DEVELOPMENT AND USE OF cDNA-DERIVED SSR MARKERS FOR STUDYING
PUCCINIA STRIIFORMIS POPULATIONS AND MOLECULAR MAPPING OF
NEW GENES FOR EFFECTIVE RESISTANCE TO STRIPE RUST
IN DURUM WHEAT
By
PENG CHENG
A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY
WASHINGTON STATE UNIVERSITY Department of Plant Pathology AUGUST 2012
To the Faculty of Washington State University:
The members of the Committee appointed to examine the dissertation of PENG
CHENG find it satisfactory and recommend that it be accepted.
Xianming Chen, Ph.D., Chair
Scot H. Hulbert, Ph.D.
Tobin Peever, Ph.D.
Kulvinder Gill, Ph.D.
ii
ACKNOWLEDGMENTS
I am very grateful to Dr. Xianming Chen for providing me such a great opportunity to study in his program. I want to thank Dr. Chen for his time, advice and encouragement for my course work and research. Also, I would like to thank Dr. Scot Hulbert, Dr. Tobin Peever, and Dr. Kulvinder Gill for serving on my committee and their precious suggestions for my studies in the department, including the classes and research, and their time for critically reviewing my dissertation. Special thanks to Dr. Brenda Schroeder, Dr. Lori Carris, Dr. Hanu
Pappu, Dr. Lee A. Hadwiger, and Dr. Patricia Okubara for their big encouragement and nice advice during my graduate study.
I also want to show my appreciation to my colleagues in our laboratory, especially Dr.
Meinan Wang, Dr. Anmin Wan, and Dr. Kent Evans for helping me in the lab and greenhouse work. I also like to thank my collaborators Dr. Chuntao Yin and Dr. Paul Ling for the stripe rust EST libraries. I thank all my fellow graduate students and friends for being there to share all the good and bad times with me. Special thanks to the office staffs in the
Department of Plant Pathology for their help and support during my graduate study. Last but not least, I want to express my appreciation to my husband Dr. Liangsheng Xu for his support, sacrifice, understanding, and love.
iii
DEVELOPMENT AND USE OF cDNA-DERIVED SSR MARKERS FOR STUDYING
PUCCINIA STRIIFORMIS POPULATIONS AND MOLECULAR MAPPING OF
NEW GENES FOR EFFECTIVE RESISTANCE TO STRIPE RUST
IN DURUM WHEAT Abstract
by Peng Cheng, Ph.D. Washington State University August 2012
Chair: Xianming Chen
Puccinia striiformis , a basidiomycete fungus, produces dikaryotic urediniospores causing stripe rust of wheat, barley, and many grass species. To study its population biology, three cDNA libraries were screened for simple sequence repeats (SSRs) and their flanking sequences were used to design primers. Seventeen primer pairs which produced stable polymorphic markers among 28 isolates of the pathogen were demonstrated to be useful for population studies.
To characterize stripe rust on grasses and determine if somatic hybridization occur between P. striiformis f. sp. tritici (Pst , the wheat stripe rust pathogen) and P. striiformis f. sp. hordei (Psh , the barley stripe rust pathogen), 103 isolates from wheat, barley, and various grasses were tested on 20 wheat and 12 barley genotypes that are used to differentiate races of Pst and Psh , respectively. Virulence analyses indicated that some grass isolates were able to attack some differential genotypes of wheat, barley, or both. Molecular testing with 20 SSR markers showed that some of the grass isolates are hybrids between Pst and Psh . The results suggest that somatic hybridization occurs between Pst and Psh on grasses.
iv
To determine how the Pst population reproduces in the US Pacific Northwest (PNW), a systemic collection of single-stripe samples were made in 2010 in 26 wheat fields in the
PNW especially the Palouse region, where plants of Berberis vulgaris , an alternate host of P. striiformis , still grow. Twenty one races and 66 molecular haplotypes were identified. The
SSR marker data revealed two genetic groups: homokaryotic (most PNW isolates) and heterokaryotic (most non-PNW US isolates). The different karyotypes were related to the groups of races. The analysis of multi-locus association ruled out the possibility of sexual reproduction in the PNW population.
Because growing resistant cultivars is the most effective approach to control stripe rust and new resistance genes are needed in breeding programs, studies were conducted to identify and map new genes for effective resistance. Two mapping populations were developed by crossing durum wheat genotypes PI 331260 and PI 480016 with susceptible common spring wheat genotype Avocet Susceptible (AvS). A single dominant resistance gene was identified in each of the mapping populations. Using wheat SSR markers, both genes were mapped to wheat chromosome 1BS, but at different loci. Common wheat lines with these genes were selected for breeding programs to develop stripe rust resistant cultivars.
v
TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS……………………………………………………………………iii
ABSTRACT…………………………………………………………………………………..iv
LIST OF TABLES…...... viii
LIST OF FIGURES…………………………………………………………………………....x
DEDICATION…………………………………………………………………………….....xii
CHAPTER
1. Literature review……………………………..…………………………………………...1
Stripe rust ……………....……...…………………………………….……………..……….1 Control of wheat stripe rust ……………………………………….………..…….…….....13 References …...…………………………..…………………………………………………22
2. Development and characterization of expressed sequence tag-derived microsatellite markers for the wheat stripe rust fungus Puccinia striiformis f. sp. tritici …..……...... 36
Abstract ………………………………………………………………………………….36 Introduction ……………………………..……………………………………………….…..37 Material and methods ……………………………………………………………….…...37 Results ….…………………………………………………………………………...……....41 Discussion ……………………………………………………………………………….…42 References ……...…………………………………………………………………………..46
3. Somatic hybridization between wheat stripe rust Puccinia striiformis f. sp. tritici and barley stripe rust ( P. striiformis f. sp. hordei ) in grasses revealed by virulence patterns and microsatellite markers...... 48
Abstract ………………………………………………………………………………….48 Introduction …..………………………………………………………………………...…....49 Material and methods ………………………………………………………………...….53 Results ….…………………………………………………………………………………...64 Discussion ……………………………………………………………...... ……………...84 References ……...…………………………………………………………………..………91
vi
4. Virulence and microsatellite markers revealed only asexual reproduction in the US Pacific Northwest Puccinia striiformis f. sp. tritici population...... 99
Abstract .………...……………………………………………………………………….99 Introduction ……..……………………………………………………………………...…..100 Material and methods ………………………………………………………………...... 104 Results ……………………….………………………………………………………….....113 Discussion ……………………………………………………………...... …………...133 References …...……………………………………………………………………………139
5. Molecular mapping of two genes for stripe rust resistance in durum wheat genotypes PI 331260 and PI 480016 from Ethiopia...... 146
Abstract ………………………………………………………………………………...146 Introduction ………………………..……………………………………………………….147 Material and methods ……………………………………………………………….….149 Results ………………………………….…………………………………………...……..156 Discussion …………………………………………………………………………...……163 References …...……………………………………………………………………………166
vii
LIST OF TABLES
Chapter 1
1. Wheat genotypes used to differentiate races of Puccinia striiformis f. sp. tritici in the United States…….………………………………...……………………...... …5
2. Wheat single gene lines used to differentiate races of Puccinia striiformis f. sp. tritici in the United States…….……………………..……………………………...... …6
3. Barley genotypes used to differentiate races of Puccinia striiformis f. sp. tritici in the United States…….……………………………………...………………...... …7
4. Comparison of all-stage resistance and HTAP resistance…………………………….....15
5. Genes for resistance to stripe rust ( Puccinia striiformis f. sp. tritici ), examples of wheat genotypes containing the genes, their chromosomal locations, types of resistance, and references.……………………………………………………...…...... …19
Chapter 2
1. Seventeen EST-SSR markers for Puccinia striiformis f. sp. tritici and their primer sequences, PCR annealing temperature, number of alleles and product size range, allele frequency, observed (Ho) and expected (He) heterozygosity, cross-species amplification, corresponding supercontig identification numbers of Puccinia striiformis f. sp. tritici (Pst ), P. graminis f. sp. tritici (Pgt ) and P. triticina (Pt )………………………………...39
Chapter 3
1. Hosts, collection locations, Puccinia striiformis f. sp. tritici (Pst ) and P. striiformis f. sp. hordei (Psh ) races, virulence phenotypes with combination of wheat and barley differential tests, and haplotypes and groups identified through molecular analysis of stripe rust isolates collected from wheat, barley, triticale, rye and various grasses……..54
2. Primer sequences, annealing temperatures and amplified fragment sizes of 20 microsatellite markers………...…………………….………………..………………….62
3. Virulence phenotypes, Puccinia striiformis f. sp. tritici (Pst ) and P. striiformis f. sp. hordei (Psh ) races identified from isolates of P. striiformis isolates collected from wheat, barley, triticale, rye, and various grasses………………………………………………...69
4. The mutation-scaled population size ( Θ), and migration rates (M) among the Puccinia striiformis populations from wheat, barley, and wild grasses based on the SSR data…..75
viii
5. Genotype assignment based on allele frequencies with 44 haplotypes from different hosts……………………………………………………………………………………...76
Chapter 4
1. Number of isolates, races, virulence group, haplotypes, and molecular group in collection regions…………………………………………………………………………….……106
2. Primer sequences, annealing temperatures (Tm) and primary sizes of amplified alleles of 20 microsatellite markers………………………………...…………………………….110
3. Puccinia striiformis f. sp. tritici races and their virulence formula, group and number of isolates in the PNW region, the non-PNW US, total number in the study and total frequency……………………………………………………………………………….116
4. Locations and dates of wheat fields sampled in 2010 and races and haplotypes of P. striiformis f. sp. tritici in the US Pacific Northwest……………………………………120
5. Nei’s gene diversity, Shannon’s information index, and Kosman index of the Puccinia striiformis f. sp. tritici populations in the Palouse region, the non-Palouse Pacific Northwest (PNW), and the non-PNW United States based on the SSR data…………..130
6. The mutation-scaled population size ( Θ), and migration rates (M) between the Puccinia striiformis f. sp. tritici populations in the Palouse region and the non-Palouse PNW; the PNW and the non-PNW US based on the SSR data……………………...……………131
7. Analysis of molecular variance (AMOVA) among and within the Puccinia striiformis f. sp. tritici populations in the Palouse region, the non-Palouse Pacific Northwest (PNW), and the non-PNW United States based on the SSR data…………..…………………...132
Chapter 5
1. Seedling infection types of PI 331260, PI 480016, and Avocet Susceptible (AvS) to races of Puccinia striiformis f. sp . tritici tested under controlled greenhouse conditions…...153
2. F6 plants and F 7 lines segregation for seedling resistance to races PST-127 of Puccinia striiformis f. sp . tritici in AvS/PI 331260 and AvS/PI 480016……………………...….157
3. Infection types on wheat genotypes with Yr genes on short arm of chromosome 1B produced by races of Puccinia striiformis f. sp. tritici …………………………………162
ix
LIST OF FIGURES
Chapter 2
1. Principal coordinates analysis of eight races of Puccinia striiformis using 17 SSR markers. PSH denotes races of P. striiformis f. sp. hordei , the barley stripe rust pathogen and PST denotes races of P. striiformis f. sp. tritici , the wheat stripe rust pathogen……44
Chapter 3
1. Cluster analysis of the 69 identified virulence patterns (UPGMA on Nei distances with virulence data). The number at each branch shows the percentage of times the group of isolates in that branch occurred based on 2,000 cycles in bootstrap analysis using the Winboot program ………………………………………………………………....……..67
2. Three-dimensional plot of 69 virulence phenotypes using principle coordinates analysis. VG 1 - VG 3 corresponding to the clusters in Fig. 1………………..…………..…...….68
3. Examples of designated AA, AB, and BB types with two alleles (A), three alleles (B) and four alleles (C) of markers………………………………………………...……………..79
4. Molecular haplotypes revealed by 20 microsatellites. Markers from 1 to 20 are presented in Table 2. ……………………………………………………………...…..…………....80
5. Neighbor-joining tree of 44 molecular haplotypes based on SSR marker data by NTsyspc 2.21L program. MG 1 - 3 correspond to the molecular groups. The number at each branch shows the percentage of times the group of isolates in that branch occurred based on 2,000 cycles in bootstrap analysis using the Winboot program…………………...…81
6. Three-dimentional plot of 44 molecular haplotypes using principle coordinates analysis. White, black, and gray circles indicate example samples collected from wheat, barley, and other grasses, repectively……………………...…...………………………………..82
7. Molecular groups revealed by STRUCTURE with 44 haplotypes, samples aligned by host, different color in each line represented the proportion of genetic different populations (A); Genotype frequency classes identified by NEWHYBRIDS with 44 haplotypes (B), black and white bars indicated the two pure species and gray bar
indicated the F 1 hybrids, other pattern corresponded to F 2 and backcross of two parental species…………………………………………………………………………………...83
Chapter 4
1. Map showing Puccinia striiformis f. sp. tritici samples collected from the Pacific
x
Northwest (PNW) and 20 states in the United States in 2010. Circles mark the 26 PNW fields where single stripe samples were collected and the numbers in the circles correspond to the field number in Table 4. The Palouse region is indicated by the broken line rectangle…………..………………………………………………………….……105
2. Frequencies of Puccinia striiformis f. sp. tritici virulences to the 18 Yr -gene lines in the Palouse region, the non-Palouse PNW, and the non-PNW US………………...……....115
3. Dendrogram showing the similarities of 21 Puccinia striiformis f. sp. tritici races determined by the UPGMA in the NTsyspc 2.21L program. VG 1 and VG 2 are virulence groups. The number at each branch shows the percentage of times the group of isolates in that branch occurred based on 2,000 cycles in the bootstrap analysis using the Winboot program………………………………………………………………………………...118
4. Three-dimensional plot of 21 Puccinia striiformis f. sp. tritici races using principle coordinates analysis. VG 1 and VG 2 correspond to the clusters in Fig. 3. The number in a circle represents the number of isolates and the number outside the circle is the PSTv race name in number…………………………………………………………………...119
5. Molecular haplotypes of Puccinia striiformis f. sp. tritici determined using 20 SSR markers. Markers 1 to 20 are presented in Table 2. The numbers in the columns on the right are numbers of isolates in the different regions…………...……………………...124
6. Neighbor-joining tree showing the similarities of 66 haplotypes of Puccinia striiformis f. sp. tritici based on SSR markers using NTsyspc 2.21L program. MG 1 and MG 2 are molecular groups shown in Fig. 5. The number at each branch shows the percentage of times the group of isolates in that branch occurred based on 2,000 cycles in bootstrap analysis using the Winboot program…………………………………………….……..125
7. Three-dimensional plot of 66 molecular haplotypes of Puccinia striiformis f. sp. tritici using principle coordinates analysis……….…………………………………………...126
8. Randomized distributions and observed the number of steps in most parsimonious trees of the Palouse Puccinia striiformis f. sp. tritici population. The distribution of step numbers under the null hypothesis (no association between alleles) was obtained after 1,000 randomizations of alleles in the individual isolates……………………………...129
Chapter 5
1. Linkage map for YrPI331260 and YrPI480016 on the short arm of chromosome 1B. The map distances of YrPI331260 and YrPI480016 to resistance genes Yr15 and Yr24 /Yr26 were based on common markers………………………………………………...... …...160
xi
DEDICATION
This thesis is dedicated to my parents, who always trust me and support me, in love and
gratitude.
xii
CHAPTER ONE
LITERATURE REVIEW
1. Stripe Rust
1.1 Discovery of stripe rust
Stripe rust, caused by Puccinia striiformis , was first described by Gadd in 1777 (Eriksson
& Henning 1896). Transcaucasia, the origin of domesticated wheat, also is assumed to be the center of origin for P. striiformis with the grasses as primary host (Stubbs 1985). The pathogen might have moved from the primary host grasses into Europe and along the mountain ranges to China and eastern Asia by winds (Stubbs 1985). Although the pathogen was first recognized in North America in 1915 by a visiting scientist, F. Kolpin Ravn, from
Denmark, it is believed that P. striiformis had existed in North America for at least 23 years before this first report since specimens collected in 1892 were later identified as P. striiformis
(Line 2002).
1.2 Host range and specialization
Puccinia striiformis has a wide host range including wheat, barley, triticale, rye, and various grasses only in the Gramineae (now Poaceae) family (Stubbs 1985). Stripe rust was observed on 372 lines representing 105 species in 16 genera by inoculating 948 randomly selected grass lines in a greenhouse at Pullman, WA (Dietz & Hendrix 1962). It is summarized that the host range of stripe rust consists of 320 species in 50 genera by natural infection or artificial inoculation (Hassebrauk 1965). Rusts from 30 grass species were able to infected wheat and conversely, wheat and barley stripe rust can infect about 150 grass species
1
(Hassebrauk 1965). Dormant mycelium of the pathogen was found in Elymus glaucus , E.
canadensis , Bromus marginatus , Hordeum nodosum , and H. jubatum at low elevations in
Oregon (Hungerford 1923). Additionally, urediniospores were found viable for 58 and 49 days on infected leaves of Agropyron dasystachyum and Elymus condensatus , respectively,
when kept in herbarium packets at room temperature. Other grass hosts found in Washington
were: Agropyron bakeri , A. reparium , A. spicatum , Bromus carinatus , B. pumpellianus , B. sitchensis , B. marginatus , Hordeum jubatum , Sitanion hystrix , and Poa nemoralis (Hendrix et
al. 1965). Successful infection was observed in Australia after inoculating wheat with
urediniospores collected from Bromus mollis , B. unioloides , Hordeum hystrix , H. leporinum ,
H. marinum , H. vulgare , Phalaris minor , P. paradoxa , and Triticosecale (Holmes & Dennis
1985).
Based on the adaptation to specific host genera, five formae speciales of the pathogen
based on the host genus were reported in the 19 th century: P. striiformis f. sp. tritici (Pst ) on
wheat, P. striiformis f. sp. hordei (Psh ) on barley, P. striiformis f. sp. secalis on rye, P.
striiformis f. sp. elymi on Elymus spp., and P. striiformis f. sp. agropyron on Agropyron spp.
(Eriksson 1894). Three additional formae speciales were reported in the 20 th century.
Collections from orchard grass ( Dactylis glomerata ) were designated as P. striiformis f. sp.
dactylidis (Manners 1960; Tollenaar 1967); collections from Kentucky blue grass ( Poa
pratensis ) were designated as P. striiformis f. sp. poae (Tollenaar 1967), and collections from
Leymus secalinus were designated as P. striiformis f. sp. leymi (Niu et al. 1991). In the
beginning of this century, another forma specialis was named. Stripe rust samples collected
from Hordeum spp. that were virulent on wheat cultivar ‘Chinese 166’ and certain barley
2
cultivar ‘Skiff’ with distinct genotypes from Pst and Psh was considered as P. striiformis f. sp . pseudo-hordei (Wellings et al. 2000; Wellings 2007). Therefore, a total of nine formae
speciales have been named under the species of P. striiformis . However, the subdivision of P. striiformis into formae speciales has been questioned as the presence of overlapped hosts in different formae speciales (Chen 2005). Same situation exists in other pathogenic fungi such as Puccinia graminis and Fusarium oxysporum . Some genotypes of wheat are susceptible to both formae speciales of stem rust fungi P. graminis f. sp. tritici (Pgt ; on wheat, Triticum aestivum ) and P. graminis f. sp. secalis (Pgs ; on cereal rye, Secale cereale ) (Sanghi & Luig
1971). Likewise, common hosts in beet and cultivars of sugarbeet have been found for vascular wilt pathogen F. oxysporum f. sp. spinaciae (on spinach) and F. oxysporum f. sp. betae (on beet) (Armstrong & Armstrong 1976). The term forma specialis is coined to designate variants that morphologically indistinguishable but adapted to parasitizing different host species.
Molecular markers have been widely used to charcaterize the pathogen. The virulence and random-amplified polymorphic DNA (RAPD) analyses clarified the relationships among
P. striiformis f. sp. hordei , P. striiformis f. sp. tritici , and P. striiformis f. sp . poae (Chen et al.
1995c). It is indicated that Puccinia striiformis f. sp. hordei and P. striiformis f. sp. tritici were more closely related to each other than they were to P. striiformis f. sp. poae . This finding agreed with the new nomenclature proposed recently using molecular (ITS and
β-tubulin sequences) and morphological data. Stripe rust infecting Dactylis glomerata was newly named P. striiformoides and stripe rust infecting Poa spp. was newly named P. pseudostriiformis (Liu & Hambleton 2010). Molecular markers helped discriminate formae
3
speciales of other pathogenic fungi such as F. oxysporum. Sequence-unbiased approaches for
molecular identification of pathogenic strains have proven to be effective for the
identification of several formae speciales and races of F. oxysporum (Chiocchetti et al. 2001;
Pasquali et al. 2006; Lievens et al. 2007). Another example with powdery mildew pathogen
Blumeria graminis using ITS and β-tubulin sequences data suggests the isolates of B. graminis f.sp avenae (from oat) is a sister group to isolates from wheat and rye, while isolates from barley is an outgroup (Wyand & Brown 2003).
1.3 Races
Within the forma specialis of either Pst or Psh , races have been used to distinguish isolates based on their virulence/avirulence patterns on differential cultivars of wheat or barley. The virulence/avirulence patterns of an isolate define the race designation. In the
United States, 20 wheat genotypes (Table 1) were used to differentiate races of P. striiformis f. sp. tritici (Chen et al. 2002). Recently, a set of single gene lines (Table 2) consisting of 18
Yr (Yellow rust resistance) genes have been selected to differentiate races of Pst (Wan and
Chen, unpublished data). For Psh race differentiation, 12 barley genotypes are used (Table 3)
(Chen 2004).
4
TABLE 1 . Wheat genotypes used to differentiate races of Puccinia striiformis f. sp. tritici in the United States.
Differential No. Cultivar or line Yr gene
1 Lemhi Yr21 2 Chinese 166 Yr1 3 Heines VII Yr2 , YrHVII 4 Moro Yr10 , YrMor 5 Paha YrPa1 , YrPa2 , YrPa3 6 Druchamp Yr3a , YrD , YrDru 7 AvSYr5NIL Yr5 8 Produra YrPr1 , YrPr2 9 Yamhill Yr2 , Yr4a , YrYam 10 Stephens Yr3a , YrS , YrSte 11 Lee Yr7 , Yr22 , Yr23 12 Fielder Yr6 , Yr20 13 Tyee YrTye 14 Tres YrTr1 , YrTr2 15 Hyak Yr17 , YrTye 16 Express YrExp1 , YrExp2 17 AvsYr8NIL Yr8 18 AvsYr9NIL Yr9 19 Clement Yr9 , YrCle 20 Compair Yr8 , Yr19
5
TABLE 2 . Wheat single gene lines used to differentiate races of Puccinia striiformis f. sp. tritici in the United States.
Differential No. Genotype Yr gene 1 AvSYr1NIL Yr1 2 AvSYr5NIL Yr5 3 AvSYr6NIL Yr6 4 AvSYr7NIL Yr7 5 AvSYr8NIL Yr8 6 AvSYr9NIL Yr9 7 AvSYr10NIL Yr10 8 AvSYr15NIL Yr15 9 AvSYr17NIL Yr17 10 AvSYr24NIL Yr24 11 AvSYr27NIL Yr27 12 AvSYr32NIL Yr32 13 Avs/IDO377s F3-41-1 Yr43 14 Avs/Zak 1-1-35-1 Yr44 15 AvSYrSPNIL YrSP 16 AvSYrTr1NIL YrTr1 17 Avs/Exp 1/1-1 Line 74 YrExp2 18 Tyee YrTye
6
TABLE 3 . Barley genotypes used to differentiate races of Puccinia striiformis f. sp. tritici in the United States.
Differential No. Name Resistance gene 1 Topper None 2 Heils Franken Rps4 , rpsHF 3 Emir rpsEm , rpsEm2 4 Astrix Rps4 , rpsAst 5 Hiproly rpsHi1 , rpsHi2 6 Varunda rpsVa1 , rpsVa2 7 Abed Binder 12 rps2 8 Trumpf rpsTr1 , rpsTr2 9 Mazurk Rps1.c 10 Bigo Rps1.b 11 I 5 Rps3 , rpsI5 12 Bancroft RpsBa
7
1.4 Life cycle
It was believed that only dikaryotic (n+n) uredial, dikaryotic to diploid (2n) telial, and
haploid (n) basidial stages exist in the P. striiformis f. sp. tritici stripe rust life cycle (Stubbs
1985; Chen 2005) until the alternate host Berberis spp. was determined under controlled greenhouse conditions (Jin et al. 2010). The basidiospores germinated from Pst could infect
Berberis spp. to produce pycnia (n) on the upper side of barberry leaves. This is where uninucleate pycniospores (also called spermatia) fertilize haploid receptive hyphae. Fertilized receptive hyphae (n+n) further develop into dikaryotic (n+n) aecia on the lower side of the leaves. Dikaryotic aeciospores that are produced from aecia on Berberis spp. are able to infect wheat plants again to produce dikaryotic urediniospores (Jin et al. 2010). However, whether the alternate host plays a role under natural environment is yet to be determined.
Interestingly, Jin et al. (2010) observed aecia on barberry plants in Minnesota under natural condition and identified them were as P. striiformis f. sp. poeae , which is now considered as a different species, P. pseudostriiformis (Liu & Hambleton 2010).
Therefore, the reproductive modes of the stripe rust pathogen may inlude clonality, recombination, and mating. Under clonality, genome of each progeny would be an exact copy of the single parent and all parts of the genome would have the same evolutionary history.
The only factor would generate diversity in a strictly clonal population is mutation. It has been widely detected that stripe rust pathogen populations in Australia, Europe, and the
United States reproduce clonally and diversify through mutations (Steele et al. 2001;
Hovmøller et al. 2002; Chen et al. 2010). On the other hand, recombination can occur via hybridization or mating. In rust fungi, somatic hybridization involves the fusion of dikaryotic
8
vegetative hyphae, nuclear exchange, and possibly whole chromosomes exchange between
two nuclei. Parasexual recombination could occur via fusion of two haploid nuclei, followed
by mitotic crossing over to mix the parental genomes and haploidization of the diploid nuclei
(Park & Wellings, 2012). Studies of somatic hybridization under controlled conditions
usually start with mix inoculation of two races on a common host. Then host genotypes that
are susceptible to one parent but resistant to the other would be used to eliminate the
contamination error (Nelson 1956). Besides the difference of virulences on certain host
resistant genotypes, urediniospore color of rust is another marker to identify and select
putative hybrids (Newton et al. 1986). The recovery of isolates with different pathogenicity
from the two parental races without the presence of alternate host in rust fungi implicates the
mechanism of somatic hybridization (Flor 1960). In a study of flax rust fungi Melampsora
lini , four host genotypes that susceptible to race 22 (known homozygous for virulence to the
four host genotypes) but resistant to race 1 (known heterozygous for virulence to the four
host genotypes) and the F 1 hybrids were used to screen the mix of four F 1 hybrids. Isolates virulent for one of the four host genotypes were recovered and 118 out of 129 were identified as race 22. It was proposed that two mating type nuclei exchange was the straight forward explanation for pathogenicity change of the resulting F 1 hybrids by comparing virulence pattern with both parents. Nonparental races isolated from single spore cultures of two crown rust races were suggested to arise from multinucleate parents or mitotic crossing over from dikaryotic parents following nuclei fusion (Bartoš et al. 1969). Two genetically distinct lineages of M. lini collected from an endemic wild herbaceous plant Linum. marginale
(referred to as AA and AB) were revealed by microsatellite and AFLP datasets (Barrett et al.
9
2007). The AA lineage displayed low heterozygosity and the AB lineage displayed high
heterozygosity. With nuclear staining of both lineages confirming dikatyotic, the authors
concluded that lineage AB was generated by nuclear exchange between lineage AA and a
putative BB lineage that carries B genome. A later study with two avirulence genes AvrP123 and AvrP4 and AFLP markers indicated that AA lineage was able to reproduce both clonally and sexually while AB lineage is completely asexual (Barrett et al. 2008). Somatic hybridization was also detected in rust fungi in regions where sexual recombination is absent or extremely low in nature such as Australia (Park & Wellings, 2012). Potential sexual recombination was also supported by a study in stripe rust that showed high genetic variation and greater telial production in population in regions with distribution of identified alternate host Berberis (Ali et al. 2010; Jin et al. 2010).
1.5 Population studies
The population structure of a pathogen can be affected by five evolutionary forces: mutations, population size and random genetic drift, gene and genotype flow, reproduction and mating system, selection by resistant hosts (McDonald & Linde 2002). For asexually reproducing fungi which the clonal mechanism plays a major role, mutation is commonly considered as the main factor to influence the population structure. This can be seen in many asexual pathosystems with race variation generated by single-step mutations such as the west gall rust fungus Peridermium harknessii (Vogler et al. 1991; 1997). The probability of
mutants is affected by population size which can influence the diversity of genes through
random genetic drift. Severe reductions in population size (bottlenecks) make pathogen populations less diverse and slower to adapt than populations that maintain a high population
10 size year round. Genotype and gene flow through hybridization and bacteria or virus infection also influence the structure of pathogen population. Hierarchical analysis of DNA fingerprints and restriction fragment length polymorphism (RFLP) markers in a large population of the wheat pathogen Mycosphaerella graminicola collected from 11 countries on five continents suggested a global scale gene flow (Zhan et al. 2003). Analysis of AFLP variation showed that the stripe rust fungus frequently migrated between the UK, Germany, France, and
Denmark (Hovmøller et al. 2002), and more recently two new strains and their rapid spread in the world were identified by the same group using AFLP markers (Hovmøller et al. 2008).
Reproduction and mating system are of great importance in pathogen population. Many studies have shown that asexual and clonal fungi may have cryptic species that can be recombining in nature (Taylor et al. 1999). One cryptic species of banana pathogen Fusarium oxysporum f. sp. cubense has been found likely to be recombining in nature (O’Donnell et al.
1998). Molecular analysis of six loci in citrus brown spot pathogen Alternaria alternata suggested putative mitotic recombination or meiotic haploid fruiting through a cryptic sexual cycle, parasexual cycle or both (Steward 2011). Detailed studies showed parasexual recombination occurs in Aspergillus nidulans , A. niger , Penicillium chrysogenum , and F. oxysporum (Pontecorvo 1956). Novel races arose from mixtures of two races of oat crown rust pathogen Puccinia coronata f. sp. avenae suggested occurrence of nuclear exchange following hyphal anastomosis and nuclear fusion and mitotic crossing over (Bartoš et al.
1969). Strong selection due to differences in host resistance resulted in shorter-term regional genetic variation in barley powdery mildew Blumeira graminis f. sp. hordei thoughout
Europe (Wolfe & McDermott 1994).
11
AFLP markers successfully differentiated the new population collected since 2000 from
the old population (collected before 2000) of the stripe rust pathogen in the eastern United
States (Markell & Milus 2008). For the dikaryotic organisms like Puccinia species, co-dominant markers such as SSRs are more informative in revealing genetic variations when compared to dominant markers (Selkoe & Toonen 2006). The first group of SSR markers for the stripe rust pathogen was reported by a French group in 2002 (Enjalbert et al. 2002).
Recently, a strong geographical structure of P. striiformis f. sp. tritici was showed within
France by using these SSR markers (Enjalbert et al. 2005). Both virulence and molecular marker data provided evidence to a foreign incursion of wheat stripe rust in Western
Australia (Wellings et al. 2003). More recently, expressed sequence tags (ESTs) from cDNA libraries have served an important resource for developing new SSR markers to assess genetic diversity. Twenty polymorphic SSR markers derived from the expressed sequence tags of P. striiformis f. sp. tritici have been developed (Chen et al. 2009). In our study, 46
EST-SSR primers were developed from genes characterized in the full-length cDNA library
of Pst (Cheng et al. 2012). Using the SSR markers, we have recently studied genetic
variations of stripe rust samples collected from grasses and obtained molecular evidence of
somatic hybridization of Puccinia striiformis in a relatively small population (Cheng & Chen
2009). Using gene sequences of 22 P. striiformis isolates from the U.S. and China, Liu et al.
(Liu et al. 2009) provided sequence evidence of heterokaryon in some isolates. However,
studies are needed to determine if the heterokyotic sequences are resulted from mutation or
somatic recombination and to determine frequency of the somatic recombination. For
understanding the pathogen biology, functional gene-based markers may be preferred over
12
the uncharacterized DNA sequences like RAPD, AFLP, and SSR markers.
1.6 Impact
The major impacts of stripe rust epidemics are the reduction in grain yield and the cost of
disease management. The stripe rust disease caused severe damage in the United States. For
example, in the State of Washington, the most severe yield losses recorded were 25%
(591,108 t) in 1960 and 17% (787,236 t) in 1976 (Chen 2007). Destructive epidemic of wheat
stripe rust occurs most often in the western USA, especially the Pacific Northwest
(Washington, Oregon, and Idaho), because the climatic conditions and cropping systems are
favorable to stripe rust. Since 2000, the wider distribution and more frequent epidemics have
made stripe rust of wheat more important throughout the U.S. (Chen 2005, 2007). In 2000,
the disease was reported in 20 states from the Pacific Northwest and California to Virginia
and from Texas to North Dakota (Chen et al. 2002). The widest distribution of the stripe rust in the recorded history was in 2005 with reported occurrence in over 35 states (Chen &
Penman 2006). In other years from 2000 to 2007, stripe rust occurred in at least 15 states every year (Chen et al. 2010). The yield loss caused by stripe rust in each year is worth of millions of dollars ((http://www.ars.usda.gov/Main/docs.htm?docid=10123 ). Without the
widely use of fungicides, the yield losses would have been two to four times of the estimates.
2. Control of wheat stripe rust
2.1 Genetic resistance
Although fungicides for controlling stripe rust have been effective since the first
large-scale successful use in North America in 1981 (Line 2002), the application of
13 fungicides add much extra cost to wheat production. Especially in developing countries, the use of fungicides brings both economic and healthy pressure to growers. Problems raised by the chemical control also include possible adverse effect on the environment and elicitation of fungicide-resistant strains of the pathogen. Thus, the best strategy to control stripe rust is growing resistant cultivars (Chen 2005). Types of resistance to stripe rust can be generally separated into two categories: all-stage resistance (also called seedling resistance) and adult-plant resistance such as the high temperature, adult-plant (HTAP) resistance (Table 4).
All-stage resistance is race-specific and can be detected at seedling stage but is also expressed at all growth stages of plant (Chen 2005). Rapid development of new virulent races of the pathogen through mutation and somatic recombination makes the cultivars with all-stage resistance become susceptible very soon after they are released (Wellings & McIntosh 1990).
This is because all-stage resistance is often conferred by race-specific single genes. In contrast, HTAP resistance is non-race specific, durable, but often quantitatively inherited and hard to incorporate into breeding cultivars (Qayoum & Line 1984; Chen & Line 1995a,
1995b; Line 2002; Chen 2005). Plant growth stage, temperature, and humidity are three major factors that affect HTAP resistance.
14
TABLE 4. Comparison of all-stage resistance and high-temperature and adult-plant (HTAP) resistance
All-stage resistance HTAP resistance
Number of loci Usually single genes Usually multiple QTL
Durability Not durable Durable
Effect stage All stages Adult plant
Specificity Race-specific Non race-specific
Level of resistance High Partial
Mode of inheritance Qualitatively Quantitatively
2.2 Resistance genes
So far, 53 Yr genes with official names have been reported and chromosomal locations of most of the genes have been determined (Table 5). Among the officially named genes, Yr11 ,
Yr12 , Yr13 , Yr14 , Yr16 , Yr18 , Yr29 , Yr30 , Yr34 , Yr36 , Yr39 , Yr46 , Yr48 , Yr49 , and Yr52 are
adult-plant resistance gene and the rest are race-specific all-stage resistance genes. Besides,
more than 30 genes or quantitative trait loci (QTLs) have been reported with provisional or
QTL names (Cheng 2008). All-stage resistance usually provide complete control of stripe
rust when it is effective, but the single-gene controlled all-stage resistance are easy to be
conquered by evolved new races of the pathogen. In contract, HTAP resistance is durable but
often not complete. Partial HTAP resistance may not be adequate when the disease develops
in the early stage and when temperatures are too low for HTAP resistance to fully express.
Therefore, the best genetic approach is to combine durable HTAP resistance with genes for
15
effective high-level all-stage resistance. Through the studies of past several years in our
program and other laboratories in the world, more than 30 genes or QTLs for HTAP
resistance have been reported and molecular makers are available for incorporate them into
breeding programs (Chen 2005, Uauy et al. 2005, Lin and Chen 2007, 2009, Chen and Zhao
2007, Santra et al. 2008, Carter et al. 2009, Guo et al. 2009, Ren et al. 2012). The effectiveness of these genes is generally not affected by changes of races. In contrast to the relative plenty of HTAP resistance genes, only Yr5 , Yr15 , and Yr45 are effective against all races identified so far in the U.S. (Chen et al. 2010; Wan and Chen 2012; Li et al. 2011). The first two genes have been recently used intensively in breeding programs throughout the U.S., and therefore, we expect that races overcoming these resistance genes will appear when cultivars with these genes widely grown. Therefore, it is urgent to identify new genes for effective all-stage resistance to be used in combination with HTAP resistance.
2.3 Resistance sources
Relatives of wheat have proven to be an invaluable gene pool for wheat improvement.
There are 14 Yr genes were transferred from wild relatives of wheat, such as Triticum aestivum subsp. spelta Album, T. turgidum , T. dicoccoides , T. turgidum var durum , Ae. ventricosa , Ae. tauschii , Ae. kotschyi , Ae. sharonenisis , Ae. geniculata , Ae. neglecta , and more distantly related species, Secalis cereal (Chen 2005). There are many drawbacks for utilizing resistance genes from alien species. It takes many years to move a resistance gene from an alien species to wheat. A translocated chromosome may carry too many undesirable traits that are hard to get rid of. Most rust resistance genes from alien species are not durable, which is exampled by Yr9 for stripe rust (Chen 2005), Lr26 for leaf rust (Datta et al. 2008),
16
and Sr31 for stem rust resistance from rye ( S. cereal ) (Mago et al. 2005). Yr9 virulence and
Lr26 virulence are widespread in the P. striiformis f. sp. tritici and P. triticina populations
worldwide, respectively, and the Ug99 stem rust races that are virulent on Sr31 has become
predominant in eastern Africa, spread to Iran and South Africa, and become a serious threat to
wheat production in the world (Visser et al. 2009). However, genes from wild relatives of wheat can be useful when they are used in pyramiding with other genes especially with
HTAP resistance genes.
Durum wheat ( T. turgidum L. subsp . durum ) is a tetraploid wheat, having 28 chromosomes (2n = 4× = 28, genome AABB) and grown on approximately 17 million hectares worldwide (Abdalla et al. 1992). Durum wheat with A and B genomes are the primary gene pool of hexaploid common wheat (T. aestivum L., 2n = 6×= 42, AABBDD genomes) for exploring desired genes to enhance the genetic diversity of common wheat varieties including disease resistance, drought tolerance, yield components, protein quality and quantity (Feldman & Millet 1993; Huang et al. 2003; Blanco et al. 2008). Resistance genes Yr15 , YrH52 , and Yr36 were originated from tetraploid wheat (Macer 1966; Ma et al.
2001; Uauy et al. 2005). In a study with 216 durum cultivars, it was found that 23% were
resistant to stripe rust (Mamluk 1992). A wide range of seedling and adult resistance to stripe
rust was observed in durum wheat cultivars from various countries (Ma et al. 1995; Ma et al.
1997a; Ma et al. 1997b). It is suggested that durum wheat germplasm is a rich source of stripe rust resistance genes. In addition, it is relatively easy to make crosses between durum wheat and common wheat genotypes, and thus durum wheat often was used as a bridging species to transfer new resistance genes from diploid wheat into common wheat (Chhuneja et
17
al. 2008). Therefore, exploring new Yr genes from durum wheat and transferring them into common wheat is an effective and convenient approach to diversify stripe rust resistance genes in common wheat cultivars. The successful transfer and characterization of alien introgression are needed to introduce and identify new resistance genes in wheat.
2.4 Molecular mapping
Molecular markers have been developed for several stripe rust resistance genes and have been used in marker-assist selection for developing resistant cultivars (Cheng 2008).
Commonly used marker techniques include random amplified polymorphic DNA (RAPD), simple sequence repeats (SSR), and amplified fragment length polymorphism (AFLP). Our lab developed the resistance gene analog polymorphism (RGAP) technique (Chen et al.
1998). Primers that designed based on the conserved regions of resistance genes sequence similarities amplified polymorphic bands. The conserved regions contain leucine-rich repeats, nucleotide-binding sites and protein kinase genes. Molecular markers for assessing the genetic diversity of germplasm were evident to be inherited as single loci. Bulk segregant analysis (BSA) (Michelmore et al. 1991) has been demonstrated as an effective way to identify markers for all-stage resistance genes and HTAP resistance QTL against stripe rust in wheat and barley (Shi et al. 2001; Yan et al. 2003; Pahalawatta & Chen 2005a, 2005b; Yan &
Chen 2006). HTAP in combination with effective race specific resistance has proven to be the best disease control strategy (Chen 2007). A quick, precise, and efficient method of marker assisted background selection (MABS) was proposed as a tool to transfer target genes among wheat cultivars or germplasms (Randhawa et al. 2009).
18
Table 5. Genes for resistance to stripe rust ( Puccinia striiformis f. sp. tritici ), examples of wheat genotypes containing the genes, their
chromosomal locations, types of resistance, and references
Yr gene Example of wheat genotype Chromosomal location Resistance type a Reference Yr1 AvSYr1NIL, Chinese 166 2AL RS, AS Macer 1966 Yr2 Heines VII, Kalyansona, 7B RS, AS Labrum 1980; Chen et al. 1995b Yr3 Nord Desprez; Vilmorin 23 5BL RS, AS McIntosh et al. 1995 Yr4 Hybrid 46; Opal 3B RS, AS McIntosh et al. 1995 Yr5 AvSYr5NIL, Triticum spelta album 2BL RS, AS Yan et al. 2003; Smith et al. 2007 Yr6 AvSYr6NIL, Heines Kolben 7BS RS, AS El-Bedewy & Röbbelen 1982 Yr7 AvSYr7NIL, Lee 2BL RS, AS Macer 1966; Yao et al. 2006 19 Yr8 Aegilops comosum 2A/2Mtrans RS, AS Riley et al. 1968b AvSYr8NIL, Compair 2D/2Mtrans RS, AS Riley et al. 1968a Yr9 AvSYr9NIL, Clement 1BL/1RStrans RS, AS Mago et al. 2002; Weng et al. 2005 Yr10 AvSYr10NIL, Moro 1BS RS, AS Chen et al. 1995b; Smith et al. 2002 Yr11 Joss Cambier unknown RS, AP McIntosh et al. 1995 Yr12 Mega unknown RS, AP McIntosh et al. 1995 Yr13 Maris Huntsman unknown RS, AP McIntosh et al. 1995 Yr14 Hobbit unknown RS, AP McIntosh et al. 1995 Yr15 AvSYr15NIL, Triticum turgidum var. 1BS RS, AS Gerechter-Amitai et al. 1989; McIntosh et dicoccoides G-25 al. 1995 Yr16 Cappelle Desprez 2D NRS, AP Worland & Law 1986
Yr17 AvSYr17NIL, Ae. ventricosa 2AS-6M trans RS, AS Bariana & McIntosh 1994 Yr18 AvSYr18NIL, Saar, Parula 7DS NRS, HTAP Suenaga et al. 2003 Yr19 Compair 5B RS, AS Chen et al. 1995a Yr20 Fielder 6D RS, AS Chen et al. 1995a Yr21 Lemhi 1B RS, AS Chen et al. 1995a Yr22 Lee 4D RS, AS Chen et al. 1995a Yr23 Lee 6D RS, AS Chen et al. 1995a Yr24 AvSYr24NIL, T. turgidum 1BS RS, AS McIntosh & Lagudah 2000 Yr25 Strubes Dickkopf, Heines Peko 1D RS, AS Calonnec & Johnson 1998 Yr26 AvSYr26NIL, T. turgidum 1BS RS, AS Ma et al. 2001; Yildirim et al. 2004 Yr27 AvSYr27NIL, Ciano 79, Selkirk 2BS RS, AS McDonald et al. 2004 20 Yr28 AvSYr27NIL, Ae. tauschii 4DS RS, AS Sharma et al. 1995; Singh et al. 2000 Yr29 AvSYr29NIL, Parula, Pavon 76 1BL NRS, AP William et al. 2003 Yr30 Parula, Pavon 76 3BS NRS, AP Singh et al. 2001 Yr31 AvSYr31NIL, Pastor 2BS RS, AS Zahravi et al. 2003 Yr32 AvSYr32NIL, Carstens V 2AS RS, AS Eriksen et al. 2004 Yr33 Batavia 7DL RS, AS Zahravi et al. 2003 Yr34 WAWHT2046 5AL AP Bariana et al. 2006 Yr35 T. turgidum var. dicoccoides 6BS RS, AS Marais et al. 2005b; Dadkhodaie et al. 2011 Yr36 T. turgidum var. dicoccoides 6BS NRS, HTAP Uauy et al. 2005
Yr37 Ae. kotschyi 2DL trans RS, AS Marais et al. 2005a Yr38 Aegilops sharonenisis 6AL tans , (6AL-6Lsh.6Ssh) RS, AS Marais et al. 2006; Marais et al. 2010 Yr39 Alpowa 7BL NRS, HTAP Lin & Chen 2007 Yr40 Ae. geniculata 5DS trans RS, AS Kuraparthy et al. 2007 (5DL.5DST5MSG) Yr41 cv. Chuannong 2BS RS, AS Luo et al. 2005; Luo et al. 2006 Yr42 Ae. neglecta 6ALtrans (6AenL.6AenS) RS, AS Marais et al. 2009 Yr43 cv. IDO377s 2BL RS, AS Cheng & Chen 2010 Yr44 cv. Zak 2BL RS, AS Sui et al. 2009 Yr45 PI 181434, PI 660056 3DL RS, AS Li et al. 2011, Wang et al. 1912 Yr46 PI 250413); RL6077 4DL NRS, AP Hiebert et al. 2010; Herrera-Foessel et al. 21 2011 Yr47 Line V336 5BS RS, AS Bansal et al. 2011 Yr48 Synthetic wheat 205 5AL NRS, AP Lowe et al. 2011 Yr49 cv. Chuanmai 18 3DS-6 (0.55-1.00) NRS, AP Spielmeyer et al. unpublished Yr50 CH233 (from Th. intermedium ) 4BL RS, AS Liu et al. unpublished Yr51 Line 5515, AUS 27858 4AL RS, AS Bansal et al. unpublished Yr52 PI 183527, PI 660057 7BL NRS, AP Ren et al. 2012 Yr53 PI 480148, AvS/PI 480148 F5-128 2BL RS, AS Xu, et al. unpublished
a RS = race specific resistance; AS = all-stage resistance; AP = adult plant resistance; HTAP = high-temperature adult plant resistance; NRS = non-race specific resistance.
References
Abdalla O, Dieseth JA, Singh RP (1992) Breeding durum wheat at CIMMYT, 1-13.
Ali S, Leconte M, Walker A-S, Enjalbert J, de Vallavieille-Pope C (2010) Reduction in the
sex ability of worldwide clonal populations of Puccinia striiformis f.sp. tritici . Fungal
Genetics and Biology 47 , 828-838.
Armstrong GM, Armstrong JK (1976) Common hosts for Fusarium oxysporum formae
speciales spinaciae and betae . Phytopathology 66 , 542-545.
Bansal UK, Forrest KL, Hayden MJ, Miah H, Singh D, Bariana HS (2011) Characterisation
of a new stripe rust resistance gene Yr47 and its genetic association with the leaf rust
resistance gene Lr52 . Theor Appl Genet 122 , 1461-1466.
Bansal UK, Hayden MJ, Gill MB, Bariana HS (2010) Chromosomal location of an
uncharacterised stripe rust resistance gene in wheat. Euphytica 171 , 121-127.
Bariana HS, McIntosh RA (1994) Characterisation and origin of rust and powdery mildew
resistance genes in VPM1 wheat. Euphytica 76 , 53-61.
Bariana HS, Parry N, Barclay IR , et al. (2006) Identification and characterization of stripe
rust resistance gene Yr34 in common wheat. Theor Appl Genet 112 , 1143-1148.
Barrett LG, Thrall PH, Burdon JJ (2007) Evolutionary diversification through hybridization
in a wild host-pathogen interaction. Evolution 61 , 1613-1621.
Barrett LG, Thrall PH, Burdon JJ, Nicotra AB, Linde CC (2008) Population structure and
diversity in sexual and asexual populations of the pathogenic fungus Melampsora lini.
Mol Ecol 17 , 3401-3415.
Bart ŏs P, Fleischmann G, Samborski DJ, Shipton WA (1969) Studies on asexual variation in
the virulence of oat crown rust, Puccinia coronata f. sp. avenae , and wheat leaf rust,
Puccinia recondita . Can. J. Bot. 47 , 1383-1387.
Blanco A, Gadaleta A, Cenci A , et al. (2008) Molecular mapping of the novel powdery
22
mildew resistance gene Pm36 introgressed from Triticum turgidum var. dicoccoides in
durum wheat. Theor Appl Genet 117 , 135-142.
Calonnec A, Johnson R (1998) Chromosomal location of genes for resistance to Puccinia
striiformis in the wheat line TP1295 selected from the cross of Soissonais-Desprez
with Lemhi. European Journal of Plant Pathology 104 , 835-847.
Chen CQ, Zheng WM, Buchenauer H , et al. (2009) Isolation of microsatellite loci from
expressed sequence tag library of Puccinia striiformis f.sp. tritici . Molecular Ecology
Resources 9, 236-238.
Chen XM (2004) Epidemiology of barley stripe rust and races of Puccinia striiformis f. sp.
hordei : the firstdecade in the United States. Cereal Rusts and Powdery Mildews
Bulletin .
Chen XM (2005) Epidemiology and control of stripe rust [ Puccinia striiformis f. sp tritici ] on
wheat. Canadian Journal of Plant Pathology 27 , 314-337.
Chen XM (2007) Challenges and solutions for stripe rust control in the United States.
Australian Journal of Agricultural Research 58 , 648-655.
Chen XM, Jones SS, Line RF (1995a) Chromosomal location of genes for stripe rust
resistance in spring wheat cultivars Compair, Fielder, Lee, and Lemhi and interactions
of aneuploid wheats with races of Puccinia striiformis . Phytopathology 85 , 375-381.
Chen XM, Line RF, Jones SS (1995b) Chromosomal location of genes for resistance to
Puccinia striiformis in winter wheat cultivars Heines VII, Clement, Moro, Tyee, Tres,
and Daws. Phytopathology 85 , 1362-1367.
Chen XM, Jones SS, Line RF (1996) Chromosomal location of genes for resistance to
Puccinia striiformis in seven wheat cultivars with resistance genes at the Yr3 and Yr4
loci. Phytopathology 86 , 1228-1233.
Chen XM, Line RF (1995a) Gene-Action in Wheat Cultivars for Durable, High-Temperature,
23
Adult-Plant Resistance and Interaction with Race-Specific, Seedling Resistance to
Puccinia-Striiformis. Phytopathology 85 , 567-572.
Chen XM, Line RF (1995b) Gene number and heritability of wheat cultivars with durable,
high-temperature, adult-plant (Htap) resistance and interaction of Htap and
race-specific seedling resistance to Puccinia striiformis . Phytopathology 85 , 573-578.
Chen XM, Line RF, Leung H (1993) Relationship between virulence variation and DNA
polymorphism in Puccinia striiformis . Phytopathology 83 , 1489-1497.
Chen XM, Line RF, Leung H (1995c) Virulence and polymorphic DNA relationships of
Puccinia striiformis f.sp. hordei to other rusts. Phytopathology 85 , 1335-1342.
Chen XM, Line RF, Leung H (1998) Genome scanning for resistance-gene analogs in rice,
barley, and wheat by high-resolution electrophoresis. Theor Appl Genet 97 , 345-355.
Chen XM, Moore M, Milus EA , et al. (2002) Wheat stripe rust epidemics and races of
Puccinia striiformis f. sp tritici in the United States in 2000. Plant Disease 86 , 39-46.
Chen XM, Penman L (2006) Stripe rust epidemic and races of Puccinia striiformis in the
United States in 2005. Phytopathology 96 , S23-S23.
Chen XM, Penman L, Wan AM, Cheng P (2010) Virulence races of Puccinia striiformis f.sp.
tritici in 2006 and 2007 and development of wheat stripe rust and distributions,
dynamics, and evolutionary relationships of races from 2000 to 2007 in the United
States. Canadian Journal of Plant Pathology 32 , 315-333.
Cheng P (2008) Molecular mapping of a gene for resistance to stripe rust in spring wheat
cultivar IDO377s and identification of a new race of Puccinia striiformis f. sp. tritici
virulent on IDO377s, pp. x, 87 p. Washington State University, [Pullman, Wash.].
Cheng P, Chen XM (2009) Somatic hybridization in Puccinia striiformis revealed by
virulence patterns and microsatellite markers. Phytopathology 99 , S23-S23.
Cheng P, Chen XM (2010) Molecular mapping of a gene for stripe rust resistance in spring
24
wheat cultivar IDO377s. Theor Appl Genet 121 , 195-204.
Cheng P, Chen XM, Xu LS, See DR (2012) Development and characterization of expressed
sequence tag-derived microsatellite markers for the wheat stripe rust fungus Puccinia
striiformis f. sp. tritici . In: Andris, M., Arias, M. C., Barthel, B. L., Bluhm, B. H.,
Bried, J., Canal, D., Chen, X. M., Cheng, P. et al. 2012. Permanent genetic resources
added to molecular ecology resources database 1 February 2012 – 31 March 2012.
Mol. Ecol. Resour. 12 ,779-781.
Chhuneja P, Kaur S, Garg T , et al. (2008) Mapping of adult plant stripe rust resistance genes
in diploid A genome wheat species and their transfer to bread wheat. Theor Appl
Genet 116 , 313-324.
Chiocchetti A, Sciaudone L, Durando F, Garibaldi A, Migheli Q (2001) PCR detection of
Fusarium oxysporum f. sp. basilici on basil. Plant Dis 85 , 607-611.
Dadkhodaie NA, Karaoglou H, Wellings CR, Park RF (2011) Mapping genes Lr53 and Yr35
on the short arm of chromosome 6B of common wheat with microsatellite markers
and studies of their association with Lr36. Theor Appl Genet 122 , 479-487.
Datta D, Bhardwaj SC, Prashar M (2008) Development of bread wheat (Triticum aestivum L.)
lines with specific rust resistance genes and their authentication through molecular
markers. Indian Journal of Genetics and Plant Breeding 68 , 113-123.
Dietz SM, Hendrix JW (1962) Reaction of grasses to stripe rust at Pullman, Washington.
Phytopathology 52 , 730.
El-Bedewy R, Röbbelen G (1982) Chromosomal location and change of dominance of a gene
for resistance against yellow rust, Puccinia striiformis West ., in wheat, Triticum
aestivum L. Zeitschrift für Pflanzenzüchtung 89 , 145-157.
Enjalbert J, Duan X, Giraud T , et al. (2002) Isolation of twelve microsatellite loci, using an
enrichment protocol, in the phytopathogenic fungus Puccinia striiformis f.sp. tritici .
25
Molecular Ecology Notes 2, 563-565.
Enjalbert J, Duan X, Leconte M, Hovmoller MS, C DEV-P (2005) Genetic evidence of local
adaptation of wheat yellow rust ( Puccinia striiformis f.sp. tritici ) within France.
Molecular Ecology 14 , 2065-2073.
Eriksen L, Afshari F, Christiansen MJ , et al. (2004) Yr32 for resistance to stripe (yellow) rust
present in the wheat cultivar Carstens V. Theor Appl Genet 108 , 567-575.
Eriksson J (1894) Uber die Spezialisierung des Parasitismus bei den Getreiderostpilzen. Ber.
Dtsch. Bot. Ges. 12 , 292-331.
Eriksson J, Henning E (1896) “Die Getreideroste.” (ed. Söner N). Stockholm.
Feldman M, Millet E (1993) Methodologies for identification, allocation and transfer of
quantitative genes from wild emmer into cultivated wheat, 19-27.
Flor HH (1960) Asexual variants of Melampsora lini . Phytopathology 50 , 223-226.
Gerechter-Amitai ZK, van Silfhout CH, Grama A, Kleitman F (1989) Yr15 -a new gene for
resistance to Puccinia striiformis in Triticum dicoccoides sel. G-25. Euphytica 43 ,
187-190.
Hassebrauk K (1965) Nomenklatur, geographische verbreitung und wirtsbereich des
gelbrostes, Puccinia striiformis West. Mitteilungen aus der Biologischen
Bundesanstalt für Land- und Forstwirtschaft, Berlin-Dahlem 116 , 1-75.
Hendrix JW, Burleigh JR, Tu JC (1965) Oversummering of stripe rust at high elevations in
the Pacific Northwest 1963. Plant Disease Report 49 , 275-278.
Herrera-Foessel SA, Lagudah ES, Huerta-Espino J , et al. (2011) New slow-rusting leaf rust
and stripe rust resistance genes Lr67 and Yr46 in wheat are pleiotropic or closely
linked. Theor Appl Genet 122 , 239-249.
Hiebert CW, Thomas JB, McCallum BD , et al. (2010) An introgression on wheat
chromosome 4DL in RL6077 (Thatcher*6/PI 250413) confers adult plant resistance to
26
stripe rust and leaf rust (Lr67). Theor Appl Genet 121 , 1083-1091.
Holmes RJ, Dennis JI (1985) Accessory hosts of wheat stripe rust in Victoria, Australia.
Transactions of the British Mycological Society 85 , 159-160.
Hovmøller MS, Justesen AF, Brown JKM (2002) Clonality and long-distance migration of
Puccinia striiformis f.sp. tritici in north-west Europe. Plant Pathology 51 , 24-32.
Hovmøller MS, Yahyaoui AH, Milus EA, Justesen AF (2008) Rapid global spread of two
aggressive strains of a wheat rust fungus. Molecular Ecology 17 , 3818-3826.
Huang XR, Cöster H, Ganal MW, Röder MS (2003) Advanced backcross QTL analysis for
the identification of quantitative trait loci alleles from wild relatives of wheat
(Triticum aestivum L.). Theor Appl Genet 106 , 1379-1389.
Hungerford CW (1923) Studies on the life history of stripe rust, Puccinia glumarum Schm.
Erikss. and Henn. Journal of Agriculture Research 24 , 607-620.
Jin Y, Szabo LJ, Carson M (2010) Century-old mystery of Puccinia striiformis life history
solved with the identification of Berberis as an alternate host. Phytopathology 100 ,
432-435.
Kuraparthy V, Chhuneja P, Dhaliwal HS , et al. (2007) Characterization and mapping of
cryptic alien introgression from Aegilops geniculata with new leaf rust and stripe rust
resistance genes Lr57 and Yr40 in wheat. Theor Appl Genet 114 , 1379-1389.
Labrum KE (1980) The location of Yr2 and Yr6 genes conferring resistance to yellow rust. In:
Proceedings of the 5th European and Mediterranean Cereal Rusts Conference , pp.
41-45, Bari, Italy.
Li Q, Chen XM, Wang MN, Jing JX (2011) Yr45 , a new wheat gene for stripe rust resistance
on the long arm of chromosome 3D. Theor Appl Genet 122 , 189-197.
Lievens B, Claes L, Vakalounakis DJ, Vanachter ACRC, Thomma BPHJ (2007) A robust
identification and detection assay to discriminate the cucumber pathogens Fusarium
27
oxysporum f. sp. cucumerinum and f. sp. radicis-cucumerinum . Environ Microbiol 9,
2145-2161.
Lin F, Chen XM (2007) Genetics and molecular mapping of genes for race-specific all-stage
resistance and non-race-specific high-temperature adult-plant resistance to stripe rust
in spring wheat cultivar Alpowa. Theor Appl Genet 114 , 1277-1287.
Line RF (2002) Stripe rust of wheat and barley in North America: a retrospective historical
review. Annu Rev Phytopathol 40 , 75-118.
Line RF, Qayoum A (1992) Virulence, aggressiveness, evolution, and distribution of races of
Puccinia striiformis (the cause of stripe rust of wheat) in North America, 1968-1987.
USDA Bulletin 1788 , 44.
Liu B, Chen X, Kang Z (2009) Gene sequencing reveals heterokaryotic variations in Puccinia
striiformis . Phytopathology 99 , S75-S75.
Liu M, Hambleton S (2010) Taxonomic study of stripe rust, Puccinia striiformis sensu lato ,
based on molecular and morphological evidence. Fungal Biology 114 , 881-899.
Lowe I, Jankuloski L, Chao S , et al. (2011) Mapping and validation of QTL which confer
partial resistance to broadly virulent post-2000 North American races of stripe rust in
hexaploid wheat. Theor Appl Genet 123 , 143-157.
Luo PG, Ren ZL, Zhang HQ (2006) Diagnostic detection and genetic analysis of wheat stripe
rust resistant gene YrCN19 . Journal of Molecular and Cell Biology 39 , 217-222.
Luo PG, Ren ZL, Zhang HQ, Zhang HY (2005) Identification, chromosome location, and
diagnostic markers for a new gene ( YrCN19 ) for resistance to wheat stripe rust.
Phytopathology 95 , 1266-1270.
Ma H, Singh RP, Abdalla O (1997a) Resistance to stripe rust in five durum wheat cultivars.
Plant Disease 81 , 27-30.
Ma H, Singh RP, Mujeeb KA (1997b) Resistance to stripe rust in durum wheats, A-genome
28
diploids, and their amphiploids. Euphytica 94 , 279-286.
Ma H, Singh RP, Mujeebkazi A (1995) Resistance to Stripe Rust in Triticum-Turgidum,
T-Tauschii and Their Synthetic Hexaploids. Euphytica 82 , 117-124.
Ma JX, Zhou RH, Dong YS , et al. (2001) Molecular mapping and detection of the yellow rust
resistance gene Yr26 in wheat transferred from Triticum turgidum L. using
microsatellite markers. Euphytica 120 , 219-226.
Macer RCF (1966) The formal and monosomic genetic analysis of stripe rust ( Puccinia
striiformis ) resistance in wheat. In: Proceedings of 2nd International Wheat Genet
Symposium , pp. 127-142, Lund, Sweden.
Mago R, Miah H, Lawrence GJ , et al. (2005) High-resolution mapping and mutation analysis
separate the rust resistance genes Sr31, Lr26 and Yr9 on the short arm of rye
chromosome 1. Theor Appl Genet 112 , 41-50.
Mago R, Spielmeyer W, Lawrence J , et al. (2002) Identification and mapping of molecular
markers linked to rust resistance genes located on chromosome 1RS of rye using
wheat-rye translocation lines. Theor Appl Genet 104 , 1317-1324.
Mamluk OF (1992) Durum wheat diseases in West Asia and North Africa (WANA). 89-106.
Manners JG (1960) Puccinia striiformis Westend. var dactylidis var. nov. Transactions of the
British Mycological Society 43 , 65-68.
Marais F, Marais A, McCallum B, Pretorious Z (2009) Transfer of leaf rust and stripe rust
resistance genes Lr62 and Yr42 from Aegilops neglecta Req. ex Betrol. to common
wheat. Crop Science 49 , 871-879.
Marais GF, Badenhorst PE, Eksteen A, Pretorius ZA (2010) Reduction of Aegilops
sharonensis chromatin associated with resistance genes Lr56 and Yr38 in wheat.
Euphytica 171 , 15-22.
Marais GF, McCallum B, Marais AS (2006) Leaf rust and stripe rust resistance genes derived
29
from Aegilops sharonensis . Euphytica 149 , 373-380.
Marais GF, McCallum B, Snyman JE, Pretorius ZA, Marais AS (2005a) Leaf rust and stripe
rust resistance genes Lr54 and Yr37 transferred to wheat from Aegilops kotschyi .
Plant Breeding 124 , 538-541.
Marais GF, Pretorius ZA, Wellings CR, McCallum B, Marais AS (2005b) Leaf rust and stripe
rust resistance genes transferred to common wheat from Triticum dicoccoides .
Euphytica 143 , 115-123.
Markell SG, Milus EA (2008) Emergence of a novel population of Puccinia striiformis f.sp.
tritici in Eastern United States. Phytopathology 98 , 632-639.
McDonald BA, Linde C (2002) Pathogen population genetics, evolutionary potential, and
durable resistance. Annual Review of Phytopathology 40 , 349-379.
McDonald DB, McIntosh RA, Wellings CR, Singh RP, Nelson JC (2004) Cytogenetical
studies in wheat XIX. Location and linkage studies on gene Yr27 for resistance to
stripe (yellow) rust. Euphytica 136 , 239-248.
McIntosh RA, Lagudah ES (2000) Cytogenetical studies in wheat. XVIII. Gene Yr24 for
resistance to stripe rust. Plant Breeding 119 , 81-83.
McIntosh RA, Wellings CR, Park RF (1995) Wheat Rusts: An Atlas of Resistance Genes
Kluwer Academic Publishers, Dordrecht, Germany.
Michelmore RW, Paran I, Kesseli RV (1991) Identification of markers linked to
disease-resistance genes by bulked segregant analysis: a rapid method to detect
markers in specific genomic regions by using segregating populations. Proc. Natl.
Acad. Sci 88 , 9828-9832.
Nelson RR (1956) Transmission of factors for urediospore color in Puccinia graminis var.
tritici by means of nuclear exchange between vegetative hyphae. Phytopathology 46,
538-540.
30
Newton AC, Johnson R, Caten CE (1986) Attempted somatic hybridisation of Puccinia
striiformis f. sp. tritici and Puccinia striiformis f. sp. hordei . Plant Pathol . 35 ,
108-113.
Niu YC, Li ZQ, Shang HS (1991) Puccinia striiformis West. f. sp. leymi and f. sp. elymi , two
new formae speciales. Acta Univ. Agric. Boreali Occident. 19 , 58-62.
O’Donnell K, Kistler HC, Cigelink E, Ploetz RC (1998) Multiple evolutionary origins of the
fungus causing Panama disease of banana: concordant evidence from nuclear,
mitochondrial gene genealogies. Proc. Natl. Acad. Sci. 95 , 2044-2049.
Pahalawatta V, Chen XM (2005a) Inheritance and molecular mapping of barley genes
conferring resistance to wheat stripe rust. Phytopathology 95 , 884-889.
Pahalawatta V, Chen XM (2005b) Genetic analysis and molecular mapping of wheat genes
conferring resistance to the wheat stripe rust and barley stripe rust pathogens.
Phytopathology 95 , 427-432.
Park RF, Wellings CR (2012) Somatic Hybridization in the Uredinales. Annual Review of
Phytopathology 50 , null.
Pasquali M, Piatti P, Gullino ML, Garibaldi A (2006) Development of a real-time polymerase
chain reaction for the detection of Fusarium oxysporum f. sp. basilici from basil seed
and roots. J Phytopathol 154 , 632-636.
Pontecorvo G (1956) The parasexual cycle in fungi. Annu Rev Microbiol 10 , 393-400.
Qayoum A, Line RF (1984) Pathogenicity of Puccinia-Striiformis West. Phytopathology 74 ,
1140-1140.
Randhawa HS, Mutti JS, Kidwell K , et al. (2009) Rapid and targeted introgression of genes
into popular wheat cultivars using marker-assisted background selection. PloS one 4,
e5752.
Ren RS, Wang MN, Chen XM, Zhang ZJ (2012) Characterization and molecular mapping of
31
Yr52 for high-temperature adult-plant resistance to stripe rust in spring wheat
germplasm PI 183527. Theoretical and Applied Genetics.
Riley R, Chapman V, Johnson R (1968a) The incorporation of alien disease resistance in
wheat by genetic interference with the regulation of meiotic chromosome synapsis.
Genetics Research Cambridge 12 , 199-219.
Riley R, Chapman V, Johnson R (1968b) Introduction of yellow rust resistance of Aegilops
comosa into wheat by genetically induced homoeologous recombination. Nature 217 ,
383-384.
Sanghi AK, Luig NH (1971) Resistance in wheat to formae speciales tritici and secalis of
Puccinia graminis . Canadian Journal of Genetics and Cytology 13 , 119-127.
Selkoe KA, Toonen RJ (2006) Microsatellites for ecologists: a practical guide to using and
evaluating microsatellite markers. Ecology Letters 9, 615-629.
Sharma S, Louwers JM, Karki CB, Snijders CHA (1995) Postulation of resistance genes to
yellow rust in wild emmer wheat derivatives and advanced wheat lines from Nepal.
Euphytica 81 , 271–277.
Shi ZX, Chen XM, Line RF, Leung H, Wellings CR (2001) Development of resistance gene
analog polymorphism markers for the Yr9 gene resistance to wheat stripe rust.
Genome 44 , 509-516.
Singh RP, Huerto-Espino J, William M (2001) Slow rusting gene based resistance to leaf and
yellow rusts in wheat: genetics and breeding at CIMMYT, 103-108.
Singh RP, Nelson JC, Sorrells ME (2000) Mapping Yr28 and other genes for resistance to
stripe rust in wheat. Crop Science 40 , 1148-1155.
Smith H, Koebner D, Boyd A (2002) The development of a STS marker linked to a yellow
rust resistance derived from the wheat cultivar Moro. Theor Appl Genet 104 ,
1278-1282.
32
Smith PH, Hadfield J, Hart NJ, Koebner RM, Boyd LA (2007) STS markers for the wheat
yellow rust resistance gene Yr5 suggest a NBS-LRR-type resistance gene cluster.
Genome 50 , 259-265.
Steele KA, Humphreys E, Wellings CR, Dickinson MJ (2001) Support for a stepwise
mutation model for pathogen evolution in Australasian Puccinia striiformis f.sp tritici
by use of molecular markers. Plant Pathology 50 , 174-180.
Steward JE (2011) Mating system and speciation of the citrus brown spot pathogen,
Alternaria alternata . Washington State University, [Pullman, Wash.], Electronic
Dissertations
Stubbs RW (1985) Stripe rust. In: The Cereal Rusts, Vol. 2, Diseases, Distribution,
Epidemiology and Control (eds. Roelfs AP, Bushnell WR), pp. 61-101. Academic
Press, Orlando, FL.
Suenaga K, Singh RP, Huerta-Espino J, William HM (2003) Microsatellite markers for genes
Lr34 /Yr18 and other quantitative trait loci for leaf rust and stripe rust resistance in
bread wheat. Phytopathology 93 , 881-890.
Sui XX, Wang MN, Chen XM (2009) Molecular mapping of a stripe rust resistance gene in
spring wheat cultivar Zak. Phytopathology 99 , 1209-1215.
Taylor J, Jacobson D, Fisher M (1999) THE EVOLUTION OF ASEXUAL FUNGI:
Reproduction, Speciation and Classification. Annual Review of Phytopathology 37 ,
197-246.
Tollenaar H (1967) A comparison of Puccinia striiformis f. sp. poae on bluegrass with P.
striiformis f. sp. tritici and f. sp. dactylidis . Phytopathology 57 , 418-420.
Uauy C, Brevis JC, Chen X , et al. (2005) High-temperature adult-plant (HTAP) stripe rust
resistance gene Yr36 from Triticum turgidum ssp. dicoccoides is closely linked to the
grain protein content locus Gpc-B1. Theor Appl Genet 112 , 97-105.
33
Visser B, Herselman L, Pretorius ZA (2009) Genetic comparison of Ug99 with selected South
African races of Puccinia graminis f.sp. tritici . Molecular plant pathology 10 ,
213-222.
Vogler DR, Epstein L, Cobb FW Jr. (1997) Nuclear behaviour and evolution of two
populations of the western gall rust fungus. Mycol. Res. 101 , 791-797.
Vogler DR, Kinlock BB, Cobb FW, Popenuck TL (1991) Isozyme structure of Peridermium
harknessii in the western United States. Can. J. Bot. 69 , 2434-2441.
Wellings CR (2007) Puccinia striiformis in Australia: a review of the incursion, evolution,
and adaptation of stripe rust in the period 1979-2006. Australian Journal of
Agricultural Research 58 , 567-575.
Wellings CR, Burdon JJ, McIntosh RA , et al. (2000) A new variant of Puccinia striiformis
causing stripe rust on barley and wild Hordeum species in Australia. Plant Pathology
49 , 803-803.
Wellings CR, McIntosh RA (1990) Puccinia striiformis f. sp. tritici in Australasia -
Pathogenic changes during the 1st 10 Years. Plant Pathology 39 , 316-325.
Wellings CR, Wright D, Keiper F, Loughman R (2003) First detection of wheat stripe rust in
Western Australia: evidence for a foreign incursion. Australasian Plant Pathology 32 ,
321-322.
Weng DX, Xu SC, Lin RM , et al. (2005) Microsatellite marker linked with stripe rust
resistant gene Yr9 in wheat. Acta Genetica Sinica 32 , 937-941.
William M, Singh RP, Huerta-Espino J, Islas SO, Hoisington D (2003) Molecular marker
mapping of leaf rust resistance gene Lr46 and its association with stripe rust
resistance gene Yr29 in wheat. Phytopathology 93 , 153-159.
Wolfe MS, McDermott JM (1994) Population genetics of plant pathogen interactions: the
example of the Erysiphe graminis -Hordeum vulgare pathosystem. Annu. Rev.
34
Phytopathol. 32 , 89-113.
Worland AJ, Law CN (1986) Genetic analysis of chromosome 2D of wheat. I. The location of
genes affecting height, day-length insensitivity, hybrid dwarfism and yellow-rust
resistance. . Zeitschrift für Pflanzenzüchtung 96 , 331-345.
Wyand RA, Brown JKM (2003) Genetic and forma specialis diversity in Blumeria graminis
of cereals and its implications for host-pathogen co-evolution. Mol Plant Pathol 4,
187-198.
Yan GP, Chen XM (2006) Molecular mapping of a recessive gene for resistance to stripe rust
in barley. Theor Appl Genet 113 , 529-537.
Yan GP, Chen XM, Line RF, Wellings CR (2003) Resistance gene-analog polymorphism
markers co-segregating with the Yr5 gene for resistance to wheat stripe rust. Theor
Appl Genet 106 , 636-643.
Yao ZJ, Lin RM, Xu SC , et al. (2006) The molecular tagging of yellow rust resistance gene
Yr7 in wheat transferred from differential host Lee using microsatellite markers.
Scientia Agricultura Sinica 39 , 1148-1152.
Yildirim A, Karadag Y, Sakin MA , et al. (2004) Transfer of stripe rust resistance gene Yr26 to
Turkish wheats using microsatellite markers. Cereal Research Communications 32 ,
25-30.
Zahravi M, Bariana HS, Shariflou MR , et al. (2003) Bulk segregant analysis of stripe rust
resistance in wheat ( Triticum aestivum ) using microsatellite markers. In: Proceedings
10th International Wheat Genetics Symposium , pp. 861-863, Rome, Italy
Zhan J, Pettway RE, McDonald BA (2003) The global genetic structure of the wheat
pathogen Mycosphaerella graminicola is characterized by high nuclear diversity, low
mitochondrial diversity, regular recombination, and gene flow. Fungal Genetics and
Biology 38 , 286-297.
35
CHAPTER TWO
Development and characterization of expressed sequence tag-derived microsatellite
markers for the wheat stripe rust fungus Puccinia striiformis f. sp. tritici
P. CHENG,† X. M. CHEN,†‡*, L. S. XU,† D. R. SEE‡
(Accepted in Molecular Ecology Resources)
†Department of Plant Pathology, Washington State University, Pullman, WA, 99164-6430,
USA, ‡USDA-ARS, Wheat Genetics, Quality, Physiology, and Disease Research Unit,
Pullman, WA 99164-6430, USA
*Correspondence: Xianming Chen, USDA-ARS, Wheat Genetics, Quality, Physiology, and
Disease Research Unit, Pullman, WA 99164-6430, USA Tel.: +1 509 335 8086; fax: +1 509
335 9581. E-mail: [email protected]
Abstract
Puccinia striiformis , a basidiomycete fungus, produces dikaryotic urediniospores causing stripe rust of wheat, barley, and many grass species. Codominant microsatellite markers are needed to study its population biology. In this study, we characterized microsatellite loci based on three EST libraries previously developed for this fungus. By screening 3,311 unique EST sequences using the SSRIT software, 46 EST sequences were selected for microsatellite motifs. Primers were designed and initially screened against 8 isolates representing 5 P. striiformis f. sp. tritici (Pst , the wheat stripe rust pathogen) and 3 P. striiformis f. sp. hordei (Psh , the barley stripe rust pathogen) races. Seventeen primer pairs produced stable polymorphic and co-dominant bands among the eight isolates. The polymorphism and usefulness of these primers were further determined with 20 Pst isolates
36
collected from three states of US in 2008 to evaluate their usefulness for population studies.
Based on their genomic locations, the microsatellite loci are dispersed throughout the genome.
These codominant microsatellite markers will be useful to study the population structure and
ecology of the stripe rust fungus.
Keywords: Puccinia striiformis ; EST; Microsatellite; Dikaryon
Stripe rust, caused by the fungus Puccinia striiformis Westend., is a major disease of wheat,
barley, and many grass species (Chen 2005). The disease is caused by dikaryotic
urediniospores which are produced asexually and dominate the pathogen lifecycle (Stubbs
1985; Chen 2005). The pathogen is highly variable, but the evolutionary mechanisms
generating the diversity are not clear (Hovmøller et al. 2011). Microsatellite markers are very powerful tools to study genetic structure of organisms due to their codominance and high polymorphism (Robinson et al. 2004). However, only a limited number of microsatellite markers are available for the stripe rust fungus with low polymorphism
(Enjalbert et al. 2002; Bahri et al. 2009; Chen et al. 2009). Recently, three EST libraries
(urediniospores, germinated urediniospores and haustoria) were constructed for the wheat stripe rust pathogen ( P. striiformis f. sp. tritici , Pst ) and their sequences are useful for development of microsatellite markers (Ling et al. 2007; Zhang et al. 2008; Yin et al. 2009).
The objective of this study was to develop additional microsatellite markers for studying the population genetics of the stripe rust pathogen.
The EST data used in this study were generated by sequencing three complementary
DNA (cDNA) libraries from urediniospores of a US Pst race, PST-78 (Ling et al. 2007), germinated urediniospores of a Chinese Pst race CYR32 (Zhang et al. 2008), and haustoria of
PST-78 (Yin et al. 2009). A total of 3,311 nonredundant sequences were obtained including
37
contigs and singlets. Microsatellite loci were identified by screening the EST data using the
SSRIT software (http://www.gramene.org/db/markers/ssrtool ). Of the 3,311 EST sequences,
72 ESTs contained microsatellite loci including 7 di-, 4 tri-, 4 tetra-, 3 penta- and 3
hexa-nucleotide repeats. Forty-six pairs of primers were designed based on related ESTs for
identification of putative microsatellites and tested on 5 Pst and 3 barley stripe rust P.
striiformis f. sp. hordei (Psh ) isolates selected to represent 8 most diverse virulence races of the two formae speciales of the stripe rust pathogens in the United States. A set of 20 Pst isolates randomly sampled in 2008 from three states (Washington, Idaho and Oregon) of the
US Pacific Northwest to represent the pathogen population in the region were used to assess the allelic variation of selected markers. DNA samples of a leaf rust ( P. triticina , Pt ) isolate, a wheat stem rust ( P. graminis f. sp. tritici , Pgt ) isolate, a bluegrass stripe rust ( P. pseudostriiformis , Pp ; syn: P. striiformis f. sp. poae ) (Liu & Hambleton 2010) isolate and a
wheat genotype ‘Avocet S’ ( Triticum aestivum ) were included in the study as references or
for determining specificity and cross-species transferability.
38
Table 1 Seventeen EST-SSR markers for Puccinia striiformis f. sp. tritici (Pst )and their primer sequences, PCR annealing temperature, number
of alleles and product size range, allele frequency, observed (Ho) and expected (He) heterozygosity, cross-species amplification, corresponding
supercontig identification numbers of Pst , P. graminis f. sp. tritici (Pgt ) and P. triticina (Pt )
Supercontig GenBank Repeat Tm No. of alleles Major allele Cross-species identification number Locus accession motif Primer sequences (5'-3') (oC) (size range, bp)* frequency Ho He amplification† Pst Pgt Pt
PstP001 JK479800 (CTA) 6 F: ACCATCGGATTCCTGC 49 2 (355, 360) 355 (0.554) 0.62 0.43 Pt, Pgt 5 -* - R: ACGGTAGGCGAACGAC 360 (0.446)
PstP002 JK479800 (ACT) 6 F: CTGACCATCGGATTCCTGC 53 2 (361, 367) 361 (0.554) 0.18 0.17 Pgt 5 - - R: TGAACGGTAGGCGAACGAC 367 (0.446)
PstP003 JK479801 (AATA) 5 F: TAACCCCACGGCAACTCA 50 2 (224, 241) 224 (0.643) 0.67 0.45 Pt, Pgt 35 35 36 39 R: ATCGTTGGCAGCCTTACC 241 (0.357)
PstP004 JK479803 (TCA) 6 F: TCTCGCCTCGCTTGAATG 50 2 (500, 503) 500 (0.536) 0.08 0.08 Pt, Pgt - - - R: TCGCTGGAGTTGGATGGA 503 (0.464)
PstP005 JK479809 (ACC) 6 F: CCAACAGGCTCAAACTACCA 52 2 (319, 326) 319 (0.589) 0.24 0.21 Pt, Pgt 1 1 146 R: TCCGCTTCGATCATAGCAC 326 (0.411)
PstP006 GH737707.1 (TGT) 6 F: GTTTGATTTTCCCTATGC 45 2 (243, 246) 243 (0.554) 0.11 0.11 Pt 5 5 82 R: AACTGAACGGAAGATGC 246 (0.446)
PstP007 GH737942.1 (GAA) 9 F: GATTTGCGAGGTCACTTT 46 2 (306, 312) 306 (0.214) 0.01 0.43 No amplicon - - - R: TGGTTGTGATAACGATGA 312 (0.786)
PstP008 GH737984.1 (CAA) 7 F: CCCTTGAGTAGTATGACC 48 2 (454, 457) 454 (0.875) 0.11 0.11 Pt, Pgt - 14 - R: AGAAGAGGACGAGAAGAT 457 (0.125)
PstP021 GH737353.1 (CT) 8 F: CCTCGACGCCCTCATTC 52 2 (193, 196) 193 (0.679) 0.08 0.08 Pt, Pgt 44 44 170/ R: TTGGTGACGAGCAGGTAT 196 (0.321) 20
PstP025 EG374292.1 (GA) 9 F: ATGTAAATGTAGCACCAAAC 48 3 (358, 364, 385) 358 (0.304) 0.11 0.30 Pgt 84 - -
R: TCATGCTCGGTATGTCTC 385 (0.464)
PstP027 JK479804 (TC) 13 F: CAGCGTAACTCCCAGGAT 50 2 (250, 252) 250 (0.518) 0.10 0.13 No amplicon 2 2 - R: GACCGTGTTCAGCCAAGT 252 (0.482)
PstP028 JK479808 (AAG) 6 F: GCATTCAAACAGCAGCAA 50 2 (489, 491) 489 (0.429) 0.09 0.08 Pgt - 51 135 R: GGTTAGGGTATGGCAAGG 491 (0.571)
PstP029 JK479813 (CAA) 9 F: ACAATCCTCAAGGTGGTG 48 3 (191,195, 205) 191 (0.536) 0.11 0.17 Pt, Pgt, Pp - - 30 R: GTTCGCTTTGTTGGTTAT 202 (0.304)
PstP030 GH737337.1 (GAT) 6 F: AAGGAAAAGAACTGTATG 41 2 (304, 315) 304 (0.214) 0.11 0.21 Pt, Pgt, Pp - - - R: TTCAGATGCTCTATTCAA 315 (0.786)
PstP031 GH737347.1 (GAA) 12 F: TTGGGCGTCCTGGCATTG 57 2 (277, 281) 277 (0.839) 0.01 0.30 No amplicon - - - R: ACCCGTTCCTTCTTGGTCTTGC 281 (0.161)
PstP033 GH737872.1 (AC) 8 F: ACAGAAGGAAGGCAGATT 46 3 (433, 446, 451) 433 (0.429) 0.13 0.12 Pt, Pgt - - - R: GGGGTTTGATGTTATTAC 451 (0.339)
PstP034 GH737893.1 (CT) 8 F: CCTCTTTTGTCCGCTTCC 50 2 (206, 208) 206 (0.393) 0.11 0.11 Pt, Pgt, Pp - - - 40 R: GTGCGACATGGTTTGACATT 208 (0.607)
*Length (ABI): expected fragment length plus 19 bps M13 tail for ABI detection.
†Pt : leaf rust ( P. triticina , Pt ) isolate; Pgt : wheat stem rust ( P. graminis f. sp. tritici , Pgt ) isolate, Pp : bluegrass stripe rust ( P. pseudostriiformis ,
Pp ; syn: P. striiformis f. sp. poae ) isolate.
‡-: No hits found.
DNA of all rust isolates were extracted from urediniospores using the method described
by Aljanabi and Martinez (1997). In order to use fluorescence to detect polymerase chain
reaction (PCR) products, an M13 tag (5’-CACGACGTTGTAAAACGAC) was added to the 5’
end of each forward primer (Schuelke 2000). Each PCR reaction contained 1× PCR buffer
(10 mM of Tris-HCl (pH=8.0), 50 mM of KCl), 200 M of dCTP, dGTP, dTTP and dATP, 1.5 mM MgCl 2, 5 pM tagged M13 fluorescent dyes (Applied Biosystems, Foster city, CA), 1 pM
5’-tagged forward primer, 5 pM reverse primer, 1 U of Taq polymerase (New England
Biolabs, Ipswich, MA) and 0.75 ng of DNA in a final volume of 12 l. PCR was performed in an iCycler (Biorad) thermal cycler (Watertown, MA, USA) with the following profile: 94
ºC for 5 min, 35 cycles of 94 ºC for 30 s, 50 ºC for 30 s (varies for each primer pair), and 72
ºC for 30 s, and 72 ºC for 10 min followed by a 4 oC holding step. Every four loci in the order listed in Table 1 tagged with FAM (blue), VIC (green), NED (yellow) and PET (red), respectively were pooled into one ABI sample. Then PCR products of 3.0 l FAM, 3.0 l
VIC, 4.0 l NED, and 6.0 l PET were added into 9 l ddH 2O to get a 25 l dilution. A total volume of 13 l containing 9.93 l formamide, 0.07 l DNA ladder (445-LIZ, Applied
Biosystems) and 3 l diluted PCR product was denatured at 95 ºC for 5 min and held at 4 ºC.
The size of the PCR products was estimated using capillary electrophoresis on an ABI3100
Genotyper (Applied Biosystems, Foster City, Calif., USA). The internal molecular weight standard for the ABI3100 was Genescan 445-LIZ (Applied Biosystems). Alleles were called using the GeneMapper v3.7 software.
A total of 34 primer pairs produced polymorphic bands, of which 17 produced single bands in a few tested isolates and 17 produced codominant bands (2 to 3 alleles) in the tests with the initially selected 8 Pst and Psh isolates. The 17 codominant markers were further tested with the 20 Pst isolates collected from Idaho, Oregon and Washington in 2008. The amplicon sizes of the co-dominant markers ranged from 191 to 503 bp containing 5 to 13 di-,
41
tri- or tetra-nucleotide repeats (Table 1). There were no null alleles among the 20 Pst isolates and the allele frequencies of markers are presented in Table 1. A total of 14 haplotypes were identified with the highest frequency of 15% in the tested population (data not shown). Four and five alleles were detected with four of the markers (PstP001, PstP002,
PstP005, PstP025) when tested with international mainly Asian isolates (Sharma et al. personal communication). This result is agreeable with study by Chen et al. (2009) which
13 of 20 their EST-SSR detected 2 to 3 alleles, 5 tected 4 alleles and 2 detected 7 alleles in a population of 25 Pst isolates collected from China and Iran. Barhi et al. (2009) used a test population consisted isolates mainly from Pakistan and revealed 5,7, and 8 alleles by 3 of their reported SSR where the rest 7 pairs of primer produced 2 to 3 alleles. It is indicated that the EST-SSR may be a good tag to describe the heterkaryon/heterozygous feature of stripe rust and reflect the clonal character of US isolates with less allele diversity and more complex reproduction carried by the Asian isolates with more allele diversity. Most markers in this study detetcted only 2 alleles in tested US isolates suggested a single copy of functional genes (ESTs) in each nucleus and could be powerful to characterize the nucleus type or genotype of P. striiformis isolates.
To determine their genomic locations, the marker sequences were blasted with the P. graminis f. sp. tritici (Pgt ) and P. triticina (Pt ) genomic sequence databases
(http://www.broadinstitute.org/annotation/genome/puccinia_group/Blast.html?sp=Sblastn ).
Near half of the sequences were located to different stem rust or leaf rust genome
supercontigs (Table 1). By searching the Pst linkage maps constructed by Ma et al. (2009),
8 out of the 17 microsatellite loci were found on 6 linkage groups, indicating that these
microsatellite loci are dispersed throughout the genome (Table 1). The observed and
expected heterozygosity values ranged from 0.01 to 0.67 and from 0.08 to 0.45, respectively.
Of the 136 possible pairwise combinations of the 17 co-dominant markers tested for linkage
42 disequilibrium with the 20 randomly sampled isolates using GenePop version 4.0.10
(Raymond & Rousset, 1995; Rousset, 2008), 95 (69.9%) combinations had significant linkage disequilibrium (LD) at the P = 0.05 level and 41 (30.1%) did not. When the
Bonferroni’s correction (Rice 1989) was applied, the significant LD pairs were reduced to
34.6%. However, none of the paired loci were on the same supercontig. This result was expected as the fungal population is putatively asexually reproducing and clonal.
Chi-squared tests for Hardy-Weinberg equilibrium were conducted for the marker loci among the 20 isolates collected in 2008 by GenAlEx 6.41 (Peakall & Smouse 2006). None of the loci fitted Hardy-Weinberg equilibrium because the reproduction mechanism of the stripe rust population is clonal (Hovmøller et al. 2011). Principal coordinate analysis (PCoA) based on
Euclidean distances between SSR genotypes using software GenAlEx 6.4 (Peakall & Smouse
2006) illustrated that the 17 markers distinguished the eight isolates representing diverse races of P. striiformis (Fig. 1).
43
Fig. 1 Principal coordinates analysis of eight races of Puccinia striiformis using 17 SSR markers. PSH denotes races of P. striiformis f. sp. hordei , the barley stripe rust pathogen and PST denotes races of P. striiformis f. sp. tritici , the wheat stripe rust pathogen.
44
Of the 17 primer pairs which produced codominant bands among the P. striiformis
isolates, 14 also produced amplicons in one or more isolates of other Puccinia species (Table
1). The rates of cross-species transferability of the EST-SSR markers designed from Pst
from high to low is in the order of Pgt > Pt > Pp . None of the primer pairs amplified bands
from wheat DNA, suggesting that these microsatellite markers may also be useful in
detecting rust pathogens from infected wheat plants before sporulation.
In conclusion, EST libraries were good resources to design SSR markers. The SSR
primers derived from Pst ESTs are useful for characterization of population structures in P.
striiformis and potentially useful for other Puccinia species. The microsatellites that are
randomly located throughout the P. striiformis genome may better profile the pathogen
populations.
Acknowledgement
This research was supported by the US Department of Agriculture, Agricultural Research
Service (Project No. 5348-22000-014-00D) and Washington Wheat Commission (Project No.
13C-3061-3925). PPNS No. 0587, Department of Plant Pathology, College of Agricultural,
Human, and Natural Resource Sciences, Agricultural Research Center, Project Number
WNP00663, Washington State University, Pullman, WA 99164-6430, USA.
45
References
Aljanabi SM, Martinez I (1997) Universal and rapid salt-extraction of high quality genomic
DNA for PCR-based techniques. Nucleic Acids Research 25 , 4692-4693.
Bahri B, Leconte M, de Vallavieille-Pope C et al. (2009) Isolation of ten microsatellite loci in
an EST library of the phytopathogenic fungus Puccinia striiformis f.sp. tritici .
Conservation Genetics 10 , 1425-1428.
Chen CQ, Zheng WM, Buchenauer H et al. (2009) Isolation of microsatellite loci from
expressed sequence tag library of Puccinia striiformis f.sp. tritici . Molecular Ecology
Resources 9, 236-238.
Chen XM (2005) Epidemiology and control of stripe rust [ Puccinia striiformis f. sp tritici ] on
wheat. Canadian Journal of Plant Pathology 27 , 314-337.
Enjalbert J, Duan X, Giraud T et al. (2002) Isolation of twelve microsatellite loci, using an
enrichment protocol, in the phytopathogenic fungus Puccinia striiformis f.sp. tritici .
Molecular Ecology Notes 2, 563-565.
Hovmøller MS, Sørensen CK, Walter S, Justesen AF (2011) Diversity of Puccinia striiformis
on Cereals and Grasses. Annual Review of Phytopathology 49 , 197-217.
Ling P, Wang MN, Chen XM et al. (2007) Construction and characterization of a full-length
cDNA library for the wheat stripe rust pathogen ( Puccinia striiformis f.sp. tritici ).
BMC Genomics 8, 145.
Liu M, Hambleton S (2010) Taxonomic study of stripe rust, Puccinia striiformis sensu lato,
based on molecular and morphological evidence. Fungal Biology 114 , 881-899.
Ma JB, Chen XM, Wang MN et al. (2009) Constructing physical and genomic maps for
Puccinia striiformis f. sp. tritici , the wheat stripe rust pathogen, by comparing its EST
sequences to the genomic sequence of P. graminis f. sp. tritici , the wheat stem rust
pathogen. Comparative and Functional Genomics 2009 , 1-13.
46
Peakall ROD, Smouse PE (2006) Genalex 6: genetic analysis in Excel. Population genetic
software for teaching and research. Molecular Ecology Notes 6, 288-295.
Raymond M, Rousset F (1995) GenePop (Version 1.2): population genetics software for exact
tests and ecumenicism. Journal of Heredity 86 , 248-249.
Rice WR (1989) Analyzing tables of statistical tests. Evolution; international journal of
organic evolution 43 , 223-225.
Rousset F (2008) GENEPOP'007: a complete reimplementation of the GENEPOP software
for Windows and Linux. Molecular Ecology Resources 8, 103-106.
Robinson AJ, Love CG, Batley J et al. (2004) Simple sequence repeat marker loci discovery
using SSR primer. Bioinformatics 20 , 1475-1476.
Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments.
Nature Biotechnology 18 , 233-234.
Stubbs RW (1985) Stripe rust. In: The Cereal Rusts, Vol. 2, Diseases, Distribution,
Epidemiology and Control (eds. Roelfs AP, Bushnell WR), pp. 61-101. Academic
Press, Orlando, FL.
Yin CT, Chen XM, Wang XJ et al. (2009) Generation and analysis of expression sequence
tags from haustoria of the wheat stripe rust fungus Puccinia striiformis f.sp. tritici .
BMC Genomics 10 , 626.
Zhang Y, Qu Z, Zheng W et al. (2008) Stage-specific gene expression during urediniospore
germination in Puccinia striiformis f.sp. tritici . BMC Genomics 9, 203.
47
CHAPTER THREE
Somatic hybridization between wheat stripe rust Puccinia striiformis f. sp. tritici and
barley stripe rust ( P. striiformis f. sp. hordei ) in grasses revealed by virulence patterns
and microsatellite markers
P. CHENG*, X. M. CHEN*†, R. A. MCINTOSH‡, D. R. SEE†
*Department of Plant Pathology, Washington State University, Pullman, WA 99164-6430,
USA; †USDA-ARS, Wheat Genetics, Quality, Physiology, and Disease Research Unit,
Pullman, WA 99164-6430, USA; ‡Plant Breeding Institute, Cobbitty, University of Sydney,
Private Bag 4011, Narellan, NSW, 2567, Australia
Abstract
Puccinia striiformis causes stripe rust on wheat, barley and many grass species. Somatic hybridization is a possible mechanism for generating variation in an asexually reproducing population, but evidence is lacking. There are also questions about the possibility of somatic hybridization between the wheat stripe rust pathogen ( P. striiformis f. sp. tritici , Pst ) and the barley stripe rust pathogen ( P. striiformis f. sp. hordei , Psh ). This study was undertaken to search for evidence of somatic hybridization through virulence and molecular characterization of natural isolates collected from various grasses as well as wheat and barley.
A total of 103 isolates were tested on 20 wheat and 12 barley genotypes that are used to differentiate Pst and Psh , respectively, and tested with 20 codominant microsatellite markers.
Virulence analyses identified isolates from grasses which were able to infect some differential genotypes of wheat, barley, or both. Microsatellite markers showed that the isolates capable of infecting both wheat and barley are very likely hybrids between Pst and Psh . The results
48 indicate that somatic hybridization occurs between Pst and Psh on grasses, especially wild barley grasses ( Hordeum spp.) which are often infected by both the formae speciales.
Keywords : microsatellite markers, virulence, resistance genes, population structure, somatic hybridization, grasses, stripe rust, Puccinia striiformis
Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the
U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.
Introduction
Stripe rust, caused by Puccinia striiformis Westend. which is an obligate, biotrophic and dikaryotic fungus, is a major disease in the world infecting wheat, barley and many grass species (Stubbs 1985; Chen 2005). In the literature, 320 grass species classified in 50 genera of the grass family Poaceae can be infected by stripe rust (Hassebrauk 1965).
According to the pathogen-host coevolution theory (Anderson & May 1982), the rust from wild grasses (high genetic diversity) could harbor more genetic variation than the ones from domestic common wheat (low genetic diversity) due to the host selection.
The P. striiformis species is separated into several formae speciales based on their specialization on different host plants. Eriksson (1894) reported the first five formae speciales of P. striiformis : P. striiformis f. sp. tritici (Pst ) on wheat, P. striiformis f. sp. hordei
(Psh ) on barley, P. striiformis f. sp. secalis on rye, P. striiformis f. sp. elymi on Elymus spp. and P. striiformis f. sp. agropyron on Agropyron spp. Later, three more formae speciales were reported: P. striiformis f. sp. dactylidis (Psd ) on orchard grass ( Dactylis glomerata L.)
(Manners 1960; Tollenaar 1967), P. striiformis f. sp. poae (Psp ) on Kentucky blue grass ( Poa
49
pratensis L.) (Tollenaar 1967) and P. striiformis f. sp. leymi on Leymus secalinus (Niu et al.
1991). Recently, a new forma specialis ( P. striiformis f. sp. pseudo-hordei , Psp-h) was
proposed for P. striiformis on wild barley grass ( Hordeum spp.) in Australia (Wellings et al.
2000). The host specificity of P. striiformis f. sp. hordei , P. striiformis f. sp. tritici and P.
striiformis f. sp . poae (from blue grass) were confirmed by greenhouse virulence tests and the
three formae speciales can be separated from each other by random amplified polymorphism
DNA (RAPD) analysis (Chen et al. 1995). Based on spore morphology and sequences of
ITS and beta-tubulin DNA, the stripe rust pathogens on bluegrass and orchard grass were
described as new species, P. pseudostriiformis and P. striiformoides , respectively (Liu &
Hambleton 2010) .
In the United States, wheat stripe rust was first recognized in 1915 (Carleton 1915).
The disease is most frequently destructive in the western United States, especially the Pacific
Northwest (PNW) and California, and since 2000 it has also become a serious production
problem in states east of the Rocky Mountains (Chen 2007). Barley stripe rust, caused by
Psh , is relatively new in the United States and first found in 1991 in Uvalde, Texas (Roelfs et al. 1992; Marshall & Sutton 1995). It became an invasive disease in the following years in
North America and has been found in Arizona, California, Colorado, Idaho, Montana, Oregon and Washington of the United States and Canada (Brown et al. 2001). The severe wheat stripe rust epidemics and very low levels of barley stripe rust in recent years clearly show that the diseases are caused by different formae speciales of P. striiformis (Chen, 2010 and 2011, unpublished data). The separation of Pst and Psh were also supported by analysis of molecular markers (Chen et al. 1995). Therefore, Pst races have been differentiated by a set of wheat genotypes and Psh races by a set of barley genotypes in the United States (Chen et al. 1995; Chen 2005; Wan & Chen 2012). Although Pst mostly infects wheat and Psh mostly infects barley, wheat and barley have been found as common hosts for both formae
50
speciales. Before Psh was first detected in the United States in 1991 (Roelfs et al. 1992), stripe rust collected from barley, rye, triticale and various grasses, except bluegrass and orchard grass, had been identified as the Pst races commonly found in wheat fields (Line &
Qayoum 1992; Line 2002). Since 1991, stripe rust samples from grasses (also except
bluegrass and orchard grass) have been identified as Pst races, sometimes Psh races, and occasionally as both Pst and Psh races (Chen 2005; Chen et al. 2010). Furthermore, stripe rust samples collected from barley were occasionally identified as both Pst and Psh races based on tests on both wheat and barley differential genotypes (Chen et al. unpublished data).
These observations let us speculate that grasses serving as a common host for both Pst and
Psh may provide the opportunity for the two formae speciales to hybrid.
The stripe rust pathogen is highly variable as demonstrated by both virulence and molecular tests (Stubbs 1985; Line 2002; Chen 2005; Hovmøller et al. 2011). However, the evolutionary mechanisms generating this diversity are not clear. Although some Berberis spp. have been demonstrated to serve as alternate hosts for Pst under greenhouse conditions
(Jin et al. 2010), sexual reproduction for Pst and Psh under natural conditions has not been demonstrated. A recent study showed that barberry ( Berberis vulgaris ) plants are not important for stripe rust in the US Pacific Northwest (Wang et al. 2011). Clonal reproduction via urediniospores is thought to be the major feature of the pathogen in the US
(Chen 2005) and Australia and Europe (Hovmøller et al. 2002; Enjalbert et al. 2005;
Hovmøller & Justesen 2007). The high ability to circumvent the specific resistance genes in wheat cultivars is thought to be due to mutation which results in new alleles and genotypes
(Wellings & McIntosh 1990; Line & Qayoum 1992). A stepwise mutation model was proposed by analyzing P. striiformis samples collected from Australia and New Zealand with
RAPD and AFLP markers (Steele et al. 2001). In addition to mutation, somatic hybridization, which is through karyogamy to re-assort nuclei and possibly leads to 51 re-assortment of chromosomes from different nuclei (somatic recombination), is thought to be a mechanism for creating variations in the pathogen population (Stubbs 1985; Chen 2005).
Evidence of somatic hybridization under controlled conditions have been showed by virulence difference in resulting isolates from two co-inoculated parental races with many rust fungi including flax rust, crown rust, stem rust, stripe rust and leaf rust (reviewed by Park
& Wellings 2012). A novel race of stripe rust was produced by inoculating two races on a common susceptible wheat cultivar, and somatic hybridization of whole nuclei during germ-tube fusion was demonstrated (Little & Manners 1969a, b; Wright & Lennard 1980).
Somatic hybridization has also been observed by electron microscopy (Kang et al. 1993a, c, b, d; Ma et al. 1993). Heterokaryosis, a phenomenon that a single- urediniospore isolate contains two different nuclei, has been found to be very common in Pst isolates by gene sequencing (Liu et al. 2009). Genetic recombination has also been proposed by studying the genetic diversity of the Pst population in Gansu, China (Mboup et al. 2009; Duan et al. 2010).
Detections of hybrid isolates in nature were also found in many other organisms. A new fungal pathogen as a result of hybridizing two Phytophthora spp. was able to attack a novel host species (Brasier et al. 1999). It is indicated that hybridization played a key role in adaptation of wild sunflowers to extreme habitats (Rieseberg et al. 2003). Hybridization also occurred between non-sister species of butterfly in genus Heliconius (Dasmahapatra et al.
2007). The recovery of red wolves in North Carolina was threatened by hybridizing with coyotes (Adams et al. 2007).
There is a great potential for new race generation if Pst and Psh can hybridize and produce races infecting both wheat and barley cultivars. A common host must be available for the growth of both formae speciales for somatic hybridization to take place. Although some wheat genotypes are susceptible to Psh and some barley genotypes are susceptible to
Pst , few commercial cultivars of wheat and barley are susceptible to Psh and Pst , respectively
52
(Chen et al. 1995; Pahalawatta & Chen 2005a, b). Wild grasses especially the barley
grasses ( Hordeum spp.) could serve as the common hosts for both formae speciales to
hybridize. This is the first study that provided both virulence and molecular evidence of
somatic hybridization between Pst and Psh in nature.
Materials and methods
Fungal collection and spore multiplication
Among 103 pathogen isolates used in this study, 41 were collected from 13 species of wild grasses in 2000-2008 (Table 1), 46 from wheat, 11 from barley, 4 from triticale and 1 from rye. The isolates from wheat and barley were selected from the collections made between
2000 and 2008 as references for Pst and Psh , respectively, except for six Pst isolates representing historically important races (PST-1, PST-17, PST-21, PST-43, PST-45 and
PST-59) from 1960s to 1999 (Line & Qayoum 1992; Chen 2005). All rust samples were increased in the greenhouse either on wheat cultivar ‘Nugains’ which does not have resistance in seedling stage to any Pst races so far in the United States (Line & Qayoum 1992; Chen et
al. 2002; Chen et al. 2010), or ‘Chinese 166’ ( Yr1 ), which is susceptible or moderately
susceptible to races of Psh (Stubbs 1985); and barley cultivar ‘Steptoe’, which is susceptible
to all races of Psh and resistant to most Pst races (Chen et al. 1995; Chen et al. 2010),
following the standard procedures as previously described (Chen & Line 1992a, b). The
single-spore isolates developed by Chen et al. (1993) were used for the six isolates
representing the races before 2000, and the remaining isolates were single-uredium isolates.
Increased urediniospores were dried and kept in a desiccator at 4 oC for less than two months
and in liquid nitrogen for a long period.
53
Table 1 Hosts, collection locations, Puccinia striiformis f. sp. tritici (Pst ) and P. striiformis f. sp. hordei (Psh ) races, virulence phenotypes with
combination of wheat and barley differential tests, and haplotypes and groups identified through molecular analysis of stripe rust isolates
collected from wheat, barley, triticale, rye and various grasses
Virulence analysis Molecular analysis Host, No. of isolates & isolate ID* State Pst race† Psh race† Phenotype Group Genotype Group Wheat ( Triticum aestivum ) (46) 08-4 CA PST-127 N/A‡ V68 VG 3 G1 MG 1 PST-127 (07-211-13-Sp1) WA PST-127 N/A V68 VG 3 G2 MG 1 08-308-6-Sp1 WA PST-116 N/A V67 VG 3 G2 MG 1 08-304-15 WA PST-137 N/A V69 VG 3 G4 MG 1
54 08-42 WA PST-109 N/A V23 VG 2 G15 MG 3a 08-165 KS PST-123 N/A V48 VG 3 G15 MG 3a 08-254 WI PST-117 N/A V49 VG 3 G15 MG 3a PST-17 WA PST-17 N/A V31 VG 2 G16 MG 3a PST-43 WA PST-43 N/A V36 VG 2 G16 MG 3a PST-59 CA PST-59 N/A V29 VG 2 G16 MG 3a 08-12-3 WA PST-25 N/A V34 VG 2 G16 MG 3a 08-25 WA PST-92 N/A V19 VG 2 G16 MG 3a 08-70 WA PST-23 N/A V32 VG 2 G16 MG 3a 08-223 WA PST-46 N/A V33 VG 2 G16 MG 3a PST-1 WA PST-1 N/A V15 VG 2 G17 MG 3a PST-3 WA PST-3 N/A V17 VG 2 G18 MG 3a PST-45 WA PST-45 N/A V28 VG 2 G18 MG 3a 08-327 ID PST-114 N/A V51 VG 3 G19 MG 3a
08-58-2 CA PST-67 N/A V30 VG 2 G30 MG 3b 08-224 OR PST-102 N/A V46 VG 3 G34 MG 3c PST-80 (2K048-8) TX PST-80 N/A V53 VG 3 G35 MG 3c PST-100 (03-202-10-Sp1) WA PST-100 N/A V41 VG 3 G36 MG 3c PST-98 (02-184-16-10) VA PST-98 N/A V42 VG 3 G39 MG 3c PST-78 (2K041-Yr9) AR PST-78 N/A V52 VG 3 G40 MG 3c 08-5-2 CA PST-129 N/A V44 VG 3 G40 MG 3c 08-7 GA PST-101 N/A V45 VG 3 G40 MG 3c 08-92 GA PST-100 N/A V41 VG 3 G40 MG 3c 08-120 CA PST-98 N/A V42 VG 3 G40 MG 3c 08-124 CA PST-111 N/A V55 VG 3 G40 MG 3c 08-141 CA PST-129 N/A V44 VG 3 G40 MG 3c 08-142 CA PST-98 N/A V42 VG 3 G40 MG 3c
55 08-156 KY PST-110 N/A V43 VG 3 G40 MG 3c 08-164 KS PST-117 N/A V49 VG 3 G40 MG 3c 08-167 VA PST-100 N/A V41 VG 3 G40 MG 3c 08-179 WA PST-119 N/A V50 VG 3 G40 MG 3c 08-237 OR PST-133 N/A V60 VG 3 G40 MG 3c 08-243 OR PST-102 N/A V46 VG 3 G40 MG 3c 08-244 WI PST-102 N/A V46 VG 3 G40 MG 3c 08-252 WI PST-131 N/A V59 VG 3 G40 MG 3c 08-253 WI PST-114 N/A V51 VG 3 G40 MG 3c 08-259 WI PST-117 N/A V49 VG 3 G40 MG 3c 08-269 ID PST-115 N/A V58 VG 3 G40 MG 3c 08-284 OR PST-101 N/A V45 VG 3 G40 MG 3c 08-291 OR PST-113 N/A V47 VG 3 G40 MG 3c 08-93 GA PST-115 N/A V58 VG 3 G43 MG 3c
08-225 OR PST-111 N/A V55 VG 3 G44 MG 3c Barley ( Hordeum vulgare ) (11) 06-223-N MN PST-102 PSH-48 V40 VG 3 G37 MG 3c PSH-75 (06-005) AZ N/A‡ PSH-75 V11 VG 1 G8 MG 2 08-275 OR N/A PSH-71 V13 VG 1 G8 MG 2 08-140 CA N/A PSH-54 V8 VG 1 G9 MG 2 08-66 WA N/A PSH-70 V5 VG 1 G10 MG 2 08-169 OR N/A PSH-77 V12 VG 1 G11 MG 2 PSH-53 (01-248) WA N/A PSH-53 V7 VG 1 G12 MG 2 PSH-72 (04-051-12) OR N/A PSH-72 V6 VG 1 G13 MG 2 08-110 CA N/A PSH-68 V9 VG 1 G25 MG 3b 08-114 CA N/A PSH-33 V1 VG 1 G25 MG 3b 08-137 CA N/A PSH-37 V10 VG 1 G27 MG 3b
56 Triticale ( Triticosecale spp.) (4) 05-161 GA PST-115 N/A V58 VG 3 G3 MG 1 02-089-10-N OR PST-133 N/A V60 VG 3 G5 MG 1 PST-21 CA PST-21 N/A V14 VG 2 G25 MG 3b 04-146 OR PST-101 PSH-33 V63 VG 3 G33 MG 3c Rye ( Secale cereal ) (1) 04-147-2-Sp1 OR PST-100 N/A V41 VG 3 G16 MG3a Foxtail barley grass ( Hordeum jubatum , H. spontaneum ) (16) 06-032-C CA PST-113 N/A V47 VG 3 G2 MG 1 06-030-C CA PST-137 N/A V69 VG 3 G6 MG 1 00-071-S CA PST-81 PSH-33 V4 VG 1 G7 MG 2 06-076-N CA PST-92 N/A V19 VG 2 G14 MG 3a 00-016 WA PST-93 N/A V21 VG 2 G16 MG 3a 06-030-N CA PST-100 N/A V41 VG 3 G16 MG 3a
06-036-N CA PST-105 N/A V35 VG 2 G16 MG 3a 06-058-N CA PST-91 N/A V64 VG 3 G17 MG 3a 06-035-N CA PST-105 N/A V35 VG 2 G18 MG 3a 04-063-S CA PST-6 PSH-33 V24 VG 2 G22 MG 3a 08-45-S CA PST-21 PSH-33 V2 VG 1 G25 MG 3b 08-146-S CA PST-21 PSH-33 V2 VG 1 G25 MG 3b 08-121-S CA PST-21 PSH-33 V2 VG 1 G27 MG 3b 08-145-S CA PST-21 PSH-46 V3 VG 1 G28 MG 3b 08-146-N CA PST-21 PSH-33 V2 VG 1 G29 MG 3b 08-121-N CA PST-101 PSH-33 V63 VG 3 G42 MG 3c Jointed goatgrass ( Aegilops cylindrica ) (6) 05-316 KS PST-50 N/A V37 VG 2 G16 MG 3a 07-137 WA PST-117 PSH-33 V39 VG 3 G32 MG 3c
57 07-137-6-Sp1 WA PST-53 N/A V20 VG 2 G16 MG 3a 07-179-S NE PST-98 PSH-46 V62 VG 3 G8 MG 2 08-JG WA PST-21 PSH-33 V2 VG 1 G24 MG 3b 08-268 WA PST-114 PSH-33 V65 VG 3 G40 MG 3c Crested wheatgrass ( Agropyron cristatum ) (1) 00-141-N ID PST-122 PSH-48 V66 VG 3 G3 MG 1 Wild oat ( Avena fatua ) (2) 08-wo-N WA PST-53 PSH-33 V25 VG 2 G23 MG 3b 08-wo-S WA PST-21 PSH-33 V2 VG 1 G26 MG 3b Meadow brome ( Bromus biebersteinii ) (3) 00-142-N ID PST-123 N/A V48 VG 3 G16 MG 3a 00-142-S ID PST-102 PSH-50 V61 VG 3 G20 MG 3a 00-142-C-S ID PST-20 PSH-50 V38 VG 2 G21 MG 3a Mountain brome ( Bromus marginatus ) (3)
08-74-N WA PST-114 PSH-33 V65 VG 3 G31 MG 3c 08-B1 WA PST-110 PSH-33 V56 VG 3 G38 MG 3c 08-B2 WA PST-110 PSH-33 V56 VG 3 G40 MG 3c Wild rye ( Elymus fedtschenkoi ; E. glaucus ) (2) 01-120 KS PST-122 N/A V57 VG 3 G16 MG 3a 05-469 ID PST-111 PSH-33 V54 VG 3 G41 MG 3c Western wheatgrass ( Pascopyrum smithii ) (2) 00-139-N ID PST-35 N/A V18 VG 2 G16 MG 3a 00-139-S ID PST-35 PSH-48 V26 VG 2 G21 MG 3a Bluebunch wheatgrass ( Pseudoroegneria spicata ) (3) 00-140-N ID PST-66 N/A V16 VG 2 G18 MG 3a 00-140-S ID PST-60 PSH-48 V27 VG 2 G21 MG 3a 00-140-Stephens ID PST-67 PSH-48 V22 VG 2 G21 MG 3a
58 Orchard grass ( Dactylis glomerata ) (2) 06-og-1 WA N/A N/A N/A N/A N/A N/A 06-og-2 WA N/A N/A N/A N/A N/A N/A Bluegrass ( Poa pratensis ) (1) 07-bg WA N/A N/A N/A N/A N/A N/A
* The first two digits of each isolate name stand for the collected year.
‡ N/A indicates that the isolate produced necrotic flecks or patches (ITs 1 or 2) but no uredia (avirulent) on any genotype of the differential set
and therefore designating a race name is not applicable. Differently, the orchard grass and bluegrass isolates did not produce any visible
symptom on any of the wheat and barley differential genotypes.
Virulence tests
Virulence patterns for each isolate were determined by testing on 20 wheat and 12 barley
genotypes that are used to differentiate Pst and Psh , respectively (Chen et al. 1995; Chen et al. 2002; Wan & Chen 2011). Fresh urediniospores or those kept in the desiccator at 4 oC for less than two months were used to inoculate the wheat and barley differential genotypes.
Seedlings at two-leaf stage were dust-inoculated with urediniospores mixed with talc (Sigma,
Milwaukee, WI, USA) at a ratio of 1:20. Inoculated plants were placed in a dew chamber for 24 h at 10 oC without light and then moved to a growth chamber to grow at a diurnal temperature cycle gradually changing from 4 oC at 2:00 am to 20 oC at 2:00 pm with a 16 h light and 8 h dark cycle. To prevent cross contamination, plants inoculated with different isolates were separated by plastic booths. Infection types (IT) were recorded 18-20 days after inoculation using the 0-9 scale (Line & Qayoum 1992; Chen et al. 2002). In this study, we only had ITs 0, 1 and 2 which were considered avirulent (A) and ITs 7, 8 and 9 which were considered virulent (V).
SSR markers
DNA was extracted from urediniospores following a modified protocol of DNA extraction
(Aljanabi & Martinez 1997). DNA concentration was determined using a ND-1000 spectrophotometer (Bio-Rad, Hercules, CA, USA) and stored at -20 oC. For PCR amplification, the stock DNA solution was diluted to 30 ng/ l as working solution and kept at
4oC. After initial screening, 20 SSR primer pairs with ability to detect homo/heterozygous
59
and polymorphic among 5 Pst races (PST-1, 21, 78, 100 and 127) and 3 Psh (PSH-4, 45 and
72) races were selected to better characterize the dikaryotic fungus which can be treated as diploid (Table 2). Of the 20 pairs of SSR primers, 3 (RJ18, RJ20 and RJ21) were developed from genomic DNA (Enjalbert et al. 2002) and 17 from expressed sequence tags (ESTs), including 4 (CPS02, CPS04, CPS08 and CPS13) developed by Chen et al. (2009), 2 (RJ2N and RJ8N) by Bahri et al. (2009a), and 11 (PstP001, PstP003, PstP004, PstP005, PstP006,
PstP007, PstP025, PstP029, PstP030, PstP031 and PstP033) by Cheng et al. (2012). All
primer sequences and annealing temperatures are listed in Table 2. In order to use
fluorescence to detect polymerase chain reaction (PCR) products, an M13 tag
(5’-CACGACGTTGTAAAACGAC) was added to the 5’ end of each forward primer
(Schuelke 2000).
Each PCR reaction contained 1× PCR buffer (10 mM of Tris-HCl, 50 mM of KCl); 200