MORPHOLOGICAL & MOLECULAR CHARACTERISATION OF CANDIDATUS MIDICHLORIA MITOCHONDRII

Swee Lin Wenna Lee

Bachelor of Science

Under the supervision of: Dr Charlotte Oskam (Primary) Dr Amanda Barbosa Prof. Peter Irwin

Submitted in fulfilment of the requirements for the degree of Bachelor of Science Honours in Biological Sciences

School of Veterinary and Life Sciences Murdoch University, 2019 Declaration of Original Authorship

The work contained in this thesis has not been previously submitted to fulfil requirements for an award at this or any other higher education institution. To the best of my knowledge and belief, this thesis contains no material previously published or written by another person except where references are made.

Swee Lin Wenna Lee

Signature: ______

Date: 21 October 2019

ii Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii Abstract

Tick-borne diseases are a class of an emerging infectious disease that presents a global threat. Much of the knowledge, diagnosis and treatment protocols have been developed in the Northern Hemisphere where the environment, native animals and arthropod-vectors, all factors that influence vector competence, are different to Australia.

In the Northern Hemisphere, the causative agents of Lyme Borreliosis have been identified, along with insightful scientific knowledge that came with extensive studies into the native ticks. In Australia, there are reportedly over 20,000 people living with Lyme-like symptoms and the number of people affected is expected to increase. However, the causative agent of Debilitating Symptom Complexes Attributed to Ticks (DSCATT) has not been identified and the causative agent of Lyme Borreliosis and the Ixodes clade of competent tick vectors do not exist in Australia. The scarcity of research into native ticks and the microbes they carry in Australia is a significant obstacle into developing diagnostic and treatment protocols for these people. This study was able to provide evidence of transmission of Candidatus Midichloria mitochondrii from the Australian paralysis tick, Ixodes holocyclus, to a human patient and is the first to detect Ca. M. mitochondrii DNA in human blood and tissue samples. This finding therefore increases the urgency to either confirm or disprove the paradigm that endosymbionts are innocuous bacteria that were harboured within ticks.

This research developed an assay which was able to sequence 16S gene of the Australian Ca. M. mitochondrii to over 1300 bp which has not been previously achieved, providing higher resolution for phylogenetic analyses. Furthermore, novel sequences of the Australian Ca. M. mitochondrii GyrB and GltA were amplified and concatenated for phylogenetic analyses. It was found that the Australian Ca. M. mitochondrii has a 2.35% genetic difference to the overseas Ca. M. mitochondrii, which is greater than the genetic difference of below 1% between three of the six Rickettsia species also analysed in this study, that were already identified as distinct species. While there are inadequate sequences in the Midichloriaceae family to determine if the Australian Ca. M. mitochondrii is a novel species, the results of this study suggest that it could be. In future, whole genome sequencing of Australian Ca.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii iii M. mitochondrii would be ideal to more accurately compare genetic distances using phylogenetic analysis.

This research also described histological features of native I. holocyclus using haematoxylin and eosin (H&E) and DAPI nuclear staining in addition to optimisation of several key steps such as fixation, sectioning and de-paraffin protocols. These are significant because current fluorescence in-situ hybridization (FISH) techniques were based on non-native Ixodes tick species which were ineffective on native Australian Ixodes tick species and the findings of this study are crucial to further research.

iv Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii Acknowledgements

I would like to thank my primary supervisor, Dr Charlotte Oskam, for taking me on as an honour student. Thank you for listening to my interests and designing a project that is so in line with my passion. It would seem like you knew me better than I knew what I wanted, right from the start! Also, thank you for being so approachable and patient as I found my feet navigating life as a researcher and for always encouraging me and building my confidence. To my secondary supervisor, Dr Amanda Barbosa, your passion for research is highly contagious and it has most certainly rubbed off on me. You have showed me the reality of research; how mesmerizing Science is and how perseverance can pay off with your optimistic outlook. Thank you for the long hours, guidance and laughs that made my honour year such an enjoyable one. To Prof Peter Irwin, I would like to thank you for agreeing to be my supervisor and encouraging me when I hit obstacles. I’m in awe of the scale of the NHMRC project you’re handling yet you still find time for random facts and quirky sense of humour. There is so much to learn from you that I don’t know where to start. To my Vector and Waterborne Pathogens Research Group, the moment I saw the comraderies everyone shared, I instantly knew I wanted to be part of this group. Megan Evans, you might not know this, but the advice you’ve dispensed me solved a part of my problems in the lab. Special thanks to Siobhon Egan for the positive samples which were so crucial to my project. Along with Dr Alireza Zahedi, whom I have met since I started my degree, everyone is so inclusive and eager to help and offer constructive advice right from the start. Thank you, Dr Jill Austen, for allowing me to understudy you for a summer and inspiring me to do my honours. You never fail to put a smile on my face with your infectious laughter! To my honour mates, Aimee Carpenter and Ruby McKenna, thank you for the banter, I have benefitted from working with such motivated individuals such as yourselves! Also, special thanks to Brendan Groves from the vet Histology lab for the ongoing support and advice in tick fixation and sectioning. Thank you to the Harry Butler Institute, Banksia Association and Murdoch University for the generous scholarships which motivated and spurred me to achieve better. Last but not least, I would like to thank my family for picking up the slack when I’m buried nose-deep in my honour year. Just listening to me rattling on endlessly about the new exciting findings or fixing my computer issues were such lifesavers. To my brilliant boys, I am so lucky to have both of you: You’re intelligent, athletic and such independent, caring individuals. When I feel exhausted, I just need to look at you guys for motivation.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii v

Table of Contents

Abstract ...... iii Acknowledgements ...... v Table of Contents ...... vi List of Figures ...... viii List of Tables ...... x List of Abbreviations ...... xi Chapter 1: Introduction ...... 1 1.1 Tick microbiome ...... 3 1.1.1 Tick endosymbionts ...... 3 1.2 Candidatus Midichloria mitochondrii ...... 5 1.2.1 Tropism ...... 6 1.2.2 Morphological characterisation techniques of tick microbiome ...... 7 1.2.3 Morphology ...... 8 1.2.4 Genome, Taxonomy and Phylogeny ...... 9 1.2.4.1 Putative Flagella genes ...... 11 1.2.4.2 Putative cbb3 oxidase genes ...... 12 1.2.5 Prevalence of Ca. M. mitochondrii in Ixodes ticks...... 13 1.3 Ticks ...... 14 1.3.1 Phylogenetic classifications of Ticks ...... 14 1.3.2 Australian Ticks ...... 16 1.3.3 Ixodes holocyclus ...... 16 1.3.4 Lifecycle of I. holocyclus ...... 17 1.4 Histological features of I. holocyclus internal anatomy ...... 18 1.4.1 The female reproductive organs of ixodid ticks...... 19 1.5 Evidence for Ca. M. mitochondrii transmission ...... 21 1.6 Human immunologic response to a tick bite ...... 23 1.6.1 Human Immunity ...... 24 1.7 Summary ...... 25 1.8 Aims ...... 26 1.9 Hypotheses ...... 27 Chapter 2: Materials and methods ...... 28 2.1 Sample Acquisition ...... 28 2.2 Nucleic acid concentration ...... 28 2.3 Polymerase chain reaction Anaysis ...... 29 2.3.1 PCR Optimisation ...... 31 2.3.2 Agarose Gel Electrophoresis, Gel Extraction and Purification ...... 31 2.3.3 Phylogenetic analysis ...... 31 2.4 Fluorescence in-situ hybridistion (FISH) ...... 32

vi Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 2.4.1 Probe Selection and Design ...... 33 2.4.2 Fixation of I. holocyclus specimen ...... 34 2.4.3 Dehydration of I. holocyclus specimen ...... 35 2.4.4 EtOH/Chloroform treatment of I. holocyclus specimen ...... 35 2.4.5 Paraffin Infiltration of I. holocyclus specimen ...... 35 2.4.6 Sectioning of I. holocyclus specimen embedded in paraffin ...... 36 2.4.7 Deparaffinization of I. holocyclus sections ...... 36 2.4.8 Permeabilization: Pre-hybridisation optimisation ...... 37 2.4.9 Hybridization of probes to I. holocyclus sections ...... 38 2.4.10 DNA stain to I. holocyclus sections ...... 38 2.4.11 Haematoxylin and eosin (H&E) stain to I. holocyclus sections ...... 38 2.4.12 Slide Mounting ...... 39 2.4.13 Fluorescence microscopy ...... 39 Chapter 3: Results ...... 40 3.1 Molecular Characterisation ...... 40 3.1.1 Optimisation of uncoupled PCR assays ...... 40 3.1.2 Ca. M. mitochondrii in Australian human samples...... 44 3.1.3 Genotype comparison: 1332 bp 16S gene (16S Assay 5) ...... 49 3.1.4 Genotype comparison: 1051 bp 16S gene (16S Assay 5) ...... 50 3.1.5 Genotype comparison: 143 bp 16S gene (16S Assay 1) ...... 51 3.1.6 Genotype comparison: GltA gene ...... 53 3.1.7 Genotype comparison: GyrB gene ...... 53 3.1.8 Concatenated genes analysis ...... 54 3.2 Morphological Characterisation ...... 57 3.2.1 Characterisation of I. holocyclus histological features ...... 57 3.2.2 Characterisation of I. holocyclus histological features: Oocytes ...... 58 3.2.3 Detection of Ca. M. mitochondrii with FISH ...... 60 Chapter 4: Discussion ...... 64 4.1 Characterisation of the Australian Ca. M. mitochondrii ...... 64 4.1.1 Primers and protocol based on CMM from the Northern Hemisphere ...... 65 4.1.2 Analyses with varying length 16S sequences...... 65 4.1.3 Concatenated sequence as a solution to above problems ...... 66 4.2 First evidence of Ca. M. mitochondrii in Australian human patient samples following tick bite ...... 67 4.2.1 Ca. M. mitochondrii detection in different specimen type ...... 67 4.3 Histological characterisation of I. holocyclus ...... 68 4.3.1 Determination of suitable section for analysis ...... 69 4.3.2 Localisation of Ca. M. mitochondrii via FISH assay ...... 69 Chapter 5: Conclusions ...... 72 References ...... 73 Appendices ...... 89

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii vii List of Figures

Figure 1.1: TEM of RMs within the mitochondria of developing I. ricinus oocyte...... 5 Figure 1.2: TEM of Ca. M. mitochondrii outside the mitochondria ...... 7 Figure 1.3: Mitochondrial matrix with Ca. M. mitochondrii bacteria ...... 8 Figure 1.4: Indirect immunofluorescence assay of I. ricinus ovaries...... 9 Figure 1.5: Phylogenetic analysis of representatives of alphaproteobacteria based on 88 conserved proteins...... 11 Figure 1.6: Phylogenetic analysis of representative proteobacteria based on conserved flagellar proteins...... 12 Figure 1.7 : Phylogenetic analysis based on cbb3 proteins...... 13 Figure 1.8: Phylogenetic classification of Ixodidae families...... 15 Figure 1.9: I. holocyclus tick and the approximate geographical range shaded...... 17 Figure 1.10: Lifecycle of I. holocyclus in stages...... 18 Figure 1.11: Adapted illustration of internal anatomy of female ixodid tick...... 19 Figure 1.12: Adapted illustrations of the female reproductive system in ixodid ticks...... 20 Figure 1.13: Adapted illustrations on the development of oocytes...... 20 Figure 1.14: Ovarian tissue, showing oocytes labelled by probes ...... 20 Figure 1.15 : FISH of whole mount I. ricinus larvae to detect Ca. M. mitochondrii...... 22 Figure 1.16: Indirect immunofluorescence assay on salivary glands of I. ricinus ticks...... 23 Figure 1.17: Immune response timeline to a bacterial infection...... 25 Figure 3.1: Amplification of 16S, GltA and GyrB gene loci ...... 40 Figure 3.2: Adapted 16S rRNA primer alignment with the Ca. M. mitochondrii 16S rRNA gene on Geneious...... 42 Figure 3.3: 16S Assay 2 and 16S Assay 3 amplification using gDNA extracted from Ca. M. mitochondrii positive I. holocyclus controls...... 43 Figure 3.4:16S Assay 5 amplification using gDNA extracted from Ca. M. mitochondrii positive I. holocyclus controls...... 43 Figure 3.5: Agarose gel electrophoresis of 16S Assay 1 PCR products...... 45 Figure 3.6: Agarose gel electrophoresis of GltA PCR products...... 45 Figure 3.7: Agarose gel electrophoresis of GyrB PCR products...... 46 Figure 3.8: Agarose gel electrophoresis of 16S Assay 5 PCR products...... 46

viii Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii Figure 3.9: Phylogenetic tree of 1332 bp 16S rRNA sequences produced by 16S Assay 5...... 50 Figure 3.10: Phylogenetic tree of 1051 bp 16S rRNA sequences produced by 16S Assay 5...... 51 Figure 3.11: Phylogenetic tree of 143 bp 16S rRNA sequences produced by 16S Assay 1...... 52 Figure 3.12: Phylogenetic tree of 126 bp GltA sequences...... 53 Figure 3.13: Phylogenetic tree of 147 bp GyrB sequences...... 54 Figure 3.14: Phylogenetic tree of the 1593 bp concatenated GltA, GyrB and 16S rRNA sequences...... 55 Figure 3.15: Intact I. holocyclus section stained with H&E ...... 57 Figure 3.16: 20X magnification of I. holocyclus ovary and oocyte stained with H&E stain...... 58 Figure 3.17: H&E stain of tick sections...... 59 Figure 3.18: I. holocyclus spatial morphology...... 60 Figure 3.19: Fluorescent microscopy of I. holocyclus sections showing oocytes and ovary at the posterior region of the female I. holocyclus tick...... 60 Figure 3.20: Fluorescent microscopy of the I. holocyclus oocyte/ovaries...... 61 Figure 3.21: Overlay of DAPI and Ca. M. mitochondrii in the female I. holocyclus ovary...... 62 Figure 3.22: I. holocyclus sections showing midgut and salivary glands...... 63

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii ix List of Tables

Table 1: Tick species and bacterial symbionts...... 4 Table 2: Taxonomic classification of Ca. M. mitochondrii ...... 10 Table 3: Taxonomy classification of ticks ...... 15 Table 4: I. holocyclus gDNA for positive controls ...... 28 Table 5: Target gene loci and primers used in this project...... 30 Table 6: Best-fit nucleotide substitution model for each gene locus ...... 32 Table 7: Probes used to develop FISH protocol...... 33 Table 8: Dehydration of fixed I. holocyclus ...... 35 Table 9: EtOH/ Chloroform treatments of dehydrated I. holocyclus ...... 35 Table 10: Paraffin infiltration of I. holocyclus ...... 36 Table 11: Protocol 1 - Deparaffinization of sections ...... 37 Table 12: Protocol 2 - Deparaffinization of sections ...... 37 Table 13: Post-hybridization slide washing sequence ...... 38 Table 14: DAPI stain procedure ...... 38 Table 15: Haematoxylin and Eosin (H&E) staining protocol...... 39 Table 16: NCBI BLAST results for merged sequences generated from Ca. M. mitochondrii positive samplesgenerated from 16S Assay 5...... 44 Table 17: Man1. Sequences identity...... 47 Table 18: Man2. Sequences identity...... 48 Table 19: Man3. Sequences identity...... 49

x Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii List of Abbreviations

Abbreviations Disambiguation °C Degrees Celsius µL Microlitre µm Micromole 16S 16S bacterial rRNA gene 3’ Hydroxy-terminus of the DNA fragment 5’ Phosphate terminus of the DNA fragment AGRF Australian Genome Research Facility APC Antigen presenting cell AUD Australian Dollar (currency) BIC Bayesian Information Criterion BLAST Basic local alignment search tool bp Base pairs (of nucleotides) DAPI “4ʹ,6-diamidino-2-phenylindole” DNA stain DNA Deoxyribonucleic acid dNTP Deoxynucleotide triphosphate DNA DSCATT Debilitating symptom complexes attributed to ticks DTT Dithiothreitol EtOH Ethanol FISH Fluorescence in-situ hybridisation gDNA Genomic DNA GTR General Time Reversible (nucleotide substitution model) H&E Haematoxylin and Eosin (histological stain) hr Hour (time) Ig Immunoglobulin IL Interleukin K2 Kimura 2-parameter (nucleotide substitution model) MEGA Molecular Evolutionary Genetic Analysis software MHC Major histocompatibility complex mg milligrams

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii xi Abbreviations Disambiguation

MgCl2 Magnesium chloride

min Minute mL Millilitre mM Millimolar MMLV Mitochondrion-membrane-limited vacuoles mt Mitochondrial NaCl Sodium chloride NCBI Nation Centre for Biotechnology Information NHMRC National Health and Medical Research Council ng nanograms nM Nanomolar PBS Phosphate-buffered saline PCR Polymerase chain reaction PRR Pattern recognition receptor RM Rickettsia-like microorganism(s) RNA Ribonucleic acid rpm Revolutions per min rRNA Ribosomal RNA s Second SCC Saline-sodium citrate (buffer) sp./spp. Species singular/plural Taq Thermus aquaticus DNA polymerase TBD Tick-borne disease TEM Transmission electron microscopy TLR Toll-like receptor USD United States Dollar (currency) v/v% Volume for volume percentage concentration

xii Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Chapter 1: Introduction

Ticks are a major global health concern because they are responsible for both transmitting infectious pathogens and directly causing non-infectious diseases such as flaccid paralysis, local cutaneous reactions and severe anaphylaxis (Stone et al., 1989; van Nunen, 2018; Dehhaghi et al., 2019). Ticks also transmit the greatest diversity of pathogenic microorganisms than other vector groups, and are only second to mosquitoes as a significant microbe-transmitting haematophagous arthropod to humans (Jongejan and Uilenberg, 2004; Dehhaghi et al., 2019). Of interest to the local scientific and medical community in Australia are ticks with the propensity to directly cause tick-borne diseases (TBD), such as Ixodes holocyclus, located along the east coast of Australia, which has been demonstrated to transmit infectious agents, result in non-infectious flaccid paralysis (Stone et al., 1989), hypersensitivities to red meat and anaphylactic reactions (van Nunen, 2015, 2018) in humans.

In addition to the physical burden of disease, the Centers for Disease Control (CDC) in the United States found that for the over 50,000 patients diagnosed with Lyme Borreliosis, annual individual healthcare costs was USD 3,000 more than healthy matched controls (Adrion et al., 2015). In Australia, there is no evidence of locally acquired Lyme Borreliosis, yet approximately 22,000 people reported to be living with symptoms similar to patients diagnosed with Lyme Borreliosis overseas (Australia. Department of Health, 2017, 2018b; Department of Health, 2018a). While epidemiological data are as yet unavailable, over 1,200 submissions from medical and veterinary professions, scientific experts, patients and general public resulted in a smaller scale Senate Inquiry involving over 349 Australian public patients showed that the average out-of-pocket cost incurred were over AUD 42,000 per patient (Lyme Disease Association of Australia, 2012; Australia. Department of Health, 2018b).

In North America, the late Wilhelm Burgdorfer identified the spirochete, Borrelia burgdorferi as the causative agent for Lyme Borreliosis in 1982 (Burgdorfer et al., 1982). Subsequently, other tick-borne bacterial pathogens that cause significant morbidity and mortality in humans, such as Ehrlichia chaffeensis and Anaplasma phagocytophilum, were identified in the 1990s (Anderson et al, 1991; Chen et al,

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 1 1994). Ongoing research efforts in the Northern Hemisphere have uncovered various vital information on the transmission dynamics, tick-vector range, pinpointed several mammal host species that serve as reservoirs, as well as characterised clinical manifestations and produced treatment protocols (Paules et al, 2018). However, TBD research in Australia is less well understood and initial research on the hosts of I. holocyclus, common name “the paralysis tick” occurred decades ago (Roberts, 1970; Piesman and Stone, 1991; Lydecker et al., 2015). Deemed to be the most likely transmission vector for B. burgdorferi due to the tick’s geographical spread overlapping with “Lyme-like illnesses” patient addresses and sharing the same genus as the North American vector for Lyme Borreliosis, I. holocyclus was subjected to vector competence studies with a North American isolate of B. burgdorferi (Piesman and Stone, 1991). The failure of B. burgdorferi to establish infections in any of the 84 I. holocyclus nymphs that were fed the spirochetes as larvae, suggests that I. holocyclus were incompetent as hosts and vectors of the causative agents of Lyme Borreliosis.

Efforts to identify an Australian causative agent of Lyme Borreliosis resulted in the morphological identification of spirochetes in blood films of bandicoots in 1959, presence of spirochete-like objects in multiple native tick species in the 1990s and molecular identification of a novel Borrelia species in native ticks of echidnas in 2016 (Mackerras, 1959; Wills and Barry, 1991; Loh et al., 2016), However, the causative agents of debilitating symptom complexes attributed to ticks (DSCATT) remains elusive, prompting the Australian Government to launch a national inquiry to research DSCATT in Australia (Collignon et al., 2016; NHMRC, 2018; Australia. Department of Health, 2018b). Despite the absence of the causative agent of Lyme Borreliosis in Australia, over 500 reports of Australian DSCATT were published in scientific literature and thousands of people continue to present at medical establishments for medical treatment (Chalada et al., 2016; NHMRC, 2018).

In the remainder of Chapter One, a literature review would be carried out on the existing research on Ca. M. mitochondrii and its reservoir invertebrate, ticks, including the Australian native I. holocyclus, and to briefly provide context on the human immune response to tick bites. The scope of this honours thesis is to explore Ca. M. mitochondrii, a known endosymbiont. Therefore other tick-borne pathogens and TBD will not be discussed in detail but a more comprehensive review on human TBD in Australia can be perused for more information (Dehhaghi et al., 2019).

2 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

1.1 TICK MICROBIOME

Ticks are not the only invertebrates to harbour symbionts, but they harbour the largest diversity of microorganisms of viral, protozoan and bacterial origins when compared to other blood-sucking arthropods. These microbes form a tick’s microbiome, which can include commensals, pathogens or symbionts (Singh and Girschick, 2003; Plantard et al., 2012; Greay et al., 2018). Tick-borne viral pathogens include tick-borne encephalitis virus, Japanese encephalitis virus and yellow fever virus, while tick-borne protozoan pathogens include Babesia divergens and Babesia microti (Singh and Girschick, 2003). Tick-borne bacterial pathogens include Anaplasma phagocytophilum, Borrelia burgdorferi, Ehrlichia chaffeensis and Francisella tularensis (Sanogo et al., 2003; Burgdorfer et al., 1982; Hartelt et al., 2004; Dumler and Bakken, 1995; Petersen et al., 2009). Moreover, a single tick can be co-infected by and vector the transmission of numerous microorganisms with complex three-way interactions between microbial species, tick physiology and immune modulations of hosts parasitised by ticks (Singh and Girschick, 2003; Haine, 2008; Francischetti et al., 2009).

In Australia, an increasing number of patients have presented with persistent symptoms similar to Lyme Borreliosis but there is no evidence that native ticks harbour the causative agent, Borrelia burgdorferi sensu lato (Russell et al., 1994; Gofton et al., 2015b). Furthermore, I. ricinus and other Ixodes ticks, that share the same monophyletic clade from the Northern Hemisphere, responsible for transmitting Lyme Borreliosis, are not found in Australia (McCann et al., 2019). Moreover, studies that deliberately attempted to infect I. holocyclus nymphs with B. burgdorferi failed to demonstrate that I. holocyclus was a competent vector of the spirochete (Piesman and Stone, 1991).

1.1.1 Tick endosymbionts Endosymbionts are commonly the most abundant bacteria harboured by arthropod hosts, such as ticks, and are typically regarded as microorganisms residing on hosts that do not directly cause disease in vertebrates (Noda et al., 1997; Sacchi et al., 2004; Beninati et al., 2004, 2009; Plantard et al., 2012). An example of a widespread obligate endosymbiont of arthropods and helminth parasites is the

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 3 bacterium Wolbachia, found naturally in ticks such as I. ricinus, filarial nematodes and endoparasitoid wasps such as Ixodiphagus hookeri, which can drastically modulate the reproductive capabilities of the host and are used to as a biological suppressant of mosquito-borne disease (Taylor et al., 2005; Hughes et al., 2011; Iturbe-Ormaetxe et al., 2011; Plantard et al., 2012; Greay et al., 2018).

Several pathogenic bacterial species also have a genetically related endosymbionts, which reside within the tick; such as Coxiella spp., Rickettsia spp., Francisella spp., Wolbachia spp. and Candidatus Midichloria mitochondrii (Table 1) (Cowdry, 1925; Noda et al., 1997; Ahantarig et al., 2013). Furthermore, there is now scientific evidence which suggests symbionts can be transmitted by ticks. Researchers have also demonstrated mammalian immune responses to symbionts that were thought to be harmless and microbial interaction with other pathogens also harboured by the tick that interferes with the propensity to cause pathogenicity in humans and other mammals (Noda et al., 1997; Haine, 2008; Gofton et al., 2015a; Cafiso et al., 2019). The increasing evidence of transmission and infection of tick-bitten mammals by endosymbionts such as Ca. Midichloria mitochondrii challenge the dogma around TBD and the benign role endosymbionts play.

Table 1: Tick species and bacterial symbionts. (Ahantarig et al., 2013) Tick species Bacterial endosymbiont Dermacentor variabilis^ Arsenophonus sp. Francisella-like endosymbiont Rickettsia montanensis Rickettsia bellii Haemaphysalis longicornis* Coxiella-like bacteria Ixodes holocyclus* Ca. Midichloria mitochondrii Ixodes ricinus^ Wolbachia sp. Rickettsia monacensis Rickettsia sp. Ca. Midichloria mitochondrii Rhipicephalus sanguineus* Wolbachia sp. Coxiella-like bacteria Rickettsia sp. * Tick observed in Australia; ^Tick observed outside of Australia

4 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

1.2 CANDIDATUS MIDICHLORIA MITOCHONDRII

The presence of rickettsia-like microorganisms (RMs), localised in ovarian tissues of the Northern Hemisphere tick, Ixodes ricinus, was identified in 1979 while conducting an ultrastructural study on the causative agent of tick-borne fever (TBF) (Lewis, 1979). With transmission electron microscopy (TEM), the morphology of these novel RMs and their high affinity for the mitochondria of the I. ricinus tick ovarian tissue were described (Lewis, 1979). In Fig. 1.1, Ca. M. mitochondrii (indicated by three arrows) can be observed enclosed within the membranes of mitochondria (M) in a section through a developing oocyte of an adult female I. ricinus (Lewis, 1979).

Figure 1.1: TEM of RMs (arrows) within the mitochondria of developing I. ricinus oocyte (Lewis, 1979).

Subsequently, a study on borreliosis in 1992 observed that the abundance of Ca. M. mitochondrii increased exponentially, in conjunction with ovarian cells, in nymphs between day 15 and 21 and appeared to progressively gravitate from the cytosol toward membrane-bound organelles, especially the mitochondria (Zhu et al, 1992). Despite complete decimation of the contents of some ovarian mitochondria for its own replication, tick oogenesis did not appear to be negatively affected by the presence of Ca. M. mitochondrii (Sacchi et al., 2004). The widespread availability of more

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 5 advanced molecular techniques led to Ca. M. mitochondrii being analysed with PCR and sequencing studies to determine that phylogenetically, Ca. M. mitochondrii are alpha-proteobacteria, within the recently reorganised order of Rickettsiales (Dumler et al., 2001; Beninati et al., 2004). In 2006, ‘Candidatus Midichloria mitochondrii’ was proposed as the yet unnamed divergent RM, after the fictional Star Wars endosymbionts known as the “Midichlorians” that were the basis of “The Force”; while the second part of the binomial name, ‘mitochondrii’ was in reference to the intramitochondrial localisation of the bacterium (Sassera et al., 2006). Apart from being ubiquitous in the family of hard ticks (Ixodidae), a number of which are capable of biting humans, Ca. M. mitochondrii has also been demonstrated recently in one member of the soft tick (Argasidae) family (Cafiso et al., 2016).

1.2.1 Tropism The gram-negative Ca. M. mitochondrii bacteria consistently exhibit mitochondrial-tropism and typically localise in clusters, enclosed within mitochondrion-membrane-limited vacuoles (MMLVs) (Sassera et al., 2006). In wild- type female adults, larvae and nymph of I. ricinus ticks, various other tick tissues such as ovarian epithelium and ooplasm, Ca. M. mitochondrii were observed to be sparsely distributed (Lewis, 1979; Zhu et al., 1992; Sassera et al., 2006). Ca. M. mitochondrii had also been consistently detected in the salivary glands of wildtype I. ricinus in a variety of molecular and microscopy techniques (Mariconti et al., 2012b; Di Venere et al., 2015; Cafiso et al., 2019).

The tendency of Ca. M. mitochondrii to exist in such host-derived membranes is reminiscent of the origin of the mitochondrial outer membrane which allowed the ancestral mitochondria to assimilate into the host cell (Sacchi et al., 2004). While the similarity on the outer membrane of Ca. M. mitochondrii and mitochondria can partly explain how these Ca. M. mitochondrii are able to gain access into the mitochondria (Sacchi et al., 2004), it is unknown if the capability of Ca. M. mitochondrii to traverse the cellular environment to invade mitochondria is attributed to flagellar-dependent motility, as the free-living mitochondrial ancestor and closely related Rickettsiales are regarded as non-motile microorganisms, i.e. lacking a flagellar apparatus (Sassera et al., 2011).

6 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Despite the high prevalence of Ca. M. mitochondrii within the mitochondria of I. ricinus oocyte, the tropism of the Australian Ca. M. mitochondrii within I. holocyclus has been observed to exclude the mitochondria (Fig 1.2) (Beninati et al., 2009). The mitochondrial diameter of engorged I. holocyclus, measured at approximately 0.2 �m, is significantly smaller than those found in I. ricinus, at similarly engorged states, which commonly measure larger than 1.0 �m in diameter when not harbouring Ca. M. mitochondrii (Beninati et al., 2009). However, it is unknown if the smaller mitochondrial diameter in the oocytes of I. holocyclus is a factor that prevents Ca. M. mitochondrii from gaining entry as the larger mitochondria of I. ricinus oocytes are prevalent with the bacteria (Beninati et al., 2009).

Figure 1.2: TEM of Ca. M. mitochondrii(arrows) outside the mitochondria (arrowheads) of a) I. holocyclus developing oocyte; b-c) I. holocyclus ovaries. (Beninati et al., 2009)

1.2.2 Morphological characterisation techniques of tick microbiome A range of laboratory techniques has been performed to characterise the spatial distribution of Ca. M. mitochondrii and other bacteria within ticks non-native to Australia, which include whole mount fluorescent in-situ hybridisation (FISH) (Epis et al., 2013), in-situ hybridisation (ISH) (Beninati et al., 2004) and indirect immunofluorescence assay (Mariconti et al., 2012a). In Australia, TEM has been utilised to specifically investigate dissected tick ovaries to determine if Ca. M. mitochondrii were located inside the mitochondria of I. holocyclus ovaries (Beninati et al., 2009) but the overall distribution of Ca. M. mitochondrii in Australian native I. holocyclus remain to be investigated.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 7 1.2.3 Morphology Ca. M. mitochondrii are as coccoid bacteria with a diameter measuring between 0.2 �m to 1.0 �m (Lewis, 1979), bacilloid (Sassera et al., 2006) or spindoid (Zhu et al., 1992) with tapering ends, with lengths measuring between 0.6 �m and 2.5 �m. In Fig. 1.3, two bacteria, can be observed within a partially vacuolated mitochondrion, possessing an inner plasma membrane, encased in a densely undulated outer cell wall (Zhu et al., 1992; Sassera et al., 2011). The double membrane structure measures approximately 6nm to 10nm in thickness and have not been imaged to include a flagellar apparatus in Fig. 1.3 (Sassera et al., 2011) despite indirect immunofluorescence assays, targeting the flagellar protein FliD, staining positive (Fig. 1.4) (Mariconti et al., 2012a).

Figure 1.3: Mitochondrial matrix (m) with Ca. M. mitochondrii bacteria (b). (Sassera et al, 2011) A) Ca. M. mitochondrii bacteria between the mitochondrial membrane (arrows) at initial stages of invasion; B) 2 Ca. M. mitochondrii bacteria within a mitochondrion.

8 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 1.4: Indirect immunofluorescence assay of I. ricinus ovaries (Mariconti et al., 2012) (i) FIT-C stained FliD, (ii) MitoTracker Red stained live mitochondria, (iii) TOTO-3 iodide cell viability nuclei stain and (iv) combined immunofluorescence of images (i)-(iii).

1.2.4 Genome, Taxonomy and Phylogeny The Ca. M. mitochondrii genome has a circular chromosome of 1,183,732 bp (Sassera et al., 2011). Similar to other microorganisms in the same order, Ca. M. mitochondrii include genes that encode for protein secretion systems and a variety of membrane-associated proteins, which is speculated to assist in the invasion of the mitochondria membrane (Sassera et al., 2011). The Ca. M. mitochondrii genome also includes genes that code for biosynthetic pathways responsible for the synthesis of amino acids and nucleotides in comparison to other free-living bacteria in the same class (Sassera et al., 2011). The suppression of genes that encode for biosynthetic pathways is also mirrored in other alphaproteobacteria, such as obligate intracellular Rickettsia (Sassera et al., 2011) and the bacteroid form of rhizobia after invasion and establishing endosymbiosis with target host legumes (Poole et al., 2018).

Ca. M. mitochondrii belong to the domain of bacteria, diverse proteobacteria phylum of gram-negative bacteria, and alphaproteobacteria class of oligotrophs that can thrive in nutrient-poor environments (Sassera et al., 2006). The order Rickettsiales, that Ca. M. mitochondrii is part of, comprise obligate intracellular microorganisms that require a host cell to complete part of the lifecycle (Sassera et al., 2006). Since

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 9 2006, molecular characterisation had necessitated the novel Family Midichloriaceae within the order of Rickettsiales, of which Ca. M. mitochondrii is assigned to (Sassera et al., 2006). The taxonomic classification of Ca. M. mitochondrii is summarised in Table 2. Furthermore, phylogenetic analysis on the basis of 88 conserved genes encoding single-copy proteins from over 60 representative bacteria clearly delineates the phylogenetic separation of Ca. M. mitochondrii from other bacteria from the order Rickettsiales (Fig. 1.5) (Sassera et al., 2006).

Table 2: Taxonomic classification of Ca. M. mitochondrii (Sassera et al., 2006) Domain Bacteria

Phylum Proteobacteria

Class Alphaproteobacteria

Subclass Rickettsidae

Order Rickettsiales

Family Midichloriaceae

Genus Ca. Midichloria

Species mitochondrii

10 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 1.5: Phylogenetic analysis of representatives of alphaproteobacteria based on 88 conserved proteins (Sassera et al., 2011).

1.2.4.1 Putative Flagella genes The flagellar apparatus is an ancient motility system that was present before the lineage of prokaryotes separated from archaebacteria and were known to exist on all ancestors of alphaproteobacteria (Toft and Fares, 2008; Sassera et al., 2011). Although energetically costly to maintain, the motility afforded, to swim away from undesirable environments and towards resources, more than compensates for the metabolic costs it required to maintain them, in a free-living environment (Toft and Fares, 2008). However, the establishment of intracellular lifestyles in microorganisms has resulted in a reduction of the genome where certain proteins and metabolic pathways which are not cost-effective are ceased, as an adaptation from a free-living lifestyle (Andersson et al., 1998). Upon adopting an intracellular lifestyle, the motility function of the flagellar apparatus was made redundant and resulted in the gradual loss of flagellar genes in Rickettsiales (Sassera et al., 2011). While most endosymbionts do not retain the flagellar gene, symbionts such as Wigglesworthia glossinidia has maintained the majority of flagellar genes to enable vertical transmission (Toft and Fares, 2008). Although TEM of Ca. M. mitochondrii morphology was not able to demonstrate the presence of a flagellar apparatus, immunofluorescence assays identified flagellar protein FliD, and molecular studies demonstrated 26 genes that encode for putative

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 11 flagellar proteins in the genome of Ca. M. mitochondrii contains (Sassera et al., 2011; Mariconti et al., 2012a). The absence of a flagellum on Ca. M. mitochondrii in previous TEM studies could also suggest a lifecycle of Ca. M. mitochondrii that has eluded scientific investigations thus far (Figs. 1.1 – 1.3) (Lewis, 1979; Zhu et al., 1992; Sassera et al., 2011). An alternative consideration is adaptation and retention of some of these flagellar proteins to function as the interfacing exporter protein to barter metabolites between Ca. M. mitochondrii and its host cell, forming the basis of an intimate mutualism (Toft and Fares, 2008).

Based on conserved flagellar proteins, Ca. M. mitochondrii diverged from the lineage of early alphaproteobacterial ancestors that were all flagellated (Fig. 1.6) (Sassera et al., 2011). The presence of flagellar genes and transcribed proteins in the Ca. M. mitochondrii could present a unique target in laboratory protocols to differentiate from other closely related and morphologically similar Rickettsiales which lack flagellar genes and proteins (Mariconti et al., 2012a).

Figure 1.6: Phylogenetic analysis of representative proteobacteria based on conserved flagellar proteins (Sassera et al., 2011).

1.2.4.2 Putative cbb3 oxidase genes

The cbb3 heme-copper oxidase possessed by Ca. M. mitochondrii is less efficient at the reduction of O2 than the oxidases generally associated with other Rickettsiales

(Sassera et al., 2011). However, the cbb3 heme-copper oxidase compensates by

12 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

possessing a higher affinity for O2 and hence is suited for a microaerobic environment (Sassera et al., 2011). This quality of thriving in a low oxygen environment is exploited by pathogenic proteobacteria to establish colonies in microaerobic host tissues that prove unsuitable for other aerobic bacteria (Sassera et al., 2011). Since the process of tick oogenesis has a high oxygen demand, which leads to low oxygen concentration in the local environment, the possession of the cbb3 oxidase that works optimally at oxygen concentrations that are below the optimum for the tick mitochondrion to synthesize ATP, suggests that Ca. M. mitochondrii could provide an additional supply of ATP to its tick hosts during oogenesis (Sassera et al., 2011).

Phylogenetic analysis based on the of Ca. M. mitochondrii cytochrome cbb3 oxidase and its assembly-associated proteins, which are absent in other Rickettsiales, demonstrate a topography that supports the early divergence of Ca. M. mitochondrii from the monophyletic alphaproteobacterial clade (Fig. 1.7) (Sassera et al., 2011).

Figure 1.7 : Phylogenetic analysis based on cbb3 proteins (Sassera et al., 2011).

1.2.5 Prevalence of Ca. M. mitochondrii in Ixodes ticks. In wildtype female ixodids, such as I. ricinus and I. holocyclus, the prevalence of Ca. M. mitochondrii is 100% in primordial oocytes, suggesting transovarial and transstadial transmission within female organs (Zhu et al., 1992; Beninati et al., 2009). Despite transovarial transmission of the endosymbiont to all offspring, as male ticks

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 13 lack female reproductive organs which is the preferred tissue to support the growth of Ca. M. mitochondrii, transstadial transmission and the establishment of consistent Ca. M. mitochondrii populations can be impeded (Beninati et al., 2009). Hence, the discordance in infection rates of Ca. M. mitochondrii in male ixodid ticks suggest an alternative horizontal route of transmission, such as feeding from a wildlife reservoir or concurrently parasitising hosts with ticks harbouring Ca. M. mitochondrii, to replenish the bacterial load in these ticks (Beninati et al., 2009).

1.3 TICKS

Globally, approximately 900 recognised species of ticks exist as of 2019, and it is estimated that one in ten tick species are directly responsible for detrimental effects on the parasitised vertebrate hosts (Jongejan and Uilenberg, 2004; Guglielmone et al., 2010; Dehhaghi et al., 2019).

1.3.1 Phylogenetic classifications of Ticks Ticks and mites, from the subclass of Acari, form a divergent lineage from other members of class Arachnida, like spiders and scorpions, as they adapted from a scavenging/predatory to a parasitic lifestyle (Mans and Neitz, 2004). Within Acari, ticks are further classed into the order of Ixodida, which are classified into three extant families; Argasidae (soft ticks), Ixodidae (hard ticks) and Nuttalliellidae (Table 3) (Nava et al., 2009). The Ixodidae family include genera Amblyomma, Anomalohimalaya, Boophilus, Bothriocroton, Cosmiomma, Dermacentor, Haemaphysalis, Hyalomma, Margaropus, Nosomma, Rhipicentor, Rhipicephalus and Ixodes (Fig. 1.8) (Barker and Murrell, 2004). The Argasidae comprise Argas, Ornithodoros, Carios and Otobius, while the Nuttalliellidae family comprise a single species, Nuttalliella namaqua (Fig. 1.8) (Barker and Murrell, 2004; Nava et al., 2009). This project endeavours to characterise the putative transmission of Ca. M. mitochondrii to humans by Ixodes ticks; hence, the remainder of this literature review will focus on the characteristics of the genus Ixodes.

14 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Table 3: Taxonomy classification of ticks (Barker and Walker, 2014).

Domain Eukarya

Kingdom Animalia

Phylum Arthropoda

Subphylum Chelicerata

Class Arachnida

Subclass Acari

Order Ixodida

Argasidae Family Ixodidae Nuttalliellidae

Figure 1.8: Phylogenetic classification of Ixodidae families (Barker & Murrell, 2004).

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 15 1.3.2 Australian Ticks Within Australia, there are 74 formally described species of ticks, of which, 17 are capable of biting companion animals, livestock and humans (Dehhaghi et al., 2019;

Barker and Walker, 2014). Tick species such as I. holocyclus and I. australiensis can result in non-infectious morbidity, such as paralysis and hypersensitivity reactions, including mammalian meat allergy (Dehhaghi et al., 2019; van Nunen, 2018). With repeated exposure to tick-related antigen, the severity of hypersensitivity symptoms could increase in severity, mediated by the immunoglobulin E (IgE) primed innate mast cells and basophils, which could result in a potentially lethal Type I hypersensitivity reaction, known as anaphylaxis (Ribeiro, 1987; Francischetti et al., 2009; da Silva et al., 2014; van Nunen, 2018). Endemic species such as I. holocyclus, Amblyomma triguttatum, Bothriocroton hydrosauri and Haemaphysalis novaeguineae are directly responsible for the transmission of Coxiella burnetii, to maintain the sylvatic transmission cycle; Rickettsia honei, the causative agent of Flinders Island spotted fever; and Rickettsia australis, the causative agent of Queensland tick typhus (Dehhaghi et al., 2019). These listed pathogens transmitted by Australian ticks is intended to provide a context and is by no means exhaustive; therefore, the remainder of this introduction will focus on the Australian paralysis tick, I. holocyclus.

1.3.3 Ixodes holocyclus Ixodes holocyclus occupies a geographical range spanning thousands of kilometres along coastal areas from North to Eastern Australia, (Fig. 1.9) (Gofton et al., 2015a; b; Greay et al., 2016). As a known harbinger of pathological conditions, such as envenomation of holocyclotoxin leading to paralysis, to both humans and animals, as well as occupying highly populated areas, I. holocyclus is undoubtedly the tick with the most medical and veterinary significance in Australia (Gofton et al., 2015).

16 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 1.9: (A) I. holocyclus tick and (B) the approximate geographical range shaded (Barker and Walker, 2014; Greay et al., 2016).

1.3.4 Lifecycle of I. holocyclus The lifecycle of I. holocyclus, which comprises the egg, larvae, nymph and the sexually dimorphic adult instar, can range from a few months to three years but can be affected by environmental factors and the type and scarcity of a suitable host (Parola and Raoult, 2001). Being three-host obligate haematophagous arthropods, I. holocyclus require three individual blood-hosts to feed to repletion, moult in order to progress towards the next instar, until sexual maturity is achieved (Barker and Walker, 2014). While adult males feed sporadically, adult females require a substantial blood meal to engorge with blood before laying eggs (Parola and Raoult, 2001). While more than 40 species of mammals and birds have been reported as hosts for I. holocyclus, bandicoots are the principal hosts necessary for the maintenance of its population through seasons (Barker and Walker, 2014). Once fed, adult I. holocyclus detach from the host and engage in mating activities in the grassy nests of bandicoots (Barker and Walker, 2014), after which the gravid female would deposit her several thousand eggs, transovarially transmitting Ca. M. mitochondrii within primordial reproductive tissue of its progenies before dying (Parola and Raoult, 2001; Beninati et al., 2004; Lo et al., 2006). The lifecycle of I. holocyclus based on instars is shown in Fig. 1.10, where humans are an unintended host for the adult female (van Nunen, 2018).

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 17

Figure 1.10: Lifecycle of I. holocyclus in stages (Doggett, 2015).

1.4 HISTOLOGICAL FEATURES OF I. HOLOCYCLUS INTERNAL ANATOMY

In addition to determining species, instar and sex, microscopy can also be used to investigate and identify internal anatomical features. Some distinguishing features of the reproductive system of female adult ixodid ticks will be discussed in the following section to provide relevant histological landmarks for microscopy analyses. The position of large structures like the salivary glands and the midgut are also briefly highlighted for orientation when carrying out microscopy work.

The internal anatomy of a tick is comprised of three large organ systems: salivary glands, reproductive and digestion systems. The reproductive system comprises the conspicuous tubular ovaries, oviduct, uterus, tubular accessory glands and seminal receptacle; the digestion system comprises a midgut that can occupy a substantial portion of the tick when fed to engorgement, midgut stomach and rectal sac; the salivary glands, type I- IV, are numerous and dynamic, and perform various vital functions such as osmoregulation, and the secretion of immune and pain modulators to evade detection by the bitten host (Fig. 1.11) (Sonenshine and Roe, 2013).

18 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 1.11: Adapted illustration of internal anatomy of female ixodid tick. (Sonenshine and Roe, 2013). Mid-gut (MG) shaded red, Ovary (OV) shaded yellow, Oviduct (shaded green), longitudinal groove of the ovary (shaded orange) and salivary glands (shaded blue).

1.4.1 The female reproductive organs of ixodid ticks. The ixodid female reproductive organ consists of a single convoluted, tubular U- shaped ovary, located at the posterior part of the female tick, where both ends of the ovary extend toward the anterior of the tick and are connected to a single uterus via paired oviducts (Fig. 1.12) (Sonenshine and Roe, 2013). (Beninati et al., 2004). Ixodid oocytes go through five distinct stages before oviposition, with Stage I – IV being still attached to the ovarian wall via the pedicel cell and ovulation into the ovarian lumen being characteristic of progression into a stage V oocyte (Fig.1.13). Digoxigenin- labelled probes targeting Ca. M. mitochondrii in Fig. 1.14 clearly outline the morphology of the oocytes as they project into the lumen of the ovary still attached via pedicel cells

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 19

Figure 1.12: Adapted illustrations of the female reproductive system in ixodid ticks (Sonenshine and Roe, 2013). a) Ovary (shaded yellow), oviduct (shaded green), longitudinal groove (shaded orange), and oocytes (shaded pink); b) transverse-section of ovarian lumen (lu) surrounded by epithelia (ep) with various maturation stages of oocytes (I – V). More immature oocytes have visible germinal vesicles (gv) as the accumulation of vitellogenic granules increasingly obscure the oocyte gv.

Figure 1.13: Adapted illustrations on the development of oocytes (Sonenshine and Roe, 2013).

Figure 1.14: Ovarian tissue, showing oocytes (arrows) labelled by probes viewed by light microscopy under a) smaller magnification and b)greater magnification (Beninati et al., 2004).

20 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

1.5 EVIDENCE FOR CA. M. MITOCHONDRII TRANSMISSION

Vector competence depends on the establishment of viable and stable populations of the microorganism within the tick as well as a mode for the transmission into a host (Piesman and Stone, 1991). A FISH assay on I. ricinus ticks with fluorescently labelled probes targeting Ca. M. mitochondrii was able to demonstrate strong signals from the ovaries of I. ricinus larva, nymph and adult female, supporting the concept of transovarial and transstadial transmission in females that give rise to stable endosymbiont populations (Fig. 1.15) (Epis et al., 2013). Presence of Ca. M. mitochondrii was confirmed in the salivary glands of I. ricinus via qPCR of dissected salivary glands and indirect immunofluorescence assays, placing the bacteria in a location that could be inoculated into the vertebrate host when biting ticks regurgitate during engorgement (Fig. 1.16) (Mariconti et al., 2012b; Cafiso et al., 2019). In humans bitten by I. ricinus, seropositivity against a recombinant Ca. M. mitochondrii antigen was close to 50 times more prevalent than humans not parasitised by I. ricinus ticks (Mariconti et al., 2012b). Subsequently, rabbits experimentally infested with Ca. M. mitochondrii-positive I. ricinus ticks seroconverted against the Ca. M. mitochondrii flagellar protein rFliD within a week of exposure and Ca. M. mitochondrii DNA was detectable during molecular analyses of the parasitised rabbit blood samples for up to 16 weeks post infestation, which supports the likelihood of successful replication of the bacteria within the mammalian host (Cafiso et al., 2019).

The evidence on transmission of Ca. M. mitochondrii to mammalian hosts via a tick bite is increasing. Furthermore, Ca. M. mitochondrii, first identified in I. ricinus, has been demonstrated to also colonise I. holocyclus (Beninati et al., 2009). In preliminary unpublished next-generation sequencing data by the Vector and Waterborne Pathogens Group, the presence of Ca. M. mitochondrii DNA in both the human tick-bitten patient and the concurrently biting I. holocyclus tick was identified. While Ca. M. mitochondrii signals are expected to localise around ovarian tissue, signals are not expected to merge with mitochondria because unlike the intramitochondrial lifestyle of the Ca. M. mitochondrii harboured by I. ricinus in the Northern Hemisphere, the bacterium appeared to be within oocytes but were not observed to be within the mitochondrial matrix (Beninati et al., 2009). It remains to be established if the smaller mitochondrial diameter of the I. holocyclus oocyte, at approximately 0.2µm, is a barrier for invasion by Ca. M. mitochondrii; Ca. M.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 21 mitochondrii were observed to readily occupy the larger oocyte mitochondria of I. ricinus, which measure approximately 1.0µm, even when not containing any bacteria (Beninati et al., 2009).

Figure 1.15 : FISH of whole mount I. ricinus larvae to detect Ca. M. mitochondrii (Epis et al., 2013). Probes specific to Ca. M. mitochondrii were used. (A) I. ricinus larvae light transmission image. (B) Hybridisation of Cy-5 labelled 16S rRNA probes targeting Ca. M. mitochondrii, fluorescent foci (arrow)(C) Autofluorescence. (D) Hybridisation of I. ricinus mitochondria 12S rRNA probes. (E) MitoTracker Red to demonstrate mitochondrial vitality. (F) Primordial ovary magnified, yellow signal for mitochondria and pink for mitochondria overlayed. Detection of mitochondria and Ca. M. mitochondrii signals (box); only mitochondrial signal (arrows).

22 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 1.16: Indirect immunofluorescence assay on salivary glands of I. ricinus ticks (Mariconti et al., 2012b). a) FitC-labelled antibodies against rFliD of Ca. M. mitochondrii in green; b) MitoTracker live mitochondria stain in red.; c) TOTO-3 iodide cell viability nuclei stain in blue; d) Merge of image a-c.

1.6 HUMAN IMMUNOLOGIC RESPONSE TO A TICK BITE

During a tick bite, the piercing mouthparts, comprising the hypostome and cheliceral sheaths, penetrate the mammalian skin, bypassing the anatomical and physiological barrier of the integument system (Kazimirova and Stibrániová, 2013; Barker and Walker, 2014). The mammalian haemostatic response to preserve the integrity of the barrier and halt blood loss, via coagulation, vasoconstriction and platelet aggregation, could be circumvented by anti-thrombotic agents such as protease inhibitors and prothrombinase complexes present in tick saliva (Francischetti et al., 2009). Additionally, ticks also introduce a myriad of foreign antigens and microbes

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 23 into the parasitised individual by salivating and regurgitation of their stomach contents during a blood meal (Mans and Neitz, 2004).

Furthermore, the cutaneous puncture inflicted by the tick hypostome results in vascular injury and the release of cytokines, which when coupled with the inoculation of foreign antigen would lead to a series of host-mediated innate immune responses such as haemostasis, neutrophils infiltrate and inflammation (Turvey and Broide, 2010; Kazimirova and Stibrániová, 2013). It is believed that neutrophil activation and respiratory bursts, mediated by IL-8, contribute directly to the damage to cutaneous tissue at the site of tick bite rather than proteolytic substances from the tick saliva (Ribeiro, 1987; Boxman et al., 1996). Conversely, the salivary contents of various ticks have been shown in overseas studies to contain immunomodulatory compounds that downregulate the mammalian immune response (Singh and Girschick, 2003; Francischetti et al., 2009).

Studies have demonstrated that humans parasitised by I. ricinus are seropositive to Ca. M. mitochondrii six weeks post removal of the tick (Mariconti et al., 2012b). While seropositivity does not equate pathogenicity or viability of Ca. M. mitochondrii in the human host, the presence of these antibodies demonstrate that the immune system had been exposed to these tick-related antigens in large enough quantities to elicit seroconversion. The longevity of the immune memory cells is a double-edged sword which can provide long-lasting immune protection against encountered pathogens but also life-long hypersensitivities to mistargeted innocuous antigens such as mammalian meat (da Silva et al., 2014).

1.6.1 Human Immunity The understanding of the human immune response (Fig. 1.17), when presented with a bacterial challenge, is helpful in the investigation of and development of a treatment protocol for patients with DSCATT. Currently, the human samples were collected in conjunction with the tick removal from human patients in a hospital setting. However, it is unknown if Ca. M mitochondrii inoculated via the tick bite was viable or capable of replicating within human tissues and causing infections (Mariconti et al., 2012b). A recent study involving the deliberate infestations of rabbits with ticks harbouring Ca. M. mitochondrii demonstrated the persistence of bacterial DNA in the

24 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

rabbit sera 16 weeks after the removal of ticks, hinting at replication capabilities (Cafiso et al., 2019).

Figure 1.17: Immune response timeline to a bacterial infection (Pearsons Education Inc, 2012).

1.7 SUMMARY

The relationship between Ca. M. mitochondrii and its arthropod hosts is supported by various studies (Sacchi et al., 2004; Ahantarig et al., 2013; Cafiso et al., 2019) which described the complete destruction of I. ricinus mitochondria matrix without detriment to the oogenesis of the host. Therefore it is anticipated that Ca. M. mitochondrii possess genes that encode for the biosynthesis of essential co-factors as well as the tricarboxylic acid (TCA) cycle that produces adenosine triphosphate (ATP) that could be supplied to the host via a functional ATP/ADP translocase also found encoded for in the Ca. M. mitochondrii genome (Sassera et al., 2011). Despite the same high abundance of Ca. M. mitochondrii seen in I. holocyclus, the endosymbiont is not observed to share the same intra-mitochondrial lifestyle as the Ca. M. mitochondrii living in I. ricinus, suggesting possible difference in Ca. M. mitochondrii or host species.

Despite having a possible mutualistic relationship on the tick host, the effect of transmission of Ca. M. mitochondrii into other accidental hosts, such as humans, are currently unknown. Studies have also shown the immunomodulatory effect of tick saliva to dampen the mammalian immune response, which can facilitate the

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 25 transmission of pathogens harboured by the tick (Singh and Girschick, 2003). Recent research also suggested that the Ca M. mitochondrii inoculated into vertebrates via tick bites could be capable of replication, evidenced by persistent DNA in serology detected up to 16 weeks post exposure (Bazzocchi et al., 2013; Cafiso et al., 2019). With more people encountering ticks due to the expanding geographical range caused by climate change, the risk of an epidemic could be mitigated with continued research efforts to uncover helpful information (Lydecker et al., 2015).

Current data show that Ca. M. mitochondrii is prevalent in I. holocyclus (Gofton et al., 2015a) and preliminary unpublished NGS data support the inoculation of Ca. M. mitochondrii into humans parasitised by I. holocyclus. The scientific evidence discussed in this literature review demonstrates that transmitted Ca. M. mitochondrii elicit an immune response (Mariconti et al., 2012b) and detectable DNA in samples of parasitised vertebrates suggest inoculated Ca. M. mitochondrii could be viable and capable of replication within a mammalian host (Beninati et al., 2009; Cafiso et al., 2019). Moreover, the role Ca. M. mitochondrii play in modulating the human immune response and potentiating the pathogenicity of other microorganisms harboured in the tick microbiome is yet to be elucidated (Singh and Girschick, 2003). In view of DSCATT in Australia still lacking a known aetiologic agent and the absence of Borrelia burgdorferi, further research is necessary for the development of tools to identify Ca. M. mitochondrii in future.

1.8 AIMS

The research aims of this project will be to molecularly characterize Ca. M. mitochondrii in Australian human patient samples and concurrently biting ticks, by targeting multiple loci. A genotype comparison will be carried out between the Australian Ca. M. mitochondrii sequence and Ca. M. mitochondrii in overseas ticks to determine genetic relatedness using phylogenetics. Histological characterization will be carried out on Australian I. holocyclus so as to provide context to FISH microscopy results. Finally, a FISH assay will be developed and optimized on Australian I. holocyclus for the morphological detection of Ca. M. mitochondrii.

26 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

1.9 HYPOTHESES

The hypotheses for this study are that Ca. M. mitochondrii will be detectable in the human blood or tissue samples, or both, and the concurrently biting tick. Based on the Australian and New Guinea Ixodes forming a distinct monophyletic clade from all other Ixodes ticks (Fig 1.8), it is hypothesized that the Ca. M. mitochondrii sequenced in Australian I. holocyclus will also be different to the genotype of the Ca. M. mitochondrii sequenced in the overseas tick, I. ricinus. Finally, Ca. M. mitochondrii will be demonstrated in I. holocyclus ovaries during FISH.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 27 Chapter 2: Materials and methods

2.1 SAMPLE ACQUISITION

Ticks, tissue biopsies and blood samples from Australian human patients, acquired with ethical approval (2016/035), were used to determine the microbial profile and TBD associated taxa of interest. DNA extraction on the samples was performed using a Qiagen DNeasy Blood and Tissue kit, with extraction blanks as negative controls, following the manufacturer’s guidelines and modified protocol by Gofton et al. (Gofton et al., 2015b). The human samples included; Patient 1: Man1.tick, Man1.blood, Man1.tissue; Patient 2: Man2.tick, Man2.blood. Man2.tissue; and Patient 3: Man3.tick, Man3.blood and Man3.tissue.

Positive Ca. M, mitochondrii controls included five I. holocyclus genomic DNA (gDNA) samples B108, B9, B124, B119 and B6 (Table 4). These ticks were removed from long-nosed bandicoots Perameles nasuta, from New South Wales and used for the optimisation of protocols before the limited human samples were analysed.

Table 4: I. holocyclus gDNA for positive controls

DNA ID Instar

B108 Nymph

B9 Nymph

B124 Adult - Male

B119 Adult - Female

B6 Nymph

2.2 NUCLEIC ACID CONCENTRATION

gDNA samples were analysed with NanoDrop to determine the nucleic acid concentration and sample quality prior to PCR analysis. Based on the abundant nucleic acid concentration in the tick samples, the tick gDNA samples were diluted with Buffer AE (the elution buffer used during gDNA extraction) to 1 in 10 dilutions. The human blood and tissue samples were undiluted in this study, because the majority of nucleic

28 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

acid concentration result was likely influenced by the DNA from the human host rather than Ca. M, mitochondrii.

2.3 POLYMERASE CHAIN REACTION ANAYSIS

The Australian I. holocyclus gDNA positive controls (Table 4) were used to develop the PCR assay to ensure the assay was effective on the Australian Ca. M. mitochondrii strain most likely to be found in Australian samples. Seven gene loci were targeted for PCR analysis on Australian Ca. M. mitochondrii (Table 5). Gene loci 1 and 2 were specific to the order of Rickettsiales, while gene loci 3-6, inclusive, are species-specific and designed for Ca. M. mitochondrii in overseas ticks (Epis et al., 2010). Gene locus 7, Gyrase subunit B (GyrB), is a single copy gene and was included to test sensitivity (Sassera et al., 2008). Gene locus 5, Type II citrate synthase (GltA) gene was targeted due to its previous success in phylogenetic analysis of Rickettsiae in ticks (Ishikura et al., 2003). Gene locus 6, 16S ribosomal RNA (16S) gene is commonly targeted when performing PCR identification of bacteria due to its ubiquitous presence, variable copy-number, relative abundance of reference sequences in GenBank and its structure of alternating ten highly-conserved regions with nine hypervariable regions which allow for the design of primers that amplify genetic differences (Fukuda et al., 2016). For primer sets 1-7, the protocol (Epis et al., 2010) was optimised using positive gDNA controls (Table 4), with 2.5 µL KAPA Taq polymerase (5 U/µL) and KAPA Taq buffer + Dye (includes 1.5mM MgCl2), and using thermal cycling conditions adapted to 95°C initial denaturation for 2 mins, followed by 40 cycles of 95°C denaturation for 15 sec, 58°C annealing for 30 sec and 72°C extension for 30 sec, with a final extension of 72°C for 5 mins.

Primer sets 8 and 9 were obtained to generate longer amplicons for analysis (Epis et al., 2008). The thermal cycling conditions used to carry out 16S Assay 5 was adapted from protocol (Sassera et al., 2008) with 2.5 µL KAPA Taq polymerase and KAPA

Taq buffer + Dye (includes 1.5mM MgCl2), and with thermal cycling conditions adapted to 95°C initial denaturation for 2 mins, followed by 40 cycles of 95°C denaturation for 30 sec, 56°C annealing for 30 sec and 72°C extension for 45 sec, with a final extension of 72°C for 10 mins.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 29 Table 5: Target gene loci and primers used in this project.

No. Gene Primers Primer sequence Amplic on size

1 Isocitrate IsodedrtDEG-f AAAGCACCGATTACTAC 631 bp dehydrogenase # IsodedrtDEG-r CCWGAAGGATTAGCAATA

2 Succinyl-CoA SucCArtDEG-f TACAACCKATATTACCGTCCATT 655 bp synthetase beta chain # SucCArtDEG-r GTGGTTAAAGCACAAATACATGC

3 RNA RpoBrt-f GTAGTAGTGATAAGCAAGC 250 bp polymerase beta subunit RpoBrt-r CTTTTGTTAGCAATTTATTCAAC (rpoB) # 4 Chaperonin GroELrt-f CAGGTGGACAGGTTATTTCT 206 bp GroEL (GroEL) # GroELrt-r TCTGAGCTTTGATCTGAGC

5 Type II citrate GltArt-f AACAAAATGCTTCCACTTCTA 180 bp synthase (GltA) # GltArt-r TATTCGAGAAGCGTGCC

6 16S rRNA # 16Srt-f GTGCTAGATGTTGGGATTTAAGT 180 bp

16Srt-r TGATCACCATGTCAAGGCC

7 Gyrase subunit GyrB-f CTTGAGAGCAGAACCACCTA 145 bp B GyrB-r CAAGCTCTGCCGAAATATCTT (GyrB) ^ 8 16S rRNA * Midi-F GTACATGGGAATCTACCTTGC 1,100 bp Midi-R CAGGTCGCCCTATTGCTTCTTT

9 16S rRNA * Midi-F2 CAACGAGCGCAACCCTTAT 350 bp CAGTCGTCAACCTTACCGT Midi-R2

* (Epis et al., 2008); ^ (Sassera et al., 2008); # ((Epis et al., 2010)

30 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

2.3.1 PCR Optimisation The GroEL assay was excluded from analysis due to lack of an annotated reference sequence and failure to align to the reference Ca. M. mitochondrii IricVA genome (Accession number: CP002130) on Geneious.

2.3.2 Agarose Gel Electrophoresis, Gel Extraction and Purification Following each PCR, gel electrophoresis was used to visualise PCR products; 2% agarose gels were used for expected amplicon size of under 500bp and 1% agarose gels were used for expected amplicon size of 500bp or above. The agarose gels were prepared with 4 μL of SYBR safe gel stain. The gel was run in 1x TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, pH 8.0) in a Bio-Rad Wide mini-sub cell GT cell. The lanes were loaded with 18 μL of gDNA, flanked by the 100 bp Axygen® DNA ladder and run at 80V for 32 mins, followed by 120V, until adequate separation was achieved. The gel was subjected to UV light, and an image was captured by Canon camera and edited on AlphaDigiDoc RT software.

Bands of expected sizes (Table 5) were cut with fresh sterile scalpels in a dark room. The cut bands were loaded into pre-UV-sterilised 200 μL filtered pipette tips that were cut and placed in 1.5 mL graduated Eppendorf tubes. The DNA was extracted from the gel by centrifugation at max tube speed of 14,600rpm for 1 min as previously described (Yang et al., 2013). Amplicons 100 bp or under resulting in ambiguous sequences were purified again with the QIAquick PCR purification kit as per manufacturer’s protocol and sent to the Australian Genome Research Facility for Sanger sequencing. Purified DNA (5 µL) was prepared in a 1.5 mL Eppendorf tube with 6 µL of DNA grade pure water and 1 µL of primer. Each amplicon was sequenced in both directions using corresponding forward and reverse primers.

2.3.3 Phylogenetic analysis Geneious 10.2.6 software was used to edit and remove primer sequences from each sequence generated via Sanger sequencing (Kearse et al., 2012). The Basic Local Alignment Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) website was used to match and align the DNA sequences

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 31 produced to GenBank. Multiple alignments were first aligned with MAAFT alignment (Katoh et al., 2002), trimmed to the same nucleotide length and realigned with MUSCLE alignment (Edgar, 2004) and exported as FASTA sequences. Genetic distance based on percent identity was also obtained from Geneious.

MEGA7 software was used to determine the best-fit substitution model for each of phylogenetic tree to be built based on the lowest Bayesian Information score (BIC) (Table 6) (Kumar et al., 2016). The best-fit substitution model for the 16S gene locus was Kimura 2-parameter (K2) using a discrete Gamma distribution (+G); for GltA gene locus was K2+G assuming that certain fraction of sites are evolutionarily invariable (+I); and for the GyrB gene locus was Tamura 3-parameter (T92) +G (Table 6).

Table 6: Best-fit nucleotide substitution model for each gene locus Gene loci Alignment length Lowest BIC score Model 16S Assay 1 143 bp 1552.892 K2+G

16S Assay 5 1051 bp 11212.742 K2 +G

16S Assay 5 1332 bp 13600.846 K2 + G

GltA 126 bp 2287.910 K2+G+I

GyrB 147 bp 1073.490 T92+G

Concatenated 1593 bp 16611.214 GTR+G (GltA, GyrB and 16S Assay 5)

Phylogenetic trees were built based on the 1000 bootstrap replications method with the maximum likelihood statistical method in MEGA7. The Ca. M. mitochondrii in the concatenated tick samples were used as representative of local Ca. M. mitochondrii to be compared with Ca. M. mitochondrii sequenced overseas.

2.4 FLUORESCENCE IN-SITU HYBRIDISTION (FISH)

A fluorescence in-situ hybridisation (FISH) protocol was developed and optimized to morphologically characterise the spatial distribution of Ca. M. mitochondrii in sectioned I. holocyclus. All steps of the FISH experiments carried out are described in the following sub-sections.

32 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

2.4.1 Probe Selection and Design Four probes, designed to target Ca. M. mitochondrii 16S gene, I. holocyclus mitochondria, universal bacteria for positive control and gammaproteobacteria for negative control, were utilised for the development and optimisation of a FISH protocol effective for I. holocyclus (Table 7). Each probe was ordered labelled with a fluorescein at the 5’ end, the fluorescence of which would have emission spectrum capable of distinguishing the fluorescence of the yellow-orange Ca. M. mitochondrii, cyan-green mitochondria and red general bacteria.

Table 7: Probes used to develop FISH protocol. Probe Probe target/ Fluorescein/ name Probe sequence Emission spectrum Ca. M. mitochondrii (16S gene) / Cy3/ Midi0066 5’-GCTACAGCTCTTGCCCGT-3’ Yellow-orange I. holocyclus (Mitochondria)/ 5’6-FAM/ 143-P 5’-GGCCATTTTACCGCGATGAC-3’ Cyan-green Universal bacterial / Cy5/ EUB338 5’-GCTGCCTCCCGTAGGAGT-3’ bright red Gammaproteobacteria/ Cy5.5/ Gam1019 5’-GGTTCCTTGCGGCACCTC-3’ deep red

The probe Midi0066 was specific to Ca. Midichloria mitochondrii (AJ566640), Ca. Midichloria sp. Ixholo1 (FM992373) and Ca. Midichloria sp. Ixholo2 (FM992373), with a maximum of one nucleotide mismatch when analysed in Geneious 10.2.6 (Kearse et al., 2012). In preliminary simulations in Geneious 10.2.6, Midi0066 did not mis-target other bacteria, such as Rickettsia, Anaplasma, Borrelia, Francisella and Ehrlichia, that are commonly reported in ixodid ticks, when allowing for a maximum of five mismatches. Midi0066 probe was used in this study to target the 16S gene of Ca. M. mitochondrii; it consisted of 18 nucleotides 5’- GCTACAGCTCTTGCCCGT-3’, a GC content of 61.1%, meting temperature (Tm) of 57.8°C and molecular weight (MW) of 5.933.1g/mol (Table 7) (Epis et al., 2013). Cy3 yellow-orange fluorescent dye, with an absorption spectrum of 550nm and emission spectrum of 564nm, was used to label Midi0066.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 33 The 143P probe was designed in this present study to target I. holocyclus mitochondria using primer design tool “Primer 3” with the I. holocyclus mitochondrial genome (Accession number AH011506) as a reference. Unlike in I. ricinus studies, the mitochondria probe for I. holocyclus could not be designed at the 12S rRNA gene locus due to failure in GC content and low Tm (Epis et al., 2013). Hence the 143P probe was designed within the region 91-154 which corresponds to product "tRNA- Tyr”. 143P was used in this study to target the I. holocyclus mitochondria; it consisted of 20 nucleotides, 5’-GGCCATTTTACCGCGATGAC-3’, a GC content of 55.0%, Tm of 56.9°C and MW of 6,711.5g/mol (Table 7) (Epis et al., 2013). 5’6FAM (azide) cyan-green fluorescent dye, with an absorption spectrum of 496nm and emission spectrum of 516nm, was used to label 143P.

EUB338 probe used in this study is a universal bacteria probe and served as a positive control (Amann et al., 1990; Epis et al., 2013). EUB338 consisted of 18 nucleotides, 5’-GCTGCCTCCCGTAGGAGT-3’, a GC content of 66.7%, Tm of 59.4°C and MW of 6,024.2g/mol (Table 7) (Epis et al., 2013). Cy5 bright-red fluorescent dye, with an absorption spectrum of 648nm and emission spectrum of 668nm, was used to label EUB338.

GAM1019 was used in this study to target gammaproteobacteria and serve as a negative control (Nielsen et al., 1999). GAM1019 consisted of 18 nucleotides, 5’- GGTTCCTTGCGGCACCTC-3’, a GC content of 66.7%, Tm of 59.3°C and MW of 6,075.3g/mol (Table 7) (Epis et al., 2013). Cy5.5 dark-red fluorescent dye, with an absorption spectrum of 685nm and emission spectrum of 706nm, was used to label GAM1019.

Each of the four probes were optimised individually to anneal to I. holocyclus samples during FISH before a multiplex assay with all four probes was carried out in conjunction with haematoxylin and eosin (H&E) stain and DAPI (4′,6-diamidino-2- phenylindole).

2.4.2 Fixation of I. holocyclus specimen Ethanol-preserved I. holocyclus samples were fully immersed in 1.5 mL of fixative (4% formaldehyde in PBS with 0.5% (v/v) Triton X-100) in a 2mL Eppendorf tubes. The tubes were vortexed for 20 sec and briefly centrifuged to eliminate air

34 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

bubbles and to ensure that the tick was positioned at the bottom of the tube. The specimens in fixative were maintained at 4°C for a period of 24 hours.

2.4.3 Dehydration of I. holocyclus specimen Fixed I. holocyclus specimens were then dehydrated in a series of increasing ethanol (EtOH) concentrations, from 50% to 100% (Table 8).

Table 8: Dehydration of fixed I. holocyclus Dehydration

50% EtOH 1 hr

70% EtOH 2 hr

70% EtOH 2 hr

90% EtOH 1 hr

90% EtOH 2 hr

100% EtOH 1 hr

100% EtOH 2 hr

2.4.4 EtOH/Chloroform treatment of I. holocyclus specimen The dehydrated tick specimens were treated by two EtOH/Chloroform preparations (Table 9).

Table 9: EtOH/ Chloroform treatments of dehydrated I. holocyclus EtOH/Chloroform treatment

100% EtOH/Chloroform 1 hr

100% Chloroform 3 hr

2.4.5 Paraffin Infiltration of I. holocyclus specimen Treated tick specimens were infiltrated with paraffin wax at 55°C for 3 hours per bath (Table 10). The paraffin infiltrated tick specimens were placed in a paraffin

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 35 cassette mould which was filled with molten paraffin and allowed to set for a period of 24 hours.

Table 10: Paraffin infiltration of I. holocyclus Paraffin infiltrate

Paraffin 3 bath 1 hr

Paraffin 3 bath 2 hr

Vacuum 3 paraffin hr bath

2.4.6 Sectioning of I. holocyclus specimen embedded in paraffin Ticks embedded in the paraffin blocks were sectioned into 5 µm thick sections by a Leica keratome, floated on warm water and collected on adhesive microscope slides manufactured by Hurst Scientific. The sections that were adhered to glass slides were allowed to dry for a period of 24 hours. Subsequently, excess wax was trimmed from around the sample, and the sample was then placed in a freezer for 1-2 hours to increase the success rate of sectioning. Wax blocks were kept on ice when on the bench. Due to fixation issues, new 5µm I. holocyclus sections were produced and placed on positively charged microscope glass slides manufactured by Hurst Scientific.

2.4.7 Deparaffinization of I. holocyclus sections Sections in paraffin were brought to water by immersing in xylene and a series of decreasing EtOH concentrations with either protocol (Table 11 and 12).

36 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Table 11: Protocol 1 - Deparaffinization of sections Deparaffinization of sections

100% xylene 2 min 3 X

100% EtOH 5 min 1 X

95% EtOH 5 min 1 X

70% EtOH 5 mins 1 X

50% EtOH 5 mins 1 X

Deionised water Quick rinse 1 X

PBS 5 min 2 X

Table 12: Protocol 2 - Deparaffinization of sections Deparaffinization of sections

100% xylene 3 mins 2 X

1:1 ratio xylene/EtOH 3 mins 2 X

100% EtOH 3 mins 2 X

95% EtOH 3 mins 1 X

70% EtOH 3 mins 1 X

50% EtOH 3 mins 1 X

Distilled water Quick rinse 1 X

PBS 5 mins 2 X

2.4.8 Permeabilization: Pre-hybridisation optimisation Due to the relative lack of permeability of the ixodid ticks’ cuticle as compared to mammalian tissue, a permeabilization pre-treatment was necessary to allow for perfusion of probes for hybridisation. The permeabilization was carried out with 100 µm of proteinase K at a concentration of 1 µm/mL in an incubation chamber at 37°C, for 15 mins.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 37 2.4.9 Hybridization of probes to I. holocyclus sections The following steps were performed in a dark room. Hybridization buffer containing probes were heated to 95°C for 3 mins to denature probes and placed directly into ice to prevent re-annealing. Approximately 125µL of hybridization buffer were added to each slide. The sections were allowed to hybridize for three hours at 37°C in a humidified chamber. After hybridization, the slides were drained, washed with SSC and 10nM DTT preparations pre-heated to 55°C and incubated at 55°C for 15 mins per wash (Table 13).

Table 13: Post-hybridization slide washing sequence No. of times Slide washes Duration

2 1X SCC* with 10mM DTT** (100mL) 15 mins each

2 0.5X SCC with 10mM DTT (100mL) 15 mins each

*SCC: saline-sodium citrate buffer ** DTT: Dithiothreitol reducing agent

2.4.10 DNA stain to I. holocyclus sections DAPI, a DNA stain, excited by the violet (405 nm) laser line, was used to provide a fluorescent nuclear counterstain to the probe fluorescein. This assay was performed in a dark room, at room temperature, and comprised of the steps listed in Table 14.

Table 14: DAPI stain procedure No. of times Slide washes Duration

3 Phosphate buffered saline (PBS) 5 mins each

1 300 µL Diluted DAPI solution (300nM) 10 mins

2 Phosphate buffered saline (PBS) 1 sec

2.4.11 Haematoxylin and eosin (H&E) stain to I. holocyclus sections Once slides were stained with DAPI, additional haematoxylin and eosin (H&E) stain was used to improve the identification of tissue sections under light microscopy and give context to the FISH signals (Table 15).

38 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Table 15: Haematoxylin and eosin (H&E) staining protocol. No. of times Reagents Duration

1 DI water rinse

1 Haematoxylin 5 dips

1 Blueing solution 1 min

1 95% EtOH 3 dips

1 Eosin 1 min

2 95% EtOH 3 dips

2 100% EtOH 3 dips

1 50:50 ratio of xylene and100% EtOH 3 dips

2.4.12 Slide Mounting Washed slides were allowed to air dry in the dark, mounted with anti-fading agent (ProLong Invitrogen) on the cover side, with the edges of the coverslip sealed with clear nail polish. Slides were stored in a dark storage box until viewed under a fluorescence microscope.

2.4.13 Fluorescence microscopy The hybridized sections were viewed under an Olympus DP70 fluorescence microscope coupled to an Olympus U-RFL-T burner and image captured with DP controller computer software. Merging of microscopy images was conducted with DP controller compute software. Measurements of morphological structures on microscopy images captured by DP controller computer software were measured with ImageJ software (Schneider et al., 2012).

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 39 Chapter 3: Results

3.1 MOLECULAR CHARACTERISATION

As seen in Fig. 3.1, 16S, GltA and GyrB genes were successfully amplified with an optimised protocol (Epis et al., 2010) using positive gDNA controls (Table 3). The amplification of the multicopy 16S gene resulted in strong amplification despite 1 in 10 dilution (Fig. 3.1 b).

Figure 3.1: Amplification of 16S (a-b), GltA (c) and GyrB (d) gene loci using gDNA extracted from Ca. M. mitochondrii positive I. holocyclus controls. L1: 100bp DNA ladder; L2: B108; L3: B9; L4:B124; L5: B119; L6:B6.

Gene loci Isocitrate dehydrogenase, succinyl-CoA synthetase beta chain and RNA polymerase beta subunit were excluded from further experiments as they failed to amplify Ca. M. mitochondrii in the I. holocyclus positive controls.

3.1.1 Optimisation of uncoupled PCR assays All 16S primers were aligned in silico against the reference 16S Ca. M. mitochondrii sequence on Geneious and numbered with 16S assay numbers 1-5 (Fig.

40 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

3.2). The amplification of a near full length 16S sequence was attempted after 16S assay 2 and 3 were successful in amplifying positive controls (Fig. 3.3). Midi-F was combined with Midi-R2 (16S Assay 4) to generate an approximately 1,300bp 16S amplicon but failed (Fig. 3.2). Hence, 16S Assay 5 was developed and successfully amplified two overlapping sequences of the 16S generating a consensus sequence for analysis (Fig. 3.2); the first with primers Midi-F and 16Srt-r which generated a sequence of approximately 800 bp and the second primers 16Srt-f and Midi-R2 which generated a sequence of approximately 790 bp (Fig. 3.4).

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 41

gene on Geneious. gene

16S M. mitochondrii M. mitochondrii

Ca. primer alignment with the the with alignment primer

16S : Adapted Adapted : 2 . 3

Figure Figure

42 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 3.3: a) 16S Assay 2 and b) 16S Assay 3 amplification using gDNA extracted from Ca. M. mitochondrii positive I. holocyclus controls. L1: 100bp DNA ladder; L2: B108; L3: B9; L4:B124; L5: B119; L6:B6; L7:Left blank; L8: Left blank; L9: No template control; L10: No template control; L11:Left blank; L12: Left blank; L13: Negative control; L14: Left blank; L15:100bp DNA ladder.

Figure 3.4:16S Assay 5 (a) and (b) amplification using gDNA extracted from Ca. M. mitochondrii positive I. holocyclus controls. L1: 100bp DNA ladder; L2: B108; L3: B9; L4:B124; L5: B119; L6:B6; L7:Left blank; L8: Left blank; L9: No template control; L10: No template control; L11:Left blank; L12: Left blank; L13: Negative control; L14: Left blank; L15:100bp DNA ladder.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 43 The 16S sequences generated were merged in Geneious, and BLAST results for each sequence confirmed that 16S Assay 5 is reliable in identifying Ca. M. mitochondrii (Table 16).

Table 16: NCBI BLAST results for merged sequences generated from Ca. M. mitochondrii positive samples generated from 16S Assay 5.

size Query E- Match Description Identity Accession bp cover value description

Ca. B108 1267 100% 0.0 100.00% Midichloria FM992372.1 sp. Ixholo1 Ca. B9 1274 99% 0.0 98.82% Midichloria FM992372.1 sp. Ixholo1 Ca. B124 1272 100% 0.0 99.92% Midichloria FM992372.1 sp. Ixholo1 Ca. B119 1273 100% 0.0 98.90% Midichloria FM992372.1 sp. Ixholo1 Ca. B6 1277 100% 0.0 98.90% Midichloria FM992372.1 sp. Ixholo1

3.1.2 Ca. M. mitochondrii in Australian human samples. Due to the high gDNA concentration of the biting tick samples, they were analysed at a 1 in 10 dilution. Furthermore, to prevent cross-contamination, the human blood and tissue samples were analysed distally to tick samples. Bands produced on the agarose gel electrophoresis of an expected size of 16S Assay 1, GltA, GyrB and 16S Assay 5 can be observed within the red boxes in Fig. 3.5, 3.6, 3.7 and 3.8 respectively.

44 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 3.5: Agarose gel electrophoresis of 16S Assay 1 PCR products. a) L1: 100bp DNA ladder; L2: Man1.tick; L3: Man2.tick; L4: Man3.tick; L5: Man.tick extraction blank. B) L1: 100bp DNA ladder; L2: Man1.blood; L3: Man2.blood; L4: Man3.blood; L5: Left blank; L6: Man1.tissue; L7: Man2.tissue; L8: Man3.tissue; L9: Left blank; L10: Man.tissue extraction blank.

Figure 3.6: Agarose gel electrophoresis of GltA PCR products. a) L1: 100bp DNA ladder; L2: Man1.tick; L3: Man2.tick; L4: Man3.tick; L5: Left blank; L6: Man.tick extraction blank; L7: Left blank; L8: Left blank; L9: Man1.blood; L10: Man2.blood; L11: Man3.blood; L12: Left blank; L13: Left blank; L14: Left blank; L15: 100bp DNA ladder. b) L1: 100bp DNA ladder; L2: Man1.tissue; L3: Man2.tissue; L4: Man3.tissue; L5: Left blank; L6: Man.tissue extraction blank; L7: Left blank; L8: Neg control; L9: Left blank; L10: No template control; L11: Left blank; L12: Left blank; L13: Positive control (B119); L14: Left blank; L15: 100bp DNA ladder.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 45

Figure 3.7: Agarose gel electrophoresis of GyrB PCR products. a) L1: 100bp DNA ladder; L2: Man1.tick; L3: Man2.tick; L4: Man3.tick; L5: Left blank; L6: Man.tick extraction blank; L7: Left blank; L8: Left blank; L9: Man1.blood; L10: Man2.blood; L11: Man3.blood; L12: Left blank; L13: Left blank; L14: Left blank; L15: 100bp DNA ladder. b) L1: 100bp DNA ladder; L2: Man1.tissue; L3: Man2.tissue; L4: Man3.tissue; L5: Left blank; L6: Man.tissue extraction blank; L7: Left blank; L8: Neg control; L9: Left blank; L10: No template control; L11: Left blank; L12: Left blank; L13: Positive control (B119); L14: Left blank; L15: 100bp DNA ladder.

Figure 3.8: Agarose gel electrophoresis of 16S Assay 5 PCR products. a) PCR products of 16S Assay 5a:L1: 100bp DNA ladder; L2: Man1.tick; L3: Man2.tick; L4: Man3.tick; L5: Left blank; L6: Man.tick extraction blank. b) PCR products of 16S Assay 5b:L1: 100bp DNA ladder; L2: Man1.tick; L3: Man2.tick; L4: Man3.tick; L5: Left blank; L6: Man.tick extraction blank.

46 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Ca. M. mitochondrii were found in all human (blood and/or tissue) samples and the concurrently biting tick (Table 17-19). The top NCBI BLAST match description of sequences generated from Australian human samples are presented in Tables 17-19.

In Man1.tick, all three targeted Ca. M. mitochondrii genes, 16S, GyrB and GltA were successful in producing amplicons after PCR (Table 17). Man1.blood sample was positive for the short 16S amplicons while Man1.tissue was positive for both GyrB and GltA amplicons (Table 17).

Table 17: Man1. Sequences identity. Primer size Query E- Identity Match description Accession assay bp cover value 16S

126 100% 2E-49 96.09% Ca. Midichloria sp. HM9 LT898326.1 assay1 16S assay5 GyrB no amplicons Man1.blood GltA 16S 141 100% 5E-66 100.00% Ca. Midichloria sp. HM9 LT898326.1 assay1

16S 1272 99% 0.0 98.82% Ca. Midichloria sp. Ixholo1 FM992372.1 assay5 Uncultured Ca. Midichloria GyrB 106 100% 7E-43 98.10% LT575858.1

Man1.tick sp. maritimus Ca. Midichloria GltA 126 100% 2E-54 98.41% CP002130.1 mitochondrii IricVA 16S assay1 no amplicons 16S assay5 Uncultured Ca. Midichloria GyrB 105 100% 7E-43 98.10% LT575858.1 sp. maritimus Man1.tissue Ca. Midichloria GltA 126 100% 4E-51 96.83% CP002130.1 mitochondrii IricVA

Man2.tick was positive for all three targeted Ca. M. mitochondrii gene loci, 16S, GyrB and GltA (Table 18). Man2.blood was not positive for any Ca. M. mitochondrii gene loci but amplified human DNA instead (Table 18). Man2.tissue was positive for all three targeted Ca. M. mitochondrii sequences but was negative for longer 16S sequences generated by 16S Assay 5 (Table 18).

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 47

Table 18: Man2. Sequences identity.

size Query E- Primer Identity Match description Accession bp cover value 16S Human DNA sequence f 110 100% 6E-44 97.30% Z98753.1 assay1 chromosome 6q22 16S assay5 GyrB no amplicons Man2.blood GltA 16S 141 100% 5E-66 100.00% Ca. Midichloria sp. HM9 LT898326.1 assay1 16S 1272 99% 0.0 98.97% Ca. Midichloria sp. Ixholo1 FM992372.1 assay5 Uncultured Ca. Midichloria GyrB 106 100% 7E-38 95.28% LT575858.1 Man2.tick sp. maritimus Ca. Midichloria mitochondrii GltA 126 100% 2E-54 98.41% CP002130.1 IricVA 16S 141 99% 8E-64 99.29% Ca. Midichloria sp. HM9 LT898326.1

assay1 16S no amplicons assay5 Uncultured Ca. Midichloria GyrB 106 100% 7E-43 98.10% LT575858.1 sp. maritimus Man2.tissue Ca. Midichloria mitochondrii GltA 126 100% 2E-54 98.41% CP002130.1 IricVA

Man3.tick was positive for all three targeted Ca. M. mitochondrii gene loci, 16S, GyrB and GltA (Table 19). Man3.blood was positive for a short 16S sequence generated by 16S Assay 1 only, while Man3.tissue was positive for all three targeted Ca. M. mitochondrii gene loci but negative for the longer 16S sequence generated by 16S Assay 5 (Table 19).

48 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Table 19: Man3. Sequences identity.

size Query E- Primer Identity Match description Accession bp cover value

16S

117 100% 9E-48 97.48% Ca. Midichloria sp. HM9 LT898326.1 assay1 16S assay5 GyrB no amplicons Man3.blood GltA 16S 141 100% 5E-66 100.00% Ca. Midichloria sp. HM9 LT898326.1 assay1 16S 1271 99% 0.0 98.97% Ca. Midichloria sp. Ixholo1 FM992372.1 assay5 Uncultured Ca. Midichloria GyrB 105 100% 7E-43 98.10% LT575858.1 Man3.tick sp. maritimus Ca. Midichloria GltA 126 100% 2E-54 98.41% CP002130.1 mitochondrii IricVA 16S 141 100% 5E-66 100.00% Ca. Midichloria sp. HM9 LT898326.1 assay1

16S assay5 no amplicons Uncultured Ca. Midichloria GyrB 105 100% 7E-43 98.10% LT575858.1 sp. maritimus Man3.tissue Ca. Midichloria GltA 126 100% 2E-54 98.41% CP002130.1 mitochondrii IricVA

3.1.3 Genotype comparison: 1332 bp 16S gene (16S Assay 5) The phylogenetic analysis of the 1332 bp 16S sequences, obtained from 16S assay 5, had a topology that supported the genetic difference between the Man.tick and other Ca. M. mitochondrii 16S sequences (Fig. 3.9). Genetic distance for the three tick samples, Man1.tick, Man2.tick and Man3.tick, analysed were 100% identical (shown in red font on the phylogenetic tree) (Fig.3.9). The organism with the closest genetic distance to the Man1-3.tick samples was Ca. Midichloria sp. Ixholo1, accession number FM992372, with a 16S genetic distance of 1.26%, followed by Ca. M. mitochondrii (accession number AJ566640) and Ca. M. mitochondrii IricVA (accession number CP002130) with genetic distances of 2.2% (Full data in appendix A1.3).

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 49

Figure 3.9: Phylogenetic tree of 1332 bp 16S sequences produced by 16S Assay 5.

3.1.4 Genotype comparison: 1051 bp 16S gene (16S Assay 5) The phylogenetic analysis of the 1051 bp 16S sequences, produced from 16S Assay 5, was conducted to include a larger number of related sequences from GenBank (Fig. 3.10). Genetic distances and the topology of the phylogenetic tree showed that Man1.tick, Man2.tick and Man3.tick, analysed were identical (shown in red font on the phylogenetic tree) (Fig. 3.10). The organism with the closest genetic distance to the sequences obtained from Man1.tick, Man2.tick and Man3.tick was Ca. Midichloria sp. Ixholo2, accession number FM992373, with a 16S genetic distance of 1.20%, followed by Ca. M. mitochondrii sp. Ixholo1 (accession number FM992372) with a 16S genetic distance of 1.30%. (Full data in appendix A1.5).

50 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 3.10: Phylogenetic tree of 1051 bp 16S sequences produced by 16S Assay 5.

3.1.5 Genotype comparison: 143 bp 16S gene (16S Assay 1) The phylogenetic analysis of the short, 143 bp 16S sequences, produced by 16S Assay 1, were able to detect Ca. M. mitochondrii in more samples than targeting longer amplicons with 16S Assay 5 in human tissue (Fig. 3.11). Man1.blood and Man3.blood sequences were of insufficient length and were excluded from this analysis. The 16S Assay 1 was more sensitive in detecting Ca. M. mitochondrii in samples with lower bacteraemia but was less able to distinguish between different strains. All genus-level Ca. Midichloria 16S sequences amplified by 16S Assay 1 were identical, except for Man2.tissue which had a 1.06% difference to all other Ca. M. mitochondrii sequences used in this analysis which could be due to polymorphisms

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 51 within the Australian Ca. M. mitochondrii strains or analytical issues such as quality of sequences (Fig. 3.11) (Full data in appendix A1.7). Similarly, this short 143 bp 16S sequence was not able to distinguish between most members of the genus Rickettsia apart from Rickettsia australis (Fig. 3.11).

Figure 3.11: Phylogenetic tree of 143 bp 16S sequences produced by 16S Assay 1.

52 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

3.1.6 Genotype comparison: GltA gene Phylogenetic analysis of the 126 bp GltA gene loci, supported by the topology of the phylogenetic tree, demonstrated that all tick and tissue samples of Man1-3 are identical with the exception of Man1.tissue (Fig. 3.12). The 2.40% genetic difference of Man1.tissue to the identical Ca. M. mitochondrii sequences could be due to polymorphisms within the Australian Ca. M. mitochondrii strains or analytical issues such as quality of sequences. The closest genetic match was Ca. M. mitochondrii IricVA, accession number CP002130, with a difference of 1.60% to all tick and tissue

GltA sequences, except for Man1.tissue with a difference of 3.20%. (Full data in appendix A1.9).

Figure 3.12: Phylogenetic tree of 126 bp GltA sequences.

3.1.7 Genotype comparison: GyrB gene The genetic difference analysis and the topology of the phylogenetic tree for the 147 bp Ca. M. mitochondrii GyrB gene showed that all human tissue and tick samples were identical, except for Man2.tissue which was 5.0% different which could be due

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 53 to polymorphisms within the Australian Ca. M. mitochondrii strains or analytical issues such as quality of sequences (Fig. 3.13). The two closest genetic matches were Ca. M. mitochondrii IricVA, accession number CP002130, and Ca. M. mitochondrii, accession number AM159536, with a genetic difference of 4.0% to the identical samples and 9.0% different to Man2.tissue sample (Fig. 3.13) (Full data in appendix A1.11).

Figure 3.13: Phylogenetic tree of 147 bp GyrB sequences.

3.1.8 Concatenated genes analysis The concatenated 1593 bp three local tick sequences, of GltA, GyrB and 16S, were identical and a single sequence (in red text) was used as a representative of the locally sequenced Ca. M. mitochondrii (Fig.3.14). The genetic distance and the topology of the phylogenetic tree demonstrated that Ca. M. mitochondrii IricVA, accession number CP002130, used as a representative of Ca. M. mitochondrii overseas, had a genetic distance of 2.35% to the Australian Ca. M. mitochondrii. When

54 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

compared with organisms from the genus Rickettsia, the genetic distances were between 18-20%. (Full data in appendix A1.13).

Figure 3.14: Phylogenetic tree of the 1593 bp concatenated GltA, GyrB and 16S sequences.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 55

3.2 MORPHOLOGICAL CHARACTERISATION

3.2.1 Characterisation of I. holocyclus histological features The internal anatomy of the adult female I. holocyclus were elucidated with H&E stain to tick sections in order to give context to fluorescence signals during analyses with microscopy (Fig. 3.15). The orientation of the tick section, as seen in Fig. 3.15, can be determined with an anterior (Ant.) aspect and a posterior (Post.) aspect.

Figure 3.15: Intact I. holocyclus section stained with H&E (4X magnification). The orientation of the tick is labelled anterior (Ant.) and posterior (Post.)

In Fig. 3.16, the transverse section of I. holocyclus ovary can be seen with multiple oocytes, in various stages of maturity, surrounding the ovarian lumen. Stage I - IV oocytes (red arrows) can be observed attached to the ovarian epithelial wall by the pedicel cell (Fig. 3.16). Two pre-oviposited oocytes, (yellow arrow) in Fig. 3.16b with an appearance consistent with being ovulated into the lumen of the ovary were 52µm and 54µm in diameter and displayed a densely granulated morphology consistent with vitellogenic granules of egg laying organisms (Sonenshine and Roe, 2013).

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 57

Figure 3.16: 20X magnification of I. holocyclus ovary and oocyte stained with H&E stain. a) transverse section of ovary (OV) Stage I - IV oocytes (red arrows) and oocytes in the ovarian lumen (LU); b) Closeup view of the yellow box in picture a showing ovulated oocytes (yellow arrow).

3.2.2 Characterisation of I. holocyclus histological features: Oocytes Light microscopy of the dorsoventral section of I. holocyclus stained with H&E, as seen in Fig. 3.17, elucidated the morphology of the ovaries. The convoluted, tubular structure of the ovaries can be seen at the posterior aspect of the gravid adult female I. holocyclus and continue anteriorly towards the genital aperture (Fig. 3.17a). Stage I – II previtellogenic oocytes (red arrows) can be identified within ovarian tissue via the lack of clearly defined vitellogenic granules, allowing the eccentrically positioned germinal vesicles (orange arrows) to be visible (Fig. 3.17b). Unlike the mature oocytes in Fig. 3.16 filled with coarse vitellogenic granules and measuring greater than 50µm, the immature oocytes in Fig. 3.17 were approximately 20µm in diameter and attached via a pedicel cell (black arrow).

58 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 3.17: H&E stain of tick sections. a) dorsoventral tick section (ovarian tissue in yellow box) 4X magnification; b) 20X magnification of the yellow box in (a) showing tubular structure of ovaries and developing oocytes still attached to the epithelia; c) 40X magnification of the ovarian wall showing immature oocyte (red arrows). Oocyte chorion (orange arrows), eccentric germinal vesicle (yellow arrow heads) and a single pedicel cell (black arrow) can be seen.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 59 3.2.3 Detection of Ca. M. mitochondrii with FISH FISH and DAPI demonstrated the positive annealing of Cy-3 labelled probes targeting Ca. M. mitochondrii to structures resembling ovaries/oocytes, as seen in Fig. 3.19, localised in the posterior region (red box of Fig. 3.18) of the tick body. The diameter of the clusters of Cy3 labelled fluorescence was measured across the widest possible diameter and clusters range from 17-37µm in diameter.

Figure 3.18: I. holocyclus spatial morphology. Oocytes and ovaries in Fig. 3.19 – 3.21 located at posterior region (red box); salivary glands in Fig. 3.22 located at anterior region (orange box).

Figure 3.19: Fluorescent microscopy of I. holocyclus sections showing oocytes and ovary at the posterior region of the female I. holocyclus tick. a) DAPI of oocytes/ovaries; b) Fluorescent Ca. M. mitochondrii probe

In Fig. 3.20, annealed Cy3-labelled fluorescent probes identified Ca. M. mitochondrii present clusters in oocyte (white arrow) with the diameter along the widest diameter determined to be approximately 30- 33µm (Fig. 3.20). In fig. 3.21, an

60 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

overlay of DAPI fluorescence (Fig. 3.20c) and Ca. M. mitochondrii probe fluorescence signals (Fig. 3.20d) demonstrated that not all cells were infected with Ca. M. mitochondrii within the ovary , consistent with published information on other Ixodes (Epis et al., 2013).

Figure 3.20: Fluorescent microscopy of the I. holocyclus oocyte/ovaries. 10X magnification of oocytes with a) DAPI filter and, b) Cy3-labelled Ca. M. mitochondrii; 40X magnification of oocytes with c) DAPI filter and, d) Cy3-labelled Ca. M. mitochondrii; Oil immersion 100X magnification of oocytes with e) DAPI filter and f) Cy3-labelled Ca. M. mitochondrii.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 61

Figure 3.21: Overlay of DAPI (Fig. 3.20c) and Ca. M. mitochondrii (Fig. 3.20d) in the female I. holocyclus ovary.

Salivary glands (SG) arranged in classical acinar organisation can be identified with DAPI and the abundant auto-fluorescence towards the anterolateral aspect of the tick body (orange box of Fig. 3.18). In Fig. 3.22a, the salivary glands can be observed surrounded by midgut (MG) containing dehydrated blood meal, consistent with sections on the dorsal aspect of a fed adult female tick. In fig. 3.22b, fluorescent signals can be observed from DAPI in the salivary gland while Ca. M. mitochondrii was undetectable. In Fig. 3.22c, DAPI was able to demonstrate the outline of the dorsoventral tick section and prominent salivary glands anterior-laterally along the length of the tick. Greater magnification of the salivary glands were demonstrated in Fig. 3.22d-f with 10X, 40X and 100X oil immersion respectively.

62 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Figure 3.22: I. holocyclus sections showing midgut and salivary glands. a) DAPI microscopy of midgut MG and salivary glands SG (within red outline) with tissue displaying abundant auto-fluorescence; b) DAPI microscopy of MG and SG dimmed to show the fluorescence of DAPI; c) 4X magnification of dorsoventrally sectioned I. holocyclus showing entire section; d-f) Increasing magnification to demonstrate the acinar structure of the salivary gland.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 63 Chapter 4: Discussion

This study produced GyrB and GltA novel gene sequences and 16S gene sequence above 1300 bp from an Australian Ca. M. mitochondrii which has not previously been accomplished. Phylogenetic analyses conducted provided compelling evidence that the Australian Ca. M. mitochondrii could be a subtype from the overseas Ca. M. mitochondrii. Morphological characterisation of the Australian I. holocyclus was also accomplished with H&E, DAPI and FISH techniques but was unfortunately not carried out on the biting Man1-3.tick samples due to the time constraints. However, due to the detection of the Australian Ca. M. mitochondrii in both the human and tick samples, it is anticipated that a fully optimised FISH assay, which is still in the process of being developed, would detect Ca. M. mitochondrii in the salivary glands of the biting Man1-3.tick samples.

4.1 CHARACTERISATION OF THE AUSTRALIAN CA. M. MITOCHONDRII

Although the whole genome of Ca. M. mitochondrii has been previously sequenced from I. ricinus in the Northern Hemisphere (Sassera et al., 2011), prior to this study the genetic data on Australian Ca. M. mitochondrii was limited to the 16S gene (Beninati et al., 2009). Phylogenetic analyses found that the Man.tick Ca. M. mitochondrii 16S sequences produced in this study were most similar to Ca. M. Mitochondrii found in Australian I. holocyclus: Ca. Midichloria sp. Ixholo2, accession number FM992373, with a genetic distance of 1.20%, followed by Ca. M. mitochondrii sp. Ixholo1 (accession number FM992372) with a 16S genetic distance of 1.30% (Beninati et al., 2009). Based on the same phylogenetic analyses with the trimmed 16S sequence, the overseas Ca. M. mitochondrii IricVA, accession number CP002130, had a genetic difference of 1.80% from the Man.tick samples.

In addition to generating additional 16S sequences, this study generated GyrB and GltA gene sequences of the Australian Ca. M. mitochondrii for the first time, which will provide relevant references for comparison studies in the future. Phylogenetic analysis of the concatenated genes, GltA, GyrB and 16S, revealed the

64 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

three I. holocyclus samples from the different patients harboured Australian Ca. M. mitochondrii with identical sequences, while the overseas strain, represented by Ca. M. mitochondrii IricVA, accession number: CP002130, had a genetic difference of 2.35%. Within the monophyletic Midichloria clade, only a single genome exists on GenBank, which makes it challenging to determine if 2.35% is sufficient molecular divergence for the Australian Ca. M. mitochondrii to constitute a novel species. The genetic difference between identified Rickettsia species in the sister clade, also compared in the same phylogenetic analysis, showed three of the six identified Rickettsia species, R. montanensis, R. ricketsii and R. parkeri have a genetic difference of under 1%, suggesting that the Australian Ca. M. mitochondrii could be a novel species that has yet to be identified.

4.1.1 Primers and protocol based on CMM from the Northern Hemisphere The 16S, GyrB and GltA gene loci were successfully amplified with primers designed for the Ca. M. mitochondrii from the Northern Hemisphere, while the Australian Ca. M. mitochondrii was not amplified with rpoB, isocitrate dehydrogenase and succinyl-CoA gene primers despite attempts at optimisation. One possible reason for failure in amplification could be because the primers chosen were developed to amplify Ca. M. mitochondrii from the Northern Hemisphere. Based on phylogenetic analysis of the sequences amplified successfully, the Australian Ca. M. mitochondrii has a genetic difference of 2.35% to the overseas Ca. M. mitochondrii. Single nucleotide polymorphisms (SNPs) at the primer target regions, which is a major cause of amplification failure, may be an explanation for failure of amplification of some genes (Vieux et al., 2002). In the future, primers incorporating degenerate bases, lower primer annealing temperatures or increased Mg2+, could improve amplification at problematic gene loci.

4.1.2 Analyses with varying length 16S sequences. To enable phylogenetic analyses of all of the available Australian Ca. M. mitochondrii sequences on GenBank and sequences generated in this study, three different alignment lengths were analyzed. A phylogenetic analysis of a 140bp 16S gene sequence produced by 16S Assay 1 was conducted as sequences were

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 65 successfully amplified in human samples. The sensitivity of 16S Assay 1 could accurately detect Ca. M. mitochondrii within more samples with a probable lower bacteraemia. Therefore, this assay could be useful in a clinical setting whereby detection of bacteraemia is more beneficial than ascertaining its complete taxonomic identity. The short 16S sequences were capable of distinguishing between organisms on the genus level, however they were incapable of distinguishing between closely related organisms of different strains and demonstrates the need for longer sequences to increase the resolution of phylogenetic analysis.

The >1,300bp 16S gene sequences produced by 16S Assay 5 was used for phylogenetic analyses as longer sequences provide better taxonomic resolution than shorter sequences. Phylogenetic analysis of a trimmed 16S gene sequences (Fig 3.11; 1,051bp) produce by 16S Assay 5 was carried out to include a larger number of closely related 16S sequences, including two from the Australian I. holocyclus, which would otherwise have been left out due to insufficient length. The result of the phylogenetic analyses demonstrated that 16S gene is a useful locus to delineate species due to the availability of data on GenBank.

4.1.3 Concatenated sequence as a solution to above problems Phylogenetic trees built with concatenations of different genes increase resolution of analyses, hence the reliability of distinguishing between organisms on a species level. Here, concatenation was performed with three genes, GyrB, GltA and 16S (Gadagkar et al., 2005). For the purpose of comparing the genetic distance of Australian Ca. M. mitochondrii, a representative concatenated sequence from the three identical tick samples was compared against Ca. M. mitochondrii IricVA, accession number CP002130, the representative overseas Ca. M. mitochondrii. The topology of the phylogenetic tree of the long 16S and the concatenated tree was similar when comparing the Ca. M. mitochondrii species, but nuanced differences were observed when comparing the topology of the rickettsial clade. With more reference sequences of adequate length added to GenBank in the future, more topological differences may be anticipated when phylogenetically analysing the Australian Ca. M. mitochondrii. The phylogenetic analyses had demonstrated that the Australian Ca. M. mitochondrii in this study is consistently distinct from the overseas Ca. M. mitochondrii, further supporting that the Australian Ca. M. mitochondrii could be a novel species.

66 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

4.2 FIRST EVIDENCE OF CA. M. MITOCHONDRII IN AUSTRALIAN HUMAN PATIENT SAMPLES FOLLOWING TICK BITE

A previous study demonstrated that humans parasitised by I. ricinus had a high prevalence of seropositivity against Ca. M. mitochondrii, close to 50 times greater than non-parasitised humans (Mariconti et al., 2012b). Seroprevalence indicates only that the patient has been exposed to a certain antigen, while PCR molecular analysis demonstrates the presence of targeted DNA at the time the sample was acquired. In this study, molecular analyses were carried out on the blood, tissue and biting tick samples of parasitised human patients who presented at east coast hospitals. Detection here of at least one Ca. M. mitochondrii DNA sequence in the human blood and tissue samples represents the first evidence (globally) of Ca. M. mitochondrii being inoculated into a human following a tick bite. This study provided evidence of transmission during a tick bite, however, the role of Ca. M. mitochondrii in human pathology has yet to be investigated.

A study that collected serial blood samples on rabbits to investigate the transmission of Ca. M. mitochondrii via tick bites, demonstrated that it could take up to four weeks for the detection of Ca. M. mitochondrii DNA in circulating blood after the detachment of the ticks and the Ca. M. mitochondrii DNA could be detected at 16 weeks post-infestation (Cafiso et al., 2019). Similar studies investigating the transmission dynamics of Ca. M. mitochondrii by I. holocyclus to a vertebrate host have not been undertaken and would be worth investigating. The present study was unable to establish if Ca. M. mitochondrii was still viable within tissue samples or if the patients seroconverted to Ca. M. mitochondrii infection. Future studies would benefit from serial serological testing of patients for up to 16 weeks from tick bite in order to investigate the changes in titre and to see if there is persistence of Ca. M. mitochondrii DNA in the blood after the removal of the tick. This would help determine or rule out Ca. M. mitochondrii as a potential cause of DSCATT.

4.2.1 Ca. M. mitochondrii detection in different specimen type In all biting ticks examined there was successful amplification of all gene loci targeted, however, only amplification of target sequences under 200 bp were successful in the human tissue and blood samples. Between these, tissue biopsy samples yielded more successful Ca. M. mitochondrii amplicons than blood in all

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 67 sample sets, which were consistent with published studies that found blood specimens to be unsuitable for the detection of pathogenic Rickettsia and Borrelia species (Wilske, 2003; Souza et al., 2009), and also that Ca. M. mitochondrii DNA is expected to be less concentrated in blood (Paludan and Bowie, 2013).

The samples were collected on the day of the tick extraction from the human patients. The blood sample might be negative for Ca. M. mitochondrii, but the timeline could be a factor. Ca. M. mitochondrii might require more time to travel from the tissue (location of tick bite) to the blood. As blood is constantly circulating, it might be the reason that the Ca. M. mitochondrii load is not concentrated enough to be detectable. Furthermore, the lack of large sequences found in human samples could be a result of immune clearance of bacterial DNA via the action of phagocytic antigen- presenting cells which degrades bacterial genetic material (Paludan and Bowie, 2013).

Various studies have shown that microbial pathogens are tropic to different cell types and are detected in those locations despite being undetectable in blood samples. For instance, Rickettsiales are tropic to endothelia, while the detection of B. burgdorferi have been recommended via analysis of skin biopsies, synovial fluid and cerebrospinal fluid (Wilske, 2003; Souza et al., 2009). Although the target cell type within the human body for Ca. M. mitochondrii is unknown, Ca. M. mitochondrii might preferentially avoid circulating blood to avoid immune cells. Hence, the unknown human tissue tropism of Ca. M. mitochondrii is a challenge which could affect attempts of detection.

4.3 HISTOLOGICAL CHARACTERISATION OF I. HOLOCYCLUS

This study was the first to provide histological characterisation about crucial anatomical features specific to I. holocyclus, such salivary gland, ovarian and oocyte morphology, that were relevant for this study. Histological characterisation is important because it provides context for the fluorescent signals during FISH. The most comprehensive publications on Australian ticks (Roberts, 1970; Barker and Walker, 2014) lack details on internal tick histology, while other publications that contain comprehensive illustrations of internal anatomy were developed on ixodid tick species overseas (Sonenshine and Roe, 2013). The assumption that I. holocyclus anatomy is the same as all other ixodid ticks (Sonenshine and Roe, 2013) could lead

68 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

to misinterpretation during microscopy. For example, based on a single study on I. holocyclus, their mitochondrial diameter was found to be 0.2µm, which was at least five times smaller than mitochondrial diameters (1µm) measured in I. ricinus at a similar state of engorgement (Beninati et al., 2009).

4.3.1 Determination of suitable section for analysis During the optimisation and troubleshooting phases of this study, another challenge encountered was achieving a section with a suitable tissue plane. When engorged, the tick mid-gut of the female tick occupies a significant portion of the dorsal aspect of the entire body of the tick (Sonenshine and Roe, 2013). Hence, this study determined that sections with tissue planes including large portions of the mid- gut were unsuitable for morphological characterisation.

4.3.2 Localisation of Ca. M. mitochondrii via FISH assay FISH techniques on tissue sections of ticks can be a powerful tool to spatially detect fluorescence signals from multiple targets via multiplexing on a single image. In this study, fluorescently labelled Ca. M. mitochondrii was detected at the posterior region of adult female I. holocyclus, which coincides with the localisation of the ovaries. The DAPI nuclear stain used in the same assay validated the presence of Ca. M. mitochondrii, by resulting in signals of a similar distribution but stronger and more numerous.

A well-known challenge of the FISH technique is the progressive weakening of fluorescence signals with time (Summersgill and Shipley, 2010), which in this study was mitigated by the use of a commercial anti-fading agent to prolong the strength of fluorescence signals. Furthermore, strong auto-fluorescence of tick tissue when viewed under a fluorescence microscope impeded accurate interpretation in this study (Summersgill and Shipley, 2010; Epis et al., 2013; Bagheri et al., 2017). Optimisation of FISH in future experiments should endeavour to reduce ambiguity of the fluorescence signal. This could be achieved via the use of Tyramide Signal Amplification, which increases the strength of true positive signals (Bagheri et al., 2017), inclusion of an auto-fluorescence reduction step with 1% sodium borohydride

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 69 (Summersgill and Shipley, 2010), or the use of a commercially available Autofluorescence Quenching kit.

While Ca. M. mitochondrii had been characterised in the ovaries and oocytes of I. ricinus with techniques such as whole-mount FISH (Epis et al., 2013), ISH (Beninati et al., 2004) and indirect immunofluorescence assay (Mariconti et al., 2012a), these techniques may not be effective when carried out on I. holocyclus. For example, the I. ricinus 12S rRNA gene locus used as a target for fluorescently-labelled probe were inappropriate for I. holocyclus due to a failure in GC content and a lower than optimal melting temperature (Tm) at the analogous region (Epis et al., 2013). To circumvent this, probe 143P targeting I. holocyclus mitochondria at the region 91-154 was designed with “Primer 3” software (Rozen and Skaletsky, 2000). The Tm of the 143P probe was 56.9°C, which was 0.9°C lower than the Tm for Midi0066, 2.5°C lower than the Tm for EUB338 and 2.4°C lower than GAM1019. These factors could possibly result in a highly reduced hybridisation stability especially if there were single mismatches, which would also lower the Tm of the probe-target heteroduplex (Nielsen et al., 1999; Epis et al., 2013). Optimisation of a probe to specifically target the mitochondria of I. holocyclus during FISH assays is important because one of the aims of this study was to develop and optimise a FISH assay. Since a reliable model for predicting hybridisation kinetics of probe-target heteroduplexes stability based on the sequence information does not exist (Zhang et al., 2018), a lowered hybridisation stringency should be investigated to determine if Tm affected the hybridisation of 143P to the mitochondria of I. holocyclus sections by altering the post-hybridisation wash conditions, such as reducing incubation temperature, incubation duration or the number of post-hybridisation washes.

Due to the time constraints of this study, a balance of penetration of fluorescence and retention of tissue on microscope slides was not achieved. However, probe fluorescence on partially intact sections, together with DAPI showed strong signal of the presence of Ca. M. mitochondrii in the ovaries of Australian I. holocyclus. The success of a multiplexed FISH assay is dependent on the ability of each individual probe with differentially labelled fluorescence emission wavelength to successfully anneal to target sequences, which required individual optimisations before a multiplex assay can be carried out. Future research could benefit from the histology of Australian I. holocyclus instead of assuming similarity with Ixodes ticks in the Northern

70 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Hemisphere. In addition, an optimised FISH protocol could help in studies to not just determine the spatial distribution of Ca. M. mitochondrii in I. holocyclus, but also other potential pathogens harboured.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 71 Chapter 5: Conclusions

This research characterised, for the first time, Ca. M. mitochondrii in Australian human patients’ samples and concurrently biting ticks using molecular and morphological methodologies. The positive amplification of at least one target Ca. M. mitochondrii gene from each of the human samples supports the hypothesis that transmission of Ca. M. mitochondrii occurs during a tick bite. The molecular results of this study provide valuable knowledge about assays specific to Ca. M. mitochondrii in Australia. As the first study to demonstrate presence of Ca. M. mitochondrii in human patients in Australia, the results will inform further research aimed at determining the significance of Ca. M. mitochondrii and tick-borne illness. With the causative agent(s) of DSCATT still unidentified in Australia, evidence presented in this study for the transmission of Ca. M mitochondrii calls for further investigation in the near future. Furthermore, the molecular evidence generated in this study provide support for the Australian Ca. M. mitochondrii as a novel species, which should be investigated with a full genome sequencing and a unique binomial nomenclature assigned.

The morphological characterisation with FISH carried out in this study was the first to be attempted on the Australian native tick I. holocyclus. While successful FISH of the specific ticks removed from the humans remained elusive due to time constraints of this study, several optimisations of important steps were successful for the future. This study was able to produce histological characterisation and describe various internal morphological features of I. holocyclus, such as the ovaries, oocytes and salivary glands coupled with measurements relevant to I. holocyclus. These findings provide an important reference point for future studies pertaining to I. holocyclus without the need to depend on potentially irrelevant details derived from the Northern Hemisphere ticks. Moreover, optimisation in the fixation, sectioning and selection of suitable reagents and labware is no doubt valuable to morphological characterisation studies in the near future.

72 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

References

Adrion, E. R., Aucott, J., Lemke, K. W. and Weiner, J. P. (2015). Health Care Costs,

Utilization and Patterns of Care following Lyme Disease. PLOS ONE 10,

e0116767. doi: 10.1371/journal.pone.0116767.

Ahantarig, A., Trinachartvanit, W., Baimai, V. and Grubhoffer, L. (2013). Hard ticks

and their bacterial endosymbionts (or would be pathogens). Folia

Microbiologica 58, 419–428. doi: 10.1007/s12223-013-0222-1.

Amann, R. I., Binder, B. J., Olson, R. J., Chisholm, S. W., Devereux, R. and Stahl,

D. A. (1990). Combination of 16S rRNA-targeted oligonucleotide probes

with flow cytometry for analyzing mixed microbial populations. Applied and

Environmental Microbiology 56, 1919–1925.

Anderson, B. E., Dawson, J. E., Jones, D. C. and Wilson, K. H. (1991). Ehrlichia

chaffeensis, a new species associated with human ehrlichiosis. Journal of

Clinical Microbiology 29, 2838–2842.

Andersson, S. G. E., Zomorodipour, A., Andersson, J. O., Sicheritz-Pontén, T.,

Alsmark, U. C. M., Podowski, R. M., Näslund, A. K., Eriksson, A.-S.,

Winkler, H. H. and Kurland, C. G. (1998). The genome sequence of

Rickettsia prowazekii and the origin of mitochondria. Nature 396, 133. doi:

10.1038/24094.

Australia. Department of Health (2017). Australian Government response to the

Senate Community Affairs References Committee final report: Inquiry into

the growing evidence of an emerging tick-borne disease that causes a Lyme-

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 73 like illness for many Australian patients.

https://www.health.gov.au/internet/main/publishing.nsf/Content/ohp-gov-

response-lyme-final-report.htm

Australia. Department of Health (2018b). Lyme disease.

https://www.health.gov.au/internet/main/publishing.nsf/Content/ohp-lyme-

disease.htm

Bagheri, G., Lehner, J. D. and Zhong, J. (2017). Enhanced Detection of Rickettsia

Species in Ixodes pacificus Using Highly Sensitive Fluorescence in situ

Hybridization Coupled with Tyramide Signal Amplification. Ticks and tick-

borne diseases 8, 915–921. doi: 10.1016/j.ttbdis.2017.08.001.

Barker, S. C. and Murrell, A. (2004). Systematics and evolution of ticks with a list of

valid genus and species names. Parasitology 129 Suppl, S15-36.

Barker, S. C. and Walker, A. R. (2014). Ticks of Australia. The species that infest

domestic animals and humans. Zootaxa 1–144. doi:

10.11646/zootaxa.3816.1.1.

Bazzocchi, C., Mariconti, M., Sassera, D., Rinaldi, L., Martin, E., Cringoli, G.,

Urbanelli, S., Genchi, C., Bandi, C. and Epis, S. (2013). Molecular and

serological evidence for the circulation of the tick symbiont Midichloria

(Rickettsiales: Midichloriaceae) in different mammalian species. Parasites &

Vectors 6, 350. doi: 10.1186/1756-3305-6-350.

Beninati, T., Lo, N., Sacchi, L., Genchi, C., Noda, H. and Bandi, C. (2004). A Novel

Alpha-Proteobacterium Resides in the Mitochondria of Ovarian Cells of the

74 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Tick Ixodes ricinus. Applied and Environmental Microbiology 70, 2596–

2602. doi: 10.1128/AEM.70.5.2596-2602.2004.

Beninati, T., Riegler, M., Vilcins, I.-M. E., Sacchi, L., McFadyen, R.,

Krockenberger, M., Bandi, C., O’Neill, S. L. and Lo, N. (2009). Absence of

the symbiont Candidatus Midichloria mitochondrii in the mitochondria of the

tick Ixodes holocyclus. FEMS Microbiology Letters 299, 241–247. doi:

10.1111/j.1574-6968.2009.01757.x.

Boxman, I. L. A., Ruwhof, C., Boerman, O. C., Löwik, C. W. G. M. and Ponec, M.

(1996). Role of fibroblasts in the regulation of proinflammatory interleukin

IL-1, IL-6 and IL-8 levels induced by keratinocyte-derived IL-1. Archives of

Dermatological Research 288, 391–398. doi: 10.1007/BF02507108.

Burgdorfer, W., Barbour, A. G., Hayes, S. F., Benach, J. L., Grunwaldt, E. and J. P.

Davis (1982). Lyme disease-a tick-borne spirochetosis? Science 216, 1317–

1319. doi: 10.1126/science.7043737.

Cafiso, A., Bazzocchi, C., De Marco, L., Opara, M. N., Sassera, D. and Plantard, O.

(2016). Molecular screening for Midichloria in hard and soft ticks reveals

variable prevalence levels and bacterial loads in different tick species. Ticks

and Tick-borne Diseases 7, 1186–1192. doi: 10.1016/j.ttbdis.2016.07.017.

Cafiso, A., Sassera, D., Romeo, C., Serra, V., Hervet, C., Bandi, C., Plantard, O. and

Bazzocchi, C. (2019). Midichloria mitochondrii, endosymbiont of Ixodes

ricinus: evidence for the transmission to the vertebrate host during the tick

blood meal. Ticks and Tick-borne Diseases 10, 5–12. doi:

10.1016/j.ttbdis.2018.08.008.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 75 Chalada, M. J., Stenos, J. and Bradbury, R. S. (2016). Is there a Lyme-like disease in

Australia? Summary of the findings to date. One Health 2, 42–54. doi:

10.1016/j.onehlt.2016.03.003.

Chen, S. M., Dumler, J. S., Bakken, J. S. and Walker, D. H. (1994). Identification of

a granulocytotropic Ehrlichia species as the etiologic agent of human disease.

Journal of Clinical Microbiology 32, 589–595.

Collignon, P. J., Lum, G. D. and Robson, J. M. (2016). Does Lyme disease exist in

Australia? The Medical Journal of Australia 205, 413–417. doi:

10.5694/mja16.00824.

Cowdry, E. V. (1925). A group of microorganisms transmitted hereditarily in ticks

and apparently unassociated with disease. The Journal of Experimental

Medicine 41, 817–830. da Silva, E. Z. M., Jamur, M. C. and Oliver, C. (2014). Mast Cell Function. Journal

of Histochemistry and Cytochemistry 62, 698–738. doi:

10.1369/0022155414545334.

Dehhaghi, M., Kazemi Shariat Panahi, H., Holmes, E. C., Hudson, B. J., Schloeffel,

R. and Guillemin, G. J. (2019). Human Tick-Borne Diseases in Australia.

Frontiers in Cellular and Infection Microbiology 9,. doi:

10.3389/fcimb.2019.00003.

Department of Health, A. G. (2018a). Australian national notifiable diseases case

definitions - Appendix B: Australian state and territory notifiable diseases.

76 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Di Venere, M., Fumagalli, M., Cafiso, A., De Marco, L., Epis, S., Plantard, O.,

Bardoni, A., Salvini, R., Viglio, S., Bazzocchi, C., Iadarola, P. and Sassera,

D. (2015). Ixodes ricinus and its endosymbiont midichloria mitochondrii: A

comparative proteomic analysis of salivary glands and ovaries. PLoS ONE

10,. doi: 10.1371/journal.pone.0138842.

Doggett, S. L. (2015). Ixodes holocyclus (Australian paralysis tick): stages and life

cycle.

Dumler, J. S. and Bakken, J. S. (1995). Ehrlichial Diseases of Humans: Emerging

Tick-Borne Infections. Clinical Infectious Diseases 20, 1102–1110. doi:

10.1093/clinids/20.5.1102.

Dumler, J. S., Barbet, A. F., Bekker, C. P. J., Dasch, G. A., Palmer, G. H., Ray, S. C.,

Rikihisa, Y. and Rurangirwa, F. R. (2001). Reorganization of genera in the

families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales:

unification of some species of Ehrlichia with Anaplasma , Cowdria with

Ehrlichia and Ehrlichia with Neorickettsia , descriptions of six new species

combinations and designation of Ehrlichia equi and “HGE agent” as

subjective synonyms of Ehrlichia phagocytophila. International Journal of

Systematic and Evolutionary Microbiology 51, 2145–2165. doi:

10.1099/00207713-51-6-2145.

Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and

high throughput. Nucleic Acids Research 32, 1792–1797. doi:

10.1093/nar/gkh340.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 77 Epis, S., Sassera, D., Beninati, T., Lo, N., Beati, L., Piesman, J., Rinaldi, L., McCoy,

K. D., Torina, A., Sacchi, L., Clementi, E., Genchi, M., Magnino, S. and

Bandi, C. (2008). Midichloria mitochondrii is widespread in hard ticks

(Ixodidae) and resides in the mitochondria of phylogenetically diverse

species. Parasitology 135, 485–494. doi: 10.1017/S0031182007004052.

Epis, S., Luciano, A. M., Franciosi, F., Bazzocchi, C., Crotti, E., Pistone, D., Bandi,

C. and Sassera, D. (2010). A novel method for the isolation of DNA from

intracellular bacteria, suitable for genomic studies. ResearchGate. doi:

http://dx.doi.org/10.1007/s13213-010-0063-y.

Epis, S., Mandrioli, M., Genchi, M., Montagna, M., Sacchi, L., Pistone, D. and

Sassera, D. (2013). Localization of the bacterial symbiont Candidatus

Midichloria mitochondrii within the hard tick Ixodes ricinus by whole-

mount FISH staining. Ticks and Tick-borne Diseases 4, 39–45. doi:

10.1016/j.ttbdis.2012.06.005.

Francischetti, I. M. B., Sá-Nunes, A., Mans, B. J., Santos, I. M. and Ribeiro, J. M. C.

(2009). The Role of Saliva in Tick Feeding. Frontiers in bioscience : a

journal and virtual library 14, 2051–2088.

Fukuda, K., Ogawa, M., Taniguchi, H. and Saito, M. (2016). Molecular Approaches

to Studying Microbial Communities: Targeting the 16S Ribosomal RNA

Gene. Journal of UOEH 38, 223–232. doi: 10.7888/juoeh.38.223.

Gadagkar, S. R., Rosenberg, M. S. and Kumar, S. (2005). Inferring species

phylogenies from multiple genes: concatenated sequence tree versus

78 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

consensus gene tree. Journal of Experimental Zoology. Part B, Molecular

and Developmental Evolution 304, 64–74. doi: 10.1002/jez.b.21026.

Gofton, A. W., Oskam, C. L., Lo, N., Beninati, T., Wei, H., McCarl, V., Murray, D.

C., Paparini, A., Greay, T. L., Holmes, A. J., Bunce, M., Ryan, U. and Irwin,

P. (2015a). Inhibition of the endosymbiont “ Candidatus Midichloria

mitochondrii” during 16S rRNA gene profiling reveals potential pathogens in

Ixodes ticks from Australia. Parasites & Vectors 8, 345. doi:

10.1186/s13071-015-0958-3.

Gofton, A. W., Doggett, S., Ratchford, A., Oskam, C. L., Paparini, A., Ryan, U. and

Irwin, P. (2015b). Bacterial Profiling Reveals Novel “ Ca. Neoehrlichia”,

Ehrlichia , and Anaplasma Species in Australian Human-Biting Ticks.

PLOS ONE 10, e0145449. doi: 10.1371/journal.pone.0145449.

Greay, T. L., Gofton, A. W. and Oskam, C. L. (2016). Paralysis tick, Ixodes

holocyclus.

Greay, T. L., Gofton, A. W., Paparini, A., Ryan, U. M., Oskam, C. L. and Irwin, P. J.

(2018). Recent insights into the tick microbiome gained through next-

generation sequencing. Parasites & Vectors 11, 12. doi: 10.1186/s13071-017-

2550-5.

Guglielmone, A. A., Robbins, R. G., Apanaskevich, D. A., Petney, T. N., Estrada-

Peña, A., Horak, I. G., Shao, R. and Barker, S. C. (2010). The Argasidae,

Ixodidae and Nuttalliellidae (Acari: Ixodida) of the world: a list of valid

species names. Zootaxa 2528, 1–28. doi: 10.5281/zenodo.196488.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 79 Haine, E. R. (2008). Symbiont-mediated protection. Proceedings of the Royal Society

B: Biological Sciences 275, 353–361. doi: 10.1098/rspb.2007.1211.

Hartelt, K., Oehme, R., Frank, H., Brockmann, S. O., Hassler, D. and Kimmig, P.

(2004). Pathogens and symbionts in ticks: prevalence of Anaplasma

phagocytophilum ( Ehrlichia sp.), Wolbachia sp., Rickettsia sp., and

Babesia sp. in Southern Germany. International Journal of Medical

Microbiology Supplements 293, 86–92. doi: 10.1016/S1433-1128(04)80013-

5.

Hughes, G. L., Koga, R., Xue, P., Fukatsu, T. and Rasgon, J. L. (2011). Wolbachia

Infections Are Virulent and Inhibit the Human Malaria Parasite Plasmodium

Falciparum in Anopheles Gambiae. PLOS Pathogens 7, e1002043. doi:

10.1371/journal.ppat.1002043.

Ishikura, M., Ando, S., Shinagawa, Y., Matsuura, K., Hasegawa, S., Nakayama, T.,

Fujita, H. and Watanabe, M. (2003). Phylogenetic Analysis of Spotted Fever

Group Rickettsiae Based on gltA, 17-kDa, and rOmpA Genes Amplified by

Nested PCR from Ticks in Japan. Microbiology and Immunology 47, 823–

832. doi: 10.1111/j.1348-0421.2003.tb03448.x.

Iturbe-Ormaetxe, I., Walker, T. and O’ Neill, S. L. (2011). Wolbachia and the

biological control of mosquito-borne disease. EMBO reports 12, 508–518.

doi: 10.1038/embor.2011.84.

Jongejan, F. and Uilenberg, G. (2004). The global importance of ticks. Parasitology

129 Suppl, S3-14.

80 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Katoh, K., Misawa, K., Kuma, K. and Miyata, T. (2002). MAFFT: a novel method

for rapid multiple sequence alignment based on fast Fourier transform.

Nucleic Acids Research 30, 3059–3066. doi: 10.1093/nar/gkf436.

Kazimirova, M. and Stibrániová, I. (2013). Tick salivary compounds: their role in

modulation of host defences and pathogen transmission. Frontiers in Cellular

and Infection Microbiology 3,. doi: 10.3389/fcimb.2013.00043.

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S.,

Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B.,

Meintjes, P. and Drummond, A. (2012). Geneious Basic: an integrated and

extendable desktop software platform for the organization and analysis of

sequence data. Bioinformatics (Oxford, England) 28, 1647–1649. doi:

10.1093/bioinformatics/bts199.

Kumar, S., Stecher, G. and Tamura, K. (2016). MEGA7: Molecular Evolutionary

Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and

Evolution 33, 1870–1874. doi: 10.1093/molbev/msw054.

Lewis, D. (1979). The detection of rickettsia -like microorganisms within the

ovaries of female Ixodes ricinus ticks. Zeitschrift Fur Parasitenkunde

(Berlin, Germany) 59, 295–298.

Lo, N., Beninati, T., Sassera, D., Bouman, E. a. P., Santagati, S., Gern, L., Sambri,

V., Masuzawa, T., Gray, J. S., Jaenson, T. G. T., Bouattour, A., Kenny, M. J.,

Guner, E. S., Kharitonenkov, I. G., Bitam, I. and Bandi, C. (2006).

Widespread distribution and high prevalence of an alpha-proteobacterial

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 81 symbiont in the tick Ixodes ricinus. Environmental Microbiology 8, 1280–

1287. doi: 10.1111/j.1462-2920.2006.01024.x.

Loh, S.-M., Gofton, A. W., Lo, N., Gillett, A., Ryan, U. M., Irwin, P. J. and Oskam,

C. L. (2016). Novel Borrelia species detected in echidna ticks,

Bothriocroton concolor , in Australia. Parasites & Vectors 9, 339. doi:

10.1186/s13071-016-1627-x.

Lydecker, H., Stanfield, E., Lo, N., Hochuli, D. and Banks, P. (2015). Are urban

bandicoots solely to blame for tick concerns? Australian Zoologist 37, 288–

293. doi: 10.7882/AZ.2015.008.

Lyme Disease Association of Australia (2012). Lyme disease: patient situation in

Australia in 2012. Lyme Disease Association of Australia.

Mackerras, M. J. (1959). The haematozoa of Australian mammals. Australian

Journal of Zoology 7, 105–135. doi: 10.1071/zo9590105.

Mans, B. J. and Neitz, A. W. H. (2004). Adaptation of ticks to a blood-feeding

environment: evolution from a functional perspective. Insect Biochemistry

and Molecular Biology 34, 1–17. doi: 10.1016/j.ibmb.2003.09.002.

Mariconti, M., Epis, S., Sacchi, L., Biggiogera, M., Sassera, D., Genchi, M., Alberti,

E., Montagna, M., Bandi, C. and Bazzocchi, C. (2012a). A study on the

presence of flagella in the order Rickettsiales: the case of ‘ Candidatus

Midichloria mitochondrii.’ Microbiology 158, 1677–1683. doi:

10.1099/mic.0.057174-0.

82 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Mariconti, M., Epis, S., Gaibani, P., Valle, C. D., Sassera, D., Tomao, P., Fabbi, M.,

Castelli, F., Marone, P., Sambri, V., Bazzocchi, C. and Bandi, C. (2012b).

Humans parasitized by the hard tick Ixodes ricinus are seropositive to

Midichloria mitochondrii : is Midichloria a novel pathogen, or just a marker

of tick bite? Pathogens and Global Health 106, 391–396. doi:

10.1179/2047773212Y.0000000050.

McCann, K. M., Grant, W. N., Spratt, D. M. and Hedtke, S. M. (2019). Cryptic

species diversity in ticks that transmit disease in Australia. International

Journal for Parasitology: Parasites and Wildlife 10, 125–131. doi:

10.1016/j.ijppaw.2019.08.002.

Nava, S., Guglielmone, A. A. and Mangold, A. J. (2009). An overview of

systematics and evolution of ticks. Frontiers in Bioscience (Landmark

Edition) 14, 2857–2877.

NHMRC (2018). Targeted Call for Research into Debilitating Symptom Complexes

Attributed to Ticks. National Health and Medical Research Council.

Nielsen, A. T., Liu, W.-T., Filipe, C., Grady, L., Molin, S. and Stahl, D. A. (1999).

Identification of a Novel Group of Bacteria in Sludge from a Deteriorated

Biological Phosphorus Removal Reactor. Applied and Environmental

Microbiology 65, 1251–1258.

Noda, H., Munderloh, U. G. and Kurtti, T. J. (1997). Endosymbionts of ticks and

their relationship to Wolbachia spp. and tick-borne pathogens of humans

and animals. Applied and Environmental Microbiology 63, 3926–3932.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 83 Paludan, S. R. and Bowie, A. G. (2013). Immune sensing of DNA. Immunity 38,

870–880. doi: 10.1016/j.immuni.2013.05.004.

Parola, P. and Raoult, D. (2001). Ticks and Tickborne Bacterial Diseases in Humans:

An Emerging Infectious Threat. Clinical Infectious Diseases 32, 897–928.

doi: 10.1086/319347.

Paules, C. I., Marston, H. D., Bloom, M. E. and Fauci, A. S. (2018). Tickborne

Diseases — Confronting a Growing Threat. New England Journal of

Medicine 379, 701–703. doi: 10.1056/NEJMp1807870.

Petersen, J. M., Mead, P. S. and Schriefer, M. E. (2009). Francisella tularensis : an

arthropod-borne pathogen. Veterinary Research 40, 1. doi:

10.1051/vetres:2008045.

Piesman, J. and Stone, B. F. (1991). Vector competence of the Australian paralysis

tick, Ixodes holocyclus , for the lyme disease spirochete Borrelia

burgdorferi. International Journal for Parasitology 21, 109–111. doi:

10.1016/0020-7519(91)90127-S.

Plantard, O., Bouju-Albert, A., Malard, M.-A., Hermouet, A., Capron, G. and

Verheyden, H. (2012). Detection of Wolbachia in the Tick Ixodes ricinus is

Due to the Presence of the Hymenoptera Endoparasitoid Ixodiphagus

hookeri. PLOS ONE 7, e30692. doi: 10.1371/journal.pone.0030692.

Poole, P., Ramachandran, V. and Terpolilli, J. (2018). Rhizobia: from saprophytes to

endosymbionts. Nature Reviews Microbiology 16, 291–303. doi:

10.1038/nrmicro.2017.171.

84 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Ribeiro, J. M. C. (1987). Role of Saliva in Blood-Feeding by Arthropods. Annual

Review of Entomology 32, 463–478. doi:

10.1146/annurev.en.32.010187.002335.

Roberts, F. H. S. (1970). Australian Ticks. Commonwealth Scientific and Industrial

Research Organization.

Rozen, S. and Skaletsky, H. (2000). Primer3 on the WWW for general users and for

biologist programmers. Methods in Molecular Biology (Clifton, N.J.) 132,

365–386. doi: 10.1385/1-59259-192-2:365.

Russell, R. C., Doggett, S. L., Munro, R., Ellis, J., Avery, D., Hunt, C. and Dickeson,

D. (1994). Lyme disease: a search for a causative agent in ticks in south-

eastern Australia. Epidemiology and Infection 112, 375–384.

Sacchi, L., Bigliardi, E., Corona, S., Beninati, T., Lo, N. and Franceschi, A. (2004).

A symbiont of the tick Ixodes ricinus invades and consumes mitochondria in

a mode similar to that of the parasitic bacterium Bdellovibrio bacteriovorus.

Tissue and Cell 36, 43–53. doi: 10.1016/j.tice.2003.08.004.

Sanogo, Y. O., Zeaiter, Z., Caruso, G., Merola, F., Shpynov, S., Brouqui, P. and

Raoult, D. (2003). Bartonella henselae in Ixodes ricinus Ticks (Acari:

Ixodida) Removed from Humans, Belluno Province, Italy. Emerging

Infectious Diseases journal 9,. doi: 10.3201/eid0903.020133.

Sassera, D., Beninati, T., Bandi, C., Bouman, E. A. P., Sacchi, L., Fabbi, M. and Lo,

N. (2006). ‘Candidatus Midichloria mitochondrii’, an endosymbiont of the

tick Ixodes ricinus with a unique intramitochondrial lifestyle. International

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 85 Journal of Systematic and Evolutionary Microbiology 56, 2535–2540. doi:

10.1099/ijs.0.64386-0.

Sassera, D., Lo, N., Bouman, E. A. P., Epis, S., Mortarino, M. and Bandi, C. (2008).

“Candidatus midichloria” endosymbionts bloom after the blood meal of the

host, the hard tick Ixodes ricinus. Applied and Environmental Microbiology

74, 6138–6140. doi: 10.1128/AEM.00248-08.

Sassera, D., Lo, N., Epis, S., D’Auria, G., Montagna, M., Comandatore, F., Horner,

D., Peretó, J., Luciano, A. M., Franciosi, F., Ferri, E., Crotti, E., Bazzocchi,

C., Daffonchio, D., Sacchi, L., Moya, A., Latorre, A. and Bandi, C. (2011).

Phylogenomic Evidence for the Presence of a Flagellum and cbb3 Oxidase in

the Free-Living Mitochondrial Ancestor. Molecular Biology and Evolution

28, 3285–3296. doi: 10.1093/molbev/msr159.

Schneider, C. A., Rasband, W. S. and Eliceiri, K. W. (2012). NIH Image to ImageJ:

25 years of image analysis | Nature Methods. https://www.nature.com.

Singh, S. K. and Girschick, H. J. (2003). Tick-host interactions and their

immunological implications in tick-borne diseases.

Sonenshine, D. E. and Roe, R. M. (2013). Biology of ticks, 2nd Edn. Oxford

University Press.

Souza, C. E., Moraes-Filho, J., Ogrzewalska, M., Uchoa, F. C., Horta, M. C., Souza,

S. S. L., Borba, R. C. M. and Labruna, M. B. (2009). Experimental infection

of capybaras Hydrochoerus hydrochaeris by Rickettsia rickettsii and

evaluation of the transmission of the infection to ticks Amblyomma

86 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

cajennense. Veterinary Parasitology 161, 116–121. doi:

10.1016/j.vetpar.2008.12.010.

Stone, B. F., Binnington, K. C., Gauci, M. and Aylward, J. H. (1989). Tick/host

interactions for Ixodes holocyclus: Role, effects, biosynthesis and nature of its

toxic and allergenic oral secretions. Experimental & Applied Acarology 7,

59–69. doi: 10.1007/BF01200453.

Summersgill, B. M. and Shipley, J. M. (2010). Fluorescence In Situ Hybridization

Analysis of Formalin Fixed Paraffin Embedded Tissues, Including Tissue

Microarrays. In Fluorescence in situ Hybridization (FISH): Protocols and

Applications (ed. Bridger, J. M. and Volpi, E. V.), pp. 51–70. Humana Press,

Totowa, NJ doi: 10.1007/978-1-60761-789-1_4.

Taylor, M. J., Bandi, C. and Hoerauf, A. (2005). Wolbachia bacterial endosymbionts

of filarial nematodes. Advances in Parasitology 60, 245–284. doi:

10.1016/S0065-308X(05)60004-8.

Toft, C. and Fares, M. A. (2008). The Evolution of the Flagellar Assembly Pathway

in Endosymbiotic Bacterial Genomes. Molecular Biology and Evolution 25,

2069–2076. doi: 10.1093/molbev/msn153.

Turvey, S. E. and Broide, D. H. (2010). Innate Immunity. The Journal of allergy and

clinical immunology 125, S24–S32. doi: 10.1016/j.jaci.2009.07.016. van Nunen, S. (2015). Tick-induced allergies: mammalian meat allergy, tick

anaphylaxis and their significance. Asia Pacific Allergy 5, 3–16. doi:

10.5415/apallergy.2015.5.1.3.

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 87 van Nunen, S. A. (2018). Tick-induced allergies: mammalian meat allergy and tick

anaphylaxis. The Medical Journal of Australia 208, 316–321.

Vieux, E. F., Kwok, P.-Y. and Miller, R. D. (2002). Primer Design for PCR and

Sequencing in High-Throughput Analysis of SNPs. BioTechniques 32, S28–

S32. doi: 10.2144/jun0202.

Wills, M. C. and Barry, R. D. (1991). Detecting the cause of Lyme disease in

Australia. The Medical Journal of Australia 155, 275.

Wilske, B. (2003). Diagnosis of Lyme Borreliosis in Europe. Vector-Borne and

Zoonotic Diseases 3, 215–227. doi: 10.1089/153036603322662200.

Yang, R., Murphy, C., Song, Y., Ng-Hublin, J., Estcourt, A., Hijjawi, N., Chalmers,

R., Hadfield, S., Bath, A., Gordon, C. and Ryan, U. (2013). Specific and

quantitative detection and identification of Cryptosporidium hominis and C.

parvum in clinical and environmental samples. Experimental Parasitology

135, 142–147. doi: 10.1016/j.exppara.2013.06.014.

Zhang, J. X., Fang, J. Z., Duan, W., Wu, L. R., Zhang, A. W., Dalchau, N.,

Yordanov, B., Petersen, R., Phillips, A. and Zhang, D. Y. (2018). Predicting

DNA Hybridization Kinetics from Sequence. Nature chemistry 10, 91–98.

doi: 10.1038/nchem.2877.

Zhu, Z., Aeschlimann, A. and Gern, L. (1992). Rickettsia-Like Microorganisms in

the Ovarian Primordia of Molting Ixodes ricinus (acari, Ixodidae) Larvae and

Nymphs. Annales De Parasitologie Humaine Et Comparee 67, 99–110. doi:

10.1051/parasite/199267499.

88 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Appendices

Table A1.1: Nanodrop results of nine samples with extraction blanks

Date Sample Nucleic A260/A280 A260/A230 A260 A280 Nucleic Baseline Baseline Name Acid(ng/uL) Acid Correction Absorbance Factor (nm) 6/5/2019 Man1.tick 43.879 1.934 1.305 0.878 0.454 50 340 0.059 11:11:01 AM 6/5/2019 Man2.tick 144.819 2.032 1.761 2.896 1.425 50 340 0.142 11:11:44 AM 6/5/2019 Man3.tick 54.133 1.935 1.197 1.083 0.56 50 340 0.112 11:12:10 AM 6/5/2019 Man1.blood 55.109 1.729 0.887 1.102 0.638 50 340 0.031 11:12:54 AM 6/5/2019 Man2.blood 86.293 1.73 0.98 1.726 0.998 50 340 0.038 11:13:32 AM 6/5/2019 Man3.blood 22.467 1.425 0.294 0.449 0.315 50 340 0.063 11:13:58 AM 6/5/2019 Man1.tissue 23.335 1.746 0.614 0.467 0.267 50 340 0.074 11:14:22 AM 6/5/2019 Man2.tissue 780.999 1.778 1.832 15.62 8.787 50 340 0.329 11:14:45 AM 6/5/2019 Man3.tissue 24.435 1.808 0.543 0.489 0.27 50 340 0.068 11:15:12 AM

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 89

fit Model Substitution - (Assay5) (Assay5) Best

16S Table A1.2: 1332 bp

90 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

(Assay5) Genetic distance, complete table. complete distance, (Assay5) Genetic

16S A1.3: 1332 bp

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 91

fit Substitution Model Substitution fit - (Assay5) Best

16S A1.4: 1051 bp

92 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

(Assay5) Genetic distance, complete table. complete distance, (Assay5) Genetic

16S A1.5: 1051 bp

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 93

fit Substitution Model Substitution fit - (Assay 1) Best

16S A1.6:

94 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

(Assay 1) Genetic distance, complete table. complete distance, (Assay 1) Genetic

16S A1.7:

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 95

fit Substitution Model Substitution fit - gene loci Best loci gene

GltA A1.8:

96 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

gene loci Genetic distance, complete table. complete distance, Genetic loci gene

GltA A1.9:

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 97

fit Substitution Model Substitution fit - gene loci Best loci gene

GyrB Table A.1.10: Table

98 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

gene Genetic distance, complete table. complete distance, Genetic gene

GyrB Table A1.11: Table

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 99

fit Substitution Model Substitution fit - Table A1.12: Concatenated gene Best gene A1.12: Concatenated Table

100 Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii

Table A1.13: Concatenated gene Genetic distance, complete table. complete distance, Genetic gene A1.13: Concatenated Table

Morphological & Molecular Characterisation of Candidatus Midichloria mitochondrii 101