescence analyses confirmed that all cellular models used herein express ZIP9. Both, ZIP9 knockdown or treatment of 15P-1 cells with Bic (antagonist of AR and ZIP9) abolished testosterone-induced upregulation of Notch1/N1ICD expression and Notch pathway activity. This led us to the conclusion that both AR and ZIP9 are involved in testosterone-mediated increase in Notch signaling in Sertoli cells. The activity of canonical Notch pathway in Sertoli cells is manifested by enhanced expression of HES1 and HEY1 transcriptional repressors [9,17,21]. Accordingly, we found that testosterone-induced Notch signaling activity was followed by upregulation of Hey1 and Hes1 mRNA and protein. However, androgen receptors’ silencing experiments and antiandrogen exposures provided evidence that different androgen signaling pathways are involved in the control of each effector gene. In TM4 and PSC AR knockdown or inhibition, respectively, abolished the effect of testosterone on HEY1 expression, indicating that HEY1 is regulated by AR-dependent pathway. In prostate cancer cells HEY1 functions as a corepressor for AF1 in the AR, inhibiting transcription from androgen-dependent target genes [47]. Although such interaction has not been confirmed in Sertoli cells yet, HEY1 may be considered as a factor involved in AR-controlled cellular responses. It is possible that HEY1 upregulation in response to AR activation may limit AR-regulated transcription, serving as negative feedback regulatory mechanism in AR-expressing cells. Zip9 silencing in TM4 cells was ineffective in blocking testosterone action on HEY1 expression or localization, which suggested that ZIP9 was not involved in its regulation. This was confirmed in 15P-1 cells, where testosterone exposure increased HEY1, but ZIP9 knockdown or exposure to Bic were not able to prevent the action of testosterone. Since AR was undetectable in 15P-1 cells, our results suggest that some other AR- and ZIP9-independent mechanism is involved in HEY1 regulation by androgen in AR-negative Sertoli cells. In recent years TRPM8 (transient receptor potential cation channel subfamily M member 8) and GPRC6A (G protein-coupled receptor class C group 6 member A) proteins were demonstrated to mediate the action of androgens in prostate cancer cells [48–50]. Both proteins are localized also in rodent Sertoli cells [51,52], but their role as potential androgen receptors in these cells remains to be investigated. Reduction of AR signaling by siRNA or HF exposure was unable to prevent stimulatory effect of testosterone on Hes1 expression in TM4 and PSC, whereas ZIP9 knockdown or inhibition by Bic Int. J. Mol. Sci. 2020, 21, 8275 14 of 22 effectively blocked this effect, demonstrating that ZIP9 is involved in the regulation of HES1 expression. This is in agreement with our previous observations that in vivo AR blockade by flutamide did not attenuate the immunoexpression of HES1 in rat Sertoli cells, whereas testosterone reduction led to a decrease of HES1 immunostaining intensity measured with densitometry [33]. Interestingly, although strong immunofluorescence signal was maintained in cell nuclei following AR knockdown or inhibition, signal intensity was diminished in cell cytoplasm. This may suggest that despite no effect on HES1 expression level, AR-mediated signaling influence subcellular distribution of HES1 protein, regulating its nuclear transport. On the other hand, AR was required for FOXA1-enhanced Notch pathway activation in endometrial cancer cells, increasing Notch1 and HES1 expression [53]. Nevertheless, in Sertoli cells, the expression of two effector proteins HEY1 and HES1 is regulated by androgens via different signaling pathways. Diverse HEY1 and HES1 regulation by dihydrotestosterone was earlier observed in R1 castrate-resistant prostate cancer cell line, however the mechanism was not investigated in that study [54]. In light of the data, further studies are required to understand how AR and ZIP9 differentially regulate Hes1 and Hey1 expression by activation of transcriptional activity of RBP-J in Sertoli cells. Based on the recent findings by Clocchiatti et al. [55], who demonstrated physical association between AR and RBP-J in primary human dermal fibroblasts, it is likely that both proteins are constituents of a common, ligand-dependent complex, which regulates transcription of target genes. To date, evidence for direct interaction between ZIP9 and NICD is lacking. However, CREB consensus motifs were found in association with numerous RBP-J sites in murine T-cells [56], which may indicate a possible interaction with CREB-mediated signaling pathways, such as ZIP9 signaling. Currently, it is becoming evident that in addition to the DNA sequence, other factors, such as protein-protein interactions, may play a role in RBP-J associations with chromatin. In consequence, interactions with different transcription factors may modulate activities of RBP-J, and thus Notch signaling could be diversified through differential DNA targeting [57]. Finally, it should be noted that cell culture models used in the present study allow us to obtain precise insight into the interactions of particular signaling pathways in Sertoli cells, however further research using AR and ZIP9 knock-out mouse models are necessary to confirm these relations in the environment of seminiferous epithelium in vivo. Taken together, testosterone regulates Notch signaling in Sertoli cells acting at various levels of this pathway. Androgen signaling through both AR and ZIP9 receptors controls not only the expression and activation of Notch1, RBP-J transcriptional activity, the expression of Notch target genes, and distribution of the effector proteins within the cells, as demonstrated herein, but also the expression of Notch ligands in both Sertoli and germ cells, as we reported previously [33]. Another possible androgen target is γ-secretase and the process of Notch receptor cleavage. It was demonstrated that presenilin 1 (PS1), an enzymatic unit of γ-secretase, is regulated by testosterone in the cerebral cortex of male mice in age-dependent manner [58] and its expression is altered in hippocampus of hypogonadal male mice [59]. In addition, androgens may act on intracellular regulators of Notch signaling. For instance, androgens up-regulate transcription of Notch inhibitor, Numb, in prostate cancer cells [60]. Finally, it cannot be excluded that, at least to some extent, androgens may modulate Hes1 or Hey1 expression in Notch-independent manner, as it was described for other signaling pathways [61]. Whether any of these mechanisms are also involved in androgen effect on Notch signaling in Sertoli cells needs further consideration.

4. Materials and Methods

4.1. Cell Line Cultures and Treatments The mouse Sertoli cell lines TM4 (Cat no. CRL-1715) and 15P-1 (Cat no. CRL-2618) were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and were maintained under standard conditions. Properties of both cell lines were evaluated according to cell line authentication recommendations of the Global Bioresource Center (ATCC). Microscopic observation, analysis of Int. J. Mol. Sci. 2020, 21, 8275 15 of 22 proliferation and viability and detection cell-speciﬁc markers expression (androgen binding protein (Abp), Desert Hedgehog (Dhh), SRY-box 9 (Sox9), sulphated glycoprotein-2 (Sgp-2), GATA binding protein 4 (Gata4); Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland; Table S1) were performed. Cells were seeded directly into cell culture plates or on coverslips. Before each experiment, cells were serum starved for 24 h. The same cell concentration (0.5 106/cm2) × was used in all experiments, so the ratio of T concentration and initial cell number was constant between experiments. 8 6 Cells were treated with 10− M to 10− M testosterone (T, Cat no. 86500; Sigma-Aldrich, St. Louis, 4 6 MO, USA) or anti-androgens 10− M hydroxyflutamide (HF; Cat no. H4166; Sigma-Aldrich) or 10− M 8 bicalutamide (Bic) (Cat no. B9061; Sigma-Aldrich) alone or with the addition of 10− M T for 24 h. Control cells were incubated in the presence of the vehicle (0.01% dimethyl sulfoxide, DMSO).

4.2. Transfection of TM4 or 15P-1 Cells with siRNA Duplexes To knockdown AR or ZIP9 in Sertoli cells by RNAi, TM4 or 15P-1, cells were seeded at 0.1 105 cells/cm2 in 6-well plates [9]. Next, the cells were transfected with Silencer™ Select siRNAs × (AR-specific siRNA assay ID: s62547, ZIP9-specific siRNA assay ID: s116149; Thermo Fisher Scientific, Waltham, MA, USA) using jetPrime Transfection Reagent (Polyplus-Transfection S.A., Bioparc, Illkirch, France) in serum-free Opti-MEM (Cat no. 11058021; Life Technologies, Gaithersburg, MD, USA), according to the manufacturer’s instructions. Negative control cells were treated with jetPrime Transfection Reagent alone or jetPrime Transfection Reagent plus Silencer™ Select Negative Control No. 1 (non-targeting siRNA; Cat no. 4404020; Thermo Fisher Scientific). Positive control was performed using Silencer™ Select GAPDH Positive Control siRNA (Cat no. 4390849; Thermo Fisher Scientific). After 24 h, cells were washed twice to remove silencing duplexes and transfection medium. Cells were treated with 10 8 M T or a vehicle for 24 h. Transfection efficiencies were in the range of 87 2% for AR − ± siRNA and 73 5% for ZIP9 siRNA. No cytotoxic effect of used concentrations of siRNAs was detected ± (CellTiter-Glo® Luminescent Cell Viability Assay, Cat no. G7570; Promega, Madison, WI, USA).

4.3. Reporter Assay RBP-J reporter assay was performed using Cignal RBP-J Pathway Reporter Assay (Cat No. 336841; Qiagen, Hilden, Germany) according to manufacturer’s instruction. In the first experiment, TM4 and 15P-1 cells were transfected with RBP-J reporter (a mixture of an inducible RBP-J responsive firefly luciferase reporter and constitutively expressing Renilla construct) and AR siRNA or ZIP9 siRNA. After 16 h cells were treated with T or vehicle. In the second experiment, cells were transfected with RBP-J reporter and after 24 h treated with T, HF or Bic. Luciferase activity was measured after 24 h using Dual-Glo Luciferase Assay System (Promega) with TECAN Infinite M200 Pro luminometer (Tecan; Männedorf, Switzerland). Firefly luciferase experimental reporter was normalized to Renilla luciferase activity to control transfection efficiency. Negative controls were performed as follows: (i) RBP-J reporter and non-targeting siRNA; (ii) a mixture of non-inducible firefly luciferase reporter and constitutively expressing Renilla construct (Cignal Negative Control); (iii) Cignal Negative Control and AR siRNA or ZIP9 siRNA; (iv) Cignal Negative Control and non-targeting siRNA. As a positive control a mixture of a constitutively expressing GFP construct, constitutively expressing firefly luciferase construct, and constitutively expressing Renilla luciferase construct was used (not shown).

4.4. Primary Sertoli Cell (PSC) Culture and Treatments Sertoli cells were isolated from 20-day-old rat testes according to previously described protocol [62]. Sertoli cells from 20-day-old rat are differentiated and have almost negligible contamination with somatic and germ cells. Primary cells were plated onto Matrigel- (Cat no. 354234; BD Biosciences, San Jose, CA, USA) coated 12-well plates at 0.5 106 cells/cm2 and incubated in serum-free Dulbecco’s × Modified Eagle Medium (DMEM) supplemented with growth factors and an antibiotic in a humidified Int. J. Mol. Sci. 2020, 21, 8275 16 of 22

atmosphere of 95% air and 5% CO2 (vol/vol) at 35 ◦C. At 48 h after plating, cultures were treated with a hypotonic buﬀer (20 mM Tris pH 7.4 at 22 ◦C) to lyse contaminating germ cells and obtaining primary 8 Sertoli cell cultures with 98% purity [63,64]. Next, primary Sertoli cells were treated with 10− M T, 4 6 10− M HF, or 10− M Bic alone or with T for 24 h. Control cells were incubated in the presence of the vehicle (0.01% DMSO).

4.5. RNA Isolation, Reverse Transcription and Real-Time Quantitative RT-PCR Total RNA was extracted from cells with TRIzol® reagent (Cat no. 15596026; Life Technologies) according to the manufacturer’s instructions. Contaminating DNA and DNase was removed with TURBO DNA-free™ Kit (Cat no. AM1907; Ambion, Austin, TX, USA) according to the manufacturer’s instructions. The yield and quality of the RNA were assessed by determining the A260:A280 ratio (NanoDrop ND2000 Spectrophotometer, Thermo Fisher Scientiﬁc) and by electrophoresis. An A260:280 ratio not lower than 1.9 was accepted for cDNA synthesis. High-Capacity cDNA Reverse Transcription Kit (Cat no. 4368814; Applied Biosystems, Carlsbad, CA, USA) was used to obtain total cDNA. Reactions for each RNA sample were run in the absence of RT to assess genomic DNA contamination. Real-time RT-PCR analyses were performed with the StepOne Real-time PCR system (Applied Biosystems) with the cDNA templates, primers (Institute of Biochemistry and Biophysics, Polish Academy of Sciences) listed in Table1 and SYBR Green master mix (Cat no. 4309155; Applied Biosystems), as described previously [9].

Table 1. Sequences of forward and reverse primers.

Gene Forward Primer Reverse Primer Mouse Actb CTGGAACGGTGAAGGTGACA AAGGGGACTTCCTGTAACAATGCA B2m TTCTGGTGCTTGTCTCACTCA CAGTATGTTCGGCTTCCCATTC Gapdh GGAGATTGTTGCCATCAACG GGAGATTGTTGCCATCAACG Hes1 ACCTTCCAGTGGCTCCTC TTTAGTGTCCGTCAGAAGAGAG Hey1 GCCGAAGTTGCCCGTTATCTG GCCGAAGTTGCCCGTTATCTG Notch1 GATGCCACCTGAACAACTGC TGACAACAGCAACAGCAAGG Rn18S CTCTGGTTGCTCTGTGCAGT GGCTCCTTGTAGGGGTTCTC Rat Actb AAGTACCCCATTGAACACGG ATCACAATGCCAGTGGTACG B2m GGACTGGTCTTTCTATATCCTGGC GATCACATGTCTCGATCCCAGTAG Gapdh GGAGATTGTTGCCATCAACG CACAATGCCAAAGTTGTCA Hes1 GGCAGGCGCACCCCGCCTTG GCAGCCAGGCTGGAGAGGCT Hey1 AAAGACGGAGAGGCATCATCG GCAGTGTGCAGCATTTTCAGG Notch1 GCAGCCACAGAACTTACAAATCCAG TAAATGCCTCTGGAATGTGGGTGAT Rn18S GCCGCGGTAATTCCAGCTCCA CCCGCCCGCTCCCAAGATC

Amplification efficiency [65], was between 97% and 104%. Melting curve analysis and subsequent agarose gel electrophoresis were used to confirm amplification specificity. In all real-time RT-PCR reactions, a negative control corresponding to RT reaction without the reverse transcriptase enzyme and a blank sample were carried out. mRNA expressions were normalized to the mean expression of reference genes Rn18s, B2m, Actb and Gapdh mRNA (relative quantification, RQ = 1) with the use of the ∆∆Ct 2− method [66].

4.6. Western Blot Analysis Lysates were obtained by sample sonification with a cold Tris/EDTA buffer (50 mM Tris, 1 mM EDTA, pH 7.5) supplemented with protease inhibitors (Cat no. P8340; Sigma-Aldrich). Samples were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions, transferred to polyvinylidene difluoride membranes (Sigma-Aldrich) and analyzed by Int. J. Mol. Sci. 2020, 21, 8275 17 of 22 immunoblotting with the respective primary antibodies as previously reported in detail [63]. Briefly, nonspecific binding sites were blocked with 5% (wt/v) non-fat dry milk containing 0.1% (v/v) Tween20. Next, the membrane was incubated with the respective primary antibody (Table2) at 4 ◦C overnight, followed by a horseradish peroxidase-conjugated secondary antibody (1:3000; Cat no. PI-1000-1; PI-2000-1; Vector Labs., Burlingame, CA, USA) for 1 h at room temperature.

Table 2. Details of primary antibodies used for Western blot and immunoﬂuorescence.

Antibody Host Species Vendor Cat. Number Dilution Anti-actin Mouse Sigma-Aldrich A2228 1:3000 (WB) Anti-HES1 Rabbit Thermo Fisher PA5-28802 1:1000 (WB); 1:100 (IF) Anti-HEY1 Rabbit Thermo Fisher PA5-40553 1:2000 (WB), 1:100 (IF) Anti-N1ICD Rabbit Abcam ab8925 1:1000 (WB), 1:200 (IF) IF—immunoﬂuorescence; WB—Western blot.

Proteins were detected by chemiluminescence and images were captured with a ChemiDocTM XRS+ System (Bio–Rad Labs., München, Germany). All immunoblots were stripped and reprobed with an antibody against β-actin (Table2). The molecular weights of target proteins were estimated by reference to standard proteins (Cat no. 1610397; Bio–Rad Labs.). To obtain semi-quantitative results, immunoblots were analyzed using the ImageLab software (Bio–Rad Labs.). Each data point was normalized against its corresponding actin data point.

4.7. Immunofluorescence Immunofluorescence labeling was performed on cells seeded on coverslips and treated as described in Sections 4.1, 4.2 and 4.4. The cells were washed with phosphate buffered saline (PBS), fixed with methanol–acetone and immunostained as described [67]. Nonspecific binding sites were blocked with 10% normal goat serum (Cat no. G9023; Sigma-Aldrich) for 20 min. Cells were incubated in the presence of primary antibodies (Table2) at 4 ◦C overnight. Next, Cy3-cojugated goat anti-Rabbit IgG (1:200; Cat no. A10520; Thermo Fisher Scientific) was applied for 60 min. Coverslips were mounted with Vectashield mounting medium (Cat no. H-1500; Vector Labs.) with 40,6-diamidino-2-phenylindole (DAPI) and examined with epifluorescence microscope Nikon Eclipse Ni (Nikon Instech Co., Japan). No background fluorescence was observed in the negative controls, where the primary antibody was omitted (not shown). The fluorescent images acquired with a 40 objective were analyzed using × ImageJ software (National Institutes of Health, Bethesda, MD). An outline was drawn around each cell (100 cells per sample) and the area, integrated density and mean gray value were measured along with adjacent background readings. Next, corrected total cell fluorescence (CTCF) = integrated density (area of selected cell mean fluorescence of background readings) was calculated as described × previously [68].

4.8. Statistical Analysis Each variable was tested using the Shapiro-Wilk W-test for normality. The homogeneity of variance was assessed with Levene’s test. Statistical differences in relative luciferase activity, mRNA expression levels, as well as differences in protein expression levels were assessed using one-way ANOVA, followed by Tukey’s post hoc comparison test. Statistical analyses were performed on raw data using Statistica 10 software (StatSoft Inc., Tulsa, OK, USA). Data were presented as means SD. ± Data were considered statistically significant at * p < 0.05, ** p < 0.01, *** p < 0.001.

5. Conclusions Our findings demonstrate that androgens influence activity of Notch pathway in rodent Sertoli cells. For the first time, we provided evidence for the role of membrane androgen receptor ZIP9 in the control of Notch pathway. Activation of AR- and ZIP9-mediated signaling produce different but complementary Int. J. Mol. Sci. 2020, 21, 8275 18 of 22 effects on Notch effector gene expression, pointing to cooperation of classical and non-classical androgen Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 18 of 23 signaling pathways in controlling Sertoli cell function (Figure 11). The importance of Notch pathway in Sertoli cells for the regulation of spermatogenesis has just begun to be elucidated and the functional be elucidated and the functional role of androgen-Notch signaling crosstalk in seminiferous role of androgen-Notch signaling crosstalk in seminiferous epithelium requires further investigation. epithelium requires further investigation.

Figure 11. Schematic representation of the crosstalk between androgen and Notch signaling pathways Figure 11. Schematic representation of the crosstalk between androgen and Notch signaling pathways inin rodent rodent Sertoli Sertoli cells. cells. NotchNotch signalingsignaling inin SertoliSertoli cellscells maymay bebe inducedinduced byby Delta-likeDelta-like oror Jagged Jagged ligands ligands expressedexpressed either either in in Sertoli Sertoli or or germ germ cells. cells. In SertoliIn Sertoli cells, cells, the actionthe action of testosterone of testosterone via both via ARboth and AR ZIP9 and increasesZIP9 increases Notch1 /Notch1/N1ICDN1ICD expression expression and transcriptional and transcr activityiptional of activity RBP-J. ARof signalingRBP-J. AR is involvedsignaling inis theinvolved up-regulation in the up-regulation of Hey1 expression, of Hey1 whereas expression, ZIP9-mediated whereas pathway ZIP9-mediated controls Hes1pathwayexpression. controls Green Hes1 arrowsexpression. indicate Green interactions arrows indicate revealed interactions in the present reve study.aled in Black the present arrows indicatestudy. Black established arrows stepsindicate of androgenestablished and steps Notch of androgen signaling and pathways. Notch signalin Red openg pathways. arrows—up-regulation. Red open arrows—up-regulation. AR—nuclear androgen AR— receptor;nuclear androgen GC—germ receptor; cells; DLL GC—germ/JAG—Delta-like cells; DL/JaggedL/JAG—Delta-like/Jagged ligands; N1ICD—Notch1 ligands; intracellular N1ICD—Notch1 domain; RBP-J—Recombinationintracellular domain; signalRBP-J—Recombination binding protein; SC—Sertolisignal binding cells; T—Testosterone;protein; SC—Sertoli ZIP9—Zrt- cells; andT— Irt-likeTestosterone; protein ZIP9—Zrt- 9. and Irt-like protein 9.

Supplementary Materials: Supplementary materials can be found at www.mdpi.com/xxx/s1, Table S1: Supplementary Materials: Supplementary materials can be found at http://www.mdpi.com/1422-0067/21/21/ 8275Sequences/s1, Table of S1:forward Sequences and reverse of forward primers and used reverse for primersdetection used of Sertoli for detection cell-specific of Sertoli markers. cell-specific markers. AuthorAuthor Contributions: Contributions:Conceptualization, Conceptualization, A.K.A.K. andand A.H.;A.H.; DataData curation,curation, A.K.A.K. andand A.H.;A.H.; FormalFormal analysis,analysis, A.K.,A.K., S.M.,S.M., B.B., B.B., and and A.H.; A.H.; Investigation, Investigation, A.K., A.K., S.M., S.M., L.P., L.P., M.B., M.B., and and A.H.; A.H; Methodology, Methodology, A.K., A.K., S.M., S.M., L.P., M.B.,L.P., andM.B., A.H.; and ProjectA.H.; Project administration, administration, A.H.; Supervision, A.H.; Supervision, B.B. and B.B. A.H.; and Writing—original A.H.; Writing—original draft, A.K. draft, and A.K. A.H.; and Writing—review A.H.; Writing— & editing, A.K., S.M., L.P., M.B., B.B., and A.H. All authors have read and agreed to the published version of review & editing, A.K., S.M., L.P., M.B., B.B., and A.H. All authors have read and agreed to the published version the manuscript. of the manuscript. Funding: This research was funded by National Science Centre (Poland), grant 2017/25/B/NZ4/01037 (OPUS 13). Funding: This research was funded by National Science Centre (Poland), grant 2017/25/B/NZ4/01037 (OPUS 13). Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study;Conflicts in the of collection,Interest: The analyses, authors or declare interpretation no conflict of data; of interest. in the writing The funders of the manuscript,had no role orin inthe the design decision of the to publishstudy; in the the results. collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. Abbreviations

ARAbbreviations Nuclear androgen receptor ATF-1 Activating transcription factor 1 AR Nuclear androgen receptor BicATF-1 Bicalutamide Activating transcription factor 1 CREBBic cAMP-responseBicalutamide element binding protein CREB cAMP-response element binding protein DAPI 4′,6-diamidino-2-phenylindole DMEM Dulbecco′s Modified Eagle Medium DMSO Dimethyl sulfoxide EDTA Ethylenediaminetetraacetic acid

Int. J. Mol. Sci. 2020, 21, 8275 19 of 22

DAPI 40,6-diamidino-2-phenylindole DMEM Dulbecco0s Modiﬁed Eagle Medium DMSO Dimethyl sulfoxide EDTA Ethylenediaminetetraacetic acid ERK 1/2 Extracellular signal-regulated protein kinase 1/2 FOXA1 Forkhead box protein A1 GPRC6A G protein-coupled receptor class C group 6 member A Hes1/HES1 Hairy/enhancer of split 1 Hey1/HEY1 Hes-related with YRPW motif 1 HF Hydroxyﬂutamide N1ICD Notch1 intracellular domain PSC Primary Sertoli cells RBP-J Recombination signal binding protein RT-PCR Reverse-transcriptase polymerase chain reaction SDS-PAGE Sodium dodecyl sulfate – poliacrylamide gel electrophoresis TRPM8 Transient receptor potential cation channel subfamily M member 8 ZIP9 Zrt- and Irt-like protein 9

References

1. Bremner, W.J.; Millar, M.R.; Sharpe, R.M.; Saunders, P.T. Immunohistochemical localization of androgen receptors in the rat testis: Evidence for stage-dependent expression and regulation by androgens. Endocrinology 1994, 135, 1227–1234. [CrossRef][PubMed] 2. Rey, R.A.; Musse, M.; Venara, M.; Chemes, H.E. Ontogeny of the androgen receptor expression in the fetal and postnatal testis: Its relevance on Sertoli cell maturation and the onset of adult spermatogenesis. Microsc. Res. Tech. 2009, 72, 787–795. [CrossRef] 3. De Gendt, K.; Swinnen, J.V.; Saunders, P.T.; Schoonjans, L.; Dewerchin, M.; Devos, A.; Tan, K.; Atanassova, N.; Claessens, F.; Lécureuil, C.; et al. A Sertoli cell-selective knockout of the androgen receptor causes spermatogenic arrest in meiosis. Proc. Natl. Acad. Sci. USA 2004, 101, 1327–1332. [CrossRef] 4. Davey, R.A.; Grossmann, M. Androgen receptor structure, function and biology: From bench to bedside. Clin. Biochem. Rev. 2016, 37, 3–15. 5. Walker, W.H. Non-classical actions of testosterone and spermatogenesis. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2010, 365, 1557–1569. [CrossRef][PubMed] 6. O’Hara, L.; Smith, L.B. Androgen receptor roles in spermatogenesis and infertility. Best Pract. Res. Clin. Endocrinol. Metab. 2015, 29, 595–605. [CrossRef][PubMed] 7. Berg, A.H.; Rice, C.D.; Rahman, M.S.; Dong, J.; Thomas, P. Identification and characterization of membrane androgen receptors in the ZIP9 zinc transporter subfamily: I. Discovery in female atlantic croaker and evidence ZIP9 mediates testosterone-induced apoptosis of ovarian follicle cells. Endocrinology 2014, 155, 4237–4249. [CrossRef][PubMed] 8. Bulldan, A.; Dietze, R.; Shihan, M.; Scheiner-Bobis, G. Non-classical testosterone signaling mediated through ZIP9 stimulates claudin expression and tight junction formation in Sertoli cells. Cell Signal. 2016, 28, 1075–1085. [CrossRef] 9. Kamińska,A.; Pardyak, L.; Marek, S.; Wróbel, K.; Kotula-Balak, M.; Bilińska,B.; Hejmej, A. Notch signaling regulates nuclear androgen receptor AR and membrane androgen receptor ZIP9 in mouse Sertoli cells. Andrology 2020, 8, 457–472. [CrossRef][PubMed] 10. Profaska-Szymik, M.; Galuszka, A.; Korzekwa, A.J.; Hejmej, A.; Gorowska-Wojtowicz, E.; Pawlicki, P.; Kotula-Balak, M.; Tarasiuk, K.; Tuz, R. Implication of membrane androgen receptor (ZIP9) in cell senescence in regressed testes of the bank vole. Int. J. Mol. Sci. 2020, 21, 6888. [CrossRef] 11. Bulldan, A.; Shihan, M.; Goericke-Pesch, S.; Scheiner-Bobis, G. Signaling events associated with gonadotropin releasing hormone-agonist-induced hormonal castration and its reversal in canines. Mol. Reprod. Dev. 2016, 83, 1092–1101. [CrossRef][PubMed] 12. Thomas, P.; Pang, Y.; Dong, J.; Berg, A.H. Identification and characterization of membrane androgen receptors in the ZIP9 zinc transporter subfamily: II. Role of human ZIP9 in testosterone-induced prostate and breast cancer cell apoptosis. Endocrinology 2014, 155, 4250–4265. [CrossRef] Int. J. Mol. Sci. 2020, 21, 8275 20 of 22

13. Bulldan, A.; Bartsch, J.W.; Konrad, L.; Scheiner-Bobis, G. ZIP9 but not the androgen receptor mediates testosterone-induced migratory activity of metastatic prostate cancer cells. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 1857–1868. [CrossRef][PubMed] 14. Kalyvianaki, K.; Panagiotopoulos, A.A.; Malamos, P.; Moustou, E.; Tzardi, M.; Stathopoulos, E.N.; Ioannidis, G.S.; Marias, K.; Notas, G.; Theodoropoulos, P.A.; et al. Membrane androgen receptors (Oxer1, Gprc6a and ZIP9) in prostate and breast cancer: A comparative study of their expression. Steroids 2019, 142, 100–108. [CrossRef] 15. Griswold, M.D. 50 years of spermatogenesis: Sertoli cells and their interactions with germ cells. Biol. Reprod. 2018, 99, 87–100. [CrossRef][PubMed] 16. Garcia, T.X.; DeFalco, T.; Capel, B.; Hofmann, M.C. Constitutive activation of Notch1 signaling in Sertoli cells causes gonocyte exit from quiescence. Dev. Biol. 2013, 377, 188–201. [CrossRef] 17. Garcia, T.X.; Parekh, P.; Gandhi, P.; Sinha, K.; Hofmann, M.C. The Notch Ligand JAG1 Regulates GDNF Expression in Sertoli Cells. Stem Cells Dev. 2017, 26, 585–598. [CrossRef] 18. Parekh, P.A.; Garcia, T.X.; Waheeb, R.; Jain, V.; Gandhi, P.; Meistrich, M.L.; Shetty, G.; Hofmann, M.C. Undifferentiated spermatogonia regulate Cyp26b1 expression through NOTCH signaling and drive germ cell differentiation. FASEB J. 2019, 33, 8423–8435. [CrossRef] 19. Murta, D.; Batista, M.; Trindade, A.; Silva, E.; Henrique, D.; Duarte, A.; Lopes-da-Costa, L. In vivo notch signaling blockade induces abnormal spermatogenesis in the mouse. PLoS ONE 2014, 9, e113365. [CrossRef] 20. Falo-Sanjuan, J.; Bray, S.J. Decoding the Notch signal. Dev. Growth Differ. 2020, 62, 4–14. [CrossRef] 21. Iso, T.; Kedes, L.; Hamamori, Y. HES and HERP families: Multiple effectors of the Notch signaling pathway. J. Cell Physiol. 2003, 194, 237–255. [CrossRef] 22. Bray, S.J. Notch signalling in context. Nat. Rev. Mol. Cell Biol. 2016, 17, 722–735. [CrossRef][PubMed] 23. Krejcí, A.; Bernard, F.; Housden, B.E.; Collins, S.; Bray, S.J. Direct response to Notch activation: Signaling crosstalk and incoherent logic. Sci. Signal. 2009, 2.[CrossRef] 24. Bertrand, F.E. The cross-talk of NOTCH and GSK-3 signaling in colon and other cancers. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118738. [CrossRef][PubMed] 25. Kamakura, S.; Oishi, K.; Yoshimatsu, T.; Nakafuku, M.; Masuyama, N.; Gotoh, Y. Hes binding to STAT3 mediates crosstalk between Notch and JAK-STAT signalling. Nat. Cell Biol. 2004, 6, 547–554. [CrossRef] 26. Li, N.; Zhang, L.; Li, Q.; Du, Y.; Liu, H.; Liu, Y.; Xiong, W. Notch activity mediates oestrogen-induced stromal cell invasion in endometriosis. Reproduction 2018, 157, 371–381. [CrossRef] 27. Piccirilli, D.; Baldini, E.; Massimiani, M.; Camaioni, A.; Salustri, A.; Bernardini, R.; Centanni, M.; Ulisse, S.; Moretti, C.; Campagnolo, L. Thyroid hormone regulates protease expression and activation of Notch signaling in implantation and embryo development. J. Endocrinol. 2018, 236, 1–12. [CrossRef] 28. Sinha-Hikim, I.; Cornford, M.; Gaytan, H.; Lee, M.L.; Bhasin, S. Effects of testosterone supplementation on skeletal muscle fiber hypertrophy and satellite cells in community-dwelling older men. J. Clin. Endocrinol. Metab. 2006, 91, 3024–3033. [CrossRef][PubMed] 29. Nantermet, P.V.; Xu, J.; Yu, Y.; Hodor, P.; Holder, D.; Adamski, S.; Gentile, M.A.; Kimmel, D.B.; Harada, S.; Gerhold, D.; et al. Identification of genetic pathways activated by the androgen receptor during the induction of proliferation in the ventral prostate gland. J. Biol. Chem. 2003, 23.[CrossRef] 30. Aldahl, J.; Yu, E.J.; He, Y.; Hooker, E.; Wong, M.; Le, V.; Olson, A.; Lee, D.H.; Kim, W.K.; Murtaugh, C.L.; et al. A pivotal role of androgen signaling in Notch-responsive cells in prostate development, maturation, and regeneration. Differentiation 2019, 107, 1–10. [CrossRef] 31. Defalco, T.; Saraswathula, A.; Briot, A.; Iruela-Arispe, M.L.; Capel, B. Testosterone levels influence mouse fetal Leydig cell progenitors through notch signaling. Biol. Reprod. 2013, 88, 91. [CrossRef] 32. Willems, A.; Batlouni, S.R.; Esnal, A.; Swinnen, J.V.; Saunders, P.T.; Sharpe, R.M.; França, L.R.; De Gendt, K.; Verhoeven, G. Selective ablation of the androgen receptor in mouse sertoli cells affects sertoli cell maturation, barrier formation and cytoskeletal development. PLoS ONE 2010, 5, e14168. [CrossRef] 33. Kamińska,A.; Marek, S.; Pardyak, L.; Brzoskwinia, M.; Pawlicki, P.; Bilińska,B.; Hejmej, A. Disruption of androgen signaling during puberty affects Notch pathway in rat seminiferous epithelium. Reprod. Biol. Endocrinol. 2020, 18, 30. [CrossRef] 34. Handelsman, D.J.; Jimenez, M.; Singh, G.K.; Spaliviero, J.; Desai, R.; Walters, K.A. Measurement of testosterone by immunoassays and mass spectrometry in mouse serum, testicular, and ovarian extracts. Endocrinology 2015, 156, 400–405. [CrossRef] Int. J. Mol. Sci. 2020, 21, 8275 21 of 22

35. Oduwole, O.O.; Vydra, N.; Wood, N.E.; Samanta, L.; Owen, L.; Keevil, B.; Donaldson, M.; Naresh, K.; Huhtaniemi, I.T. Overlapping dose responses of spermatogenic and extragonadal testosterone actions jeopardize the principle of hormonal male contraception. FASEB J. 2014, 28, 2566–2576. [CrossRef][PubMed] 36. Rato, L.; Alves, M.G.; Dias, T.R.; Lopes, G.; Cavaco, J.E.; Socorro, S.; Oliveira, P.F. High-energy diets may induce a pre-diabetic state altering testicular glycolytic metabolic proﬁle and male reproductive parameters. Andrology 2013, 1, 495–504. [CrossRef] 37. Gatson, J.W.; Singh, M. Activation of a membrane-associated androgen receptor promotes cell death in primary cortical astrocytes. Endocrinology 2007, 148, 2458–2464. [CrossRef] 38. Li, S.; Kang, L.; Zhang, Y.; Feng, B.; Du, J.; Cui, H. Detecting the presence of hippocampus membrane androgen receptors in male SAMP8 mice and their induced synaptic plasticity. Mol. Cell. Endocrinol. 2015, 414, 82–90. [CrossRef] 39. Zhang, Y.; Li, S.; Chen, H.; Chen, M.; Mi, S.; Ma, J.; Wang, C.; Sun, H.; Liu, X.; Cui, H. Non-genomic mechanisms mediate androgen-induced PSD95 expression. Aging 2019, 11, 2281–2294. [CrossRef][PubMed] 40. Bulldan, A.; Malviya, V.N.; Upmanyu, N.; Konrad, L.; Scheiner-Bobis, G. Testosterone/bicalutamide antagonism at the predicted extracellular androgen binding site of ZIP9. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 2402–2414. [CrossRef] 41. Aguirre-Portolés, C.; Payne, R.; Trautz, A.; Foskett, J.K.; Natale, C.A.; Ridky, T.W. Testosterone signaling through ZIP9 renders melanoma more aggressive in males than in females. bioRxiv 2020, 2020, 989160. [CrossRef] 42. Kim, J.H.; Han, G.C.; Seo, J.Y.; Park, I.; Park, W.; Jeong, H.W.; Lee, S.H.; Bae, S.H.; Seong, J.; Yum, M.K.; et al. Sex hormones establish a reserve pool of adult muscle stem cells. Nat. Cell Biol. 2016, 18, 930–940. [CrossRef] 43. Sharma, N.L.; Massie, C.E.; Ramos-Montoya, A.; Zecchini, V.; Scott, H.E.; Lamb, A.D.; MacArthur, S.; Stark, R.; Warren, A.Y.; Mills, I.G.; et al. The androgen receptor induces a distinct transcriptional program in castration-resistant prostate cancer in man. Cancer Cell 2013, 23, 35–47. [CrossRef] 44. Olsen, J.R.; Azeem, W.; Hellem, M.R.; Marvyin, K.; Hua, Y.; Qu, Y.; Li, L.; Lin, B.; Ke, X.; Øyan, A.M.; et al. Context dependent regulatory patterns of the androgen receptor and androgen receptor target genes. BMC Cancer 2016, 16, 377. [CrossRef] 45. Converse, A.; Zhang, C.; Thomas, P. Membrane androgen receptor ZIP9 induces croaker ovarian cell apoptosis via stimulatory G protein alpha subunit and MAP kinase signaling. Endocrinology 2017, 158, 3015–3029. [CrossRef] 46. Shihan, M.; Chan, K.H.; Konrad, L.; Scheiner-Bobis, G. Non-classical testosterone signaling in spermatogenic GC-2 cells is mediated through ZIP9 interacting with Gnα11. Cell Signal. 2015, 27, 2077–2086. [CrossRef] 47. Belandia, B.; Powell, S.M.; García-Pedrero, J.M.; Walker, M.M.; Bevan, C.L.; Parker, M.G. Hey1, a mediator of notch signaling, is an androgen receptor corepressor. Mol. Cell Biol. 2005, 25, 1425–1436. [CrossRef] 48. Asuthkar, S.; Velpula, K.K.; Elustondo, P.A.; Demirkhanyan, L.; Zakharian, E. TRPM8 channel as a novel molecular target in androgen-regulated prostate cancer cells. Oncotarget 2015, 6, 17221–17236. [CrossRef] 49. Grolez, G.P.; Gordiendko, D.V.; Clarisse, M.; Hammadi, M.; Desruelles, E.; Fromont, G.; Prevarskaya, N.; Slomianny, C.; Gkika, D. TRPM8-androgen receptor association within lipid rafts promotes prostate cancer cell migration. Cell Death Dis. 2019, 10, 652. [CrossRef] 50. Ye, R.; Pi, M.; Nooh, M.M.; Bahout, S.W.; Quarles, L.D. Human GPRC6A mediates testosterone-induced mitogen-activated protein kinases and mTORC1 signaling in prostate cancer cells. Mol. Pharmacol. 2019, 95, 563–572. [CrossRef] 51. Borowiec, A.S.; Sion, B.; Chalmel, F.; Rolland, A.D.; Lemonnier, L.; De Clerck, T.; Bokhobza, A.; Derouiche, S.; Dewailly, E.; Slomianny, C.; et al. Cold/menthol TRPM8 receptors initiate the cold-shock response and protect germ cells from cold-shock-induced oxidation. FASEB J. 2016, 30, 3155–3170. [CrossRef] 52. Pi, M.; Chen, L.; Huang, M.Z.; Zhu, W.; Ringhofer, B.; Luo, J.; Christenson, L.; Li, B.; Zhang, J.; Jackson, P.D.;et al. GPRC6A null mice exhibit osteopenia, feminization and metabolic syndrome. PLoS ONE 2008, 3, e3858. [CrossRef] 53. Qiu, M.; Bao, W.; Wang, J.; Yang, T.; He, X.; Liao, Y.; Wan, X. FOXA1 promotes tumor cell proliferation through AR involving the Notch pathway in endometrial cancer. BMC Cancer 2014, 14, 78. [CrossRef] 54. Chen, H.; Libertini, S.J.; George, M.; Dandekar, S.; Tepper, C.G.; Al-Bataina, B.; Kung, H.J.; Ghosh, P.M.; Mudryj, M. Genome-wide analysis of androgen receptor binding and gene regulation in two CWR22-derived prostate cancer cell lines. Endocr. Relat. Cancer 2010, 17, 857–873. [CrossRef] Int. J. Mol. Sci. 2020, 21, 8275 22 of 22

55. Clocchiatti, A.; Ghosh, S.; Procopio, M.G.; Mazzeo, L.; Bordignon, P.; Ostano, P.; Goruppi, S.; Bottoni, G.; Katarkar, A.; Levesque, M.; et al. Androgen receptor functions as transcriptional repressor of cancer-associated fibroblast activation. J. Clin. Investig. 2018, 128, 5531–5548. [CrossRef] 56. Wang, H.; Zou, J.; Zhao, B.; Johannsen, E.; Ashworth, T.; Wong, H.; Pear, W.S.; Schug, J.; Blacklow, S.C.; Arnett, K.L.; et al. Genome-wide analysis reveals conserved and divergent features of Notch1/RBPJ binding in human and murine T-lymphoblastic leukemia cells. Proc. Natl. Acad. Sci. USA 2011, 108, 14908–14913. [CrossRef] 57. Lake, R.J.; Tsai, P.F.; Choi, I.; Won, K.J.; Fan, H.Y. RBPJ, the major transcriptional effector of Notch signaling, remains associated with chromatin throughout mitosis, suggesting a role in mitotic bookmarking. PLoS Genet. 2014, 10, e1004204. [CrossRef] 58. Ghosh, S.; Thakur, M.K. PS1 expression is downregulated by gonadal steroids in adult mouse brain. Neurochem. Res. 2008, 33, 365–369. [CrossRef][PubMed] 59. Drummond, E.S.; Martins, R.N.; Handelsman, D.J.; Harvey, A.R. Altered expression of Alzheimer’s disease-related proteins in male hypogonadal mice. Endocrinology 2012, 153, 2789–2799. [CrossRef] 60. Liu, X.H.; Wu, Y.; Yao, S.; Levine, A.C.; Kirschenbaum, A.; Collier, L.; Bauman, W.A.; Cardozo, C.P. Androgens up-regulate transcription of the Notch inhibitor Numb in C2C12 myoblasts via Wnt/β-catenin signaling to T cell factor elements in the Numb promoter. J. Biol. Chem. 2013, 288, 17990–17998. [CrossRef] 61. Curry, C.L.; Reed, L.L.; Nickoloff, B.J.; Miele, L.; Foreman, K.E. Notch-independent regulation of Hes-1 expression by c-Jun N-terminal kinase signaling in human endothelial cells. Lab. Invest. 2006, 86, 842–852. [CrossRef] 62. Mruk, D.D.; Cheng, C.Y. An in vitro system to study Sertoli cell blood-testis barrier dynamics. Methods Mol. Biol. 2011, 763, 237–252. [CrossRef][PubMed] 63. Chojnacka, K.; Zarzycka, M.; Hejmej, A.; Mruk, D.D.; Gorowska, E.; Kotula-Balak, M.; Klimek, M.; Bilinska, B. Hydroxyflutamide affects connexin 43 via the activation of PI3K/Akt-dependent pathway but has no effect on the crosstalk between PI3K/Akt and ERK1/2 pathways at the Raf-1 kinase level in primary rat Sertoli cells. Toxicol. In Vitro 2016, 31, 146–157. [CrossRef] 64. Galdieri, M.; Ziparo, E.; Palombi, F.; Russo, M.A.; Stefanini, M. Pure Sertoli cell cultures: A new model for the study of somatic—germ cell interactions. J. Androl. 1981, 2, 249–254. [CrossRef] 65. Svec, D.; Tichopad, A.; Novosadova, V.; Pfaffl, M.W.; Kubista, M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomol. Detect. Quantif. 2015, 3, 9–16. [CrossRef][PubMed] 66. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 2001, 25, 402–408. [CrossRef] 67. Bilinska, B.; Hejmej, A.; Kotula-Balak, M. Preparation of testicular samples for histology and immunohistochemistry. Methods Mol. Biol. 2018, 1748, 17–36. [CrossRef] 68. Jakic, B.; Buszko, M.; Cappellano, G.; Wick, G. Elevated sodium leads to the increased expression of HSP60 and induces apoptosis in HUVECs. PLoS ONE 2017, 12, e0179383. [CrossRef]

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional aﬃliations.

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).