Splicing of Adjacent Genes Regulates Prostate Cancer Cell Proliferation

Published OnlineFirst June 19, 2012; DOI: 10.1158/2159-8290.CD-12-0042

RESEARCH BRIEF Chimeric Transcript Generated by cis- Splicing of Adjacent Genes Regulates Prostate Cancer Cell Proliferation

Yanmei Zhang, Mei Gong, Huiling Yuan, Hong G. Park, Henry F. Frierson, and Hui Li

ABSTRACT Gene fusion is a common event in cancer. The fusion RNA and protein products often play causal roles in tumorigenesis and therefore represent ideal diagnostic and therapeutic targets. Formerly, fusion chimeric products in cancer were thought to be produced solely by chromosomal translocation. Here, we show that a chimeric SLC45A3-ELK4 RNA is generated in the absence of chromosomal rearrangement. We showed that it is not a product of RNA trans- splicing, but formed by cis-splicing of adjacent genes/read-through. The binding of CCCTC-binding factor (CTCF) to the insulator sequences inversely correlates with the expression of the chimera transcript. The SLC45A3-ELK4 fusion, but not wild-type, ELK4 plays important roles in regulating cell growth in both androgen-dependent and -independent prostate cancer cells. The level of the chimeric transcript correlates with disease progression, with the highest levels in prostate cancer metastases. Our results suggest that gene fusions can arise from cis-splicing of adjacent genes without corresponding DNA changes.

SIGNIFICANCE: With the absence of corresponding DNA rearrangement, chimeric fusion SLC45A3-ELK4 transcript in prostate cancer cells is generated by cis-splicing of adjacent genes/gene read-through instead of trans-splicing. SLC45A3-ELK4 controls prostate cancer cell proliferation, and the chimera level correlates with prostate cancer disease progression. Cancer Discov; 2(7); 1–10. ©2012 AACR.

INTRODUCTION by abundant experimental evidence, these chimeric products are most often causally related to the neoplastic behavior of the Gene fusions are common features of human tumors (1–3). tumors containing them. For many years, the assumption has Individual examples of gene fusions are usually characteristic of been that the only mechanism by which a chimeric gene fusion specifi c subtypes of tumors and have become important diag- product can be generated is chromosomal rearrangement. Two nostic markers over the last several decades. As has been shown recent studies reported the detection by reverse transcriptase PCR (RT-PCR) of a chimeric transcript joining the 5′-end of Authors’ Affi liation: Department of Pathology, University of Virginia, RNA from solute carrier family 45, member 3 (SLC45A3) to the Charlottesville, Virginia 3′-end of RNA from the ETS-domain protein SRF accessory Note: Supplementary data for this article are available at Cancer Discov- protein 1 (ELK4) in prostate cancer (4, 5). Although several ery Online (http://cancerdiscovery.aacrjournals.org/). forms of SLC45A3-ELK4 RNA were amplifi ed, a major form Current address for M. Gong: Department of Pediatrics, University of consists of exon 1 of SLC45A3 joined to the last 4 exons of ELK4. Virginia, Charlottesville, VA 22908. These 2 genes are located adjacent to each other on chromo- Corresponding Author: Hui Li, Department of Pathology and Cancer some 1 band q32. FISH, array comparative genomic hybridi- Center, University of Virginia, Charlottesville, VA 22908. Phone: 434-982- zation (CGH), or quantitative PCR (qPCR) for copy number 6680; Fax: 434-243-7244; E-mail: [email protected] variance did not detect obvious deletion of the genomic DNA doi: 10.1158/2159-8290.CD-12-0042 between the 2 genes (4, 5), leaving the possibility of reciprocal ©2012 American Association for Cancer Research. chromosomal rearrangement or posttranscriptional changes.

JULY 2012CANCER DISCOVERY | OF1

RESEARCH BRIEF Zhang et al.

Here, we conducted extensive Southern blot analysis to colleagues (5). If true, the trans-splicing machinery in cells further rule out the possibility of DNA rearrangement and that express SLC45A3-ELK4 could then use foreign premature showed the presence of the fusion transcript with a non–RT- RNAs as substrates to generate chimeric transcripts com- PCR–based assay. We showed that the fusion transcript, but posed of both endogenous and foreign RNA, as in the case not wild-type, ELK4 played an important role in regulating of JAZF1-JJAZ1 (8). We thus conducted in vitro trans-splicing prostate cancer cell proliferation, both in androgen-dependent assay using nuclear extracts of LNCaP cells and CV-1 green and -independent cell lines. Importantly, the level of the monkey kidney cells. Single-nucleotide polymorphisms in fusion transcript correlates with prostate cancer disease pro- the ELK4 segment allowed us to distinguish the donors. gression. In studying the mechanism, we found that the Using a monkey-specifi c reverse primer that anneals within fusion transcript is not a product of RNA trans-splicing as the ELK4 segment, we could not detect any trans-spliced RNA originally suggested (5). Instead, we observed the presence of product composed of monkey ELK4 (Fig. 1C), even though intergenic transcript and an inverse correlation between the both LNCaP and CV-1 nuclear extracts were active as shown binding of CCCTC-binding factor (CTCF) to the gene bound- by PCR amplifi cation in the presence of ATP using other sets ary insulators and the level of the SLC45A3-ELK4 fusion tran- of primers (Fig. 1C). script. Of note, CTCF had the opposite effect on trans-spliced Because SLC45A3 and ELK4 are neighboring genes located JAZF1-JJAZ1 RNA. In summary, the data presented here pro- in the same chromosomal region, we suspected that the chi- vide evidence that active cis-splicing of adjacent genes (cis- meric transcript could be a product of cis-splicing of adjacent SAGe) could be suffi cient to generate gene fusion products genes (cis-SAGe), where a premature RNA is transcribed across without a corresponding chromosomal rearrangement at the the gene boundary and exons belonging to SLC45A3 and ELK4 DNA level and that such fusion products may play important are spliced together. To investigate, we used various primer functional roles in cancer cells. pairs to amplify transcripts on ELK4, SLC45A3, and intergenic regions between SLC45A3 and ELK4. No product was detected if avian myeloblastosis virus (AMV) reverse transcriptase RESULTS was omitted, suggesting the absence of DNA contamination The chimeric RNA SLC45A3-ELK4 can be detected at much (Fig. 2A). Intergenic transcripts were detected with primer higher levels in the prostate cancer cell lines LNCaP and pairs 7 and 8 and were induced with the treatment of R1881, PC3 than in non-neoplastic prostate epithelial cells such as similar to the chimeric SLC45A3-ELK4 transcript (Fig. 2A). RWPE-1 and PrEC (Supplementary Fig. S1). To investigate Insulators between the neighboring genes act as bounda- the mechanism by which the chimeric SLC45A3-ELK4 tran- ries to protect a gene against the encroachment of adja- script is generated, we fi rst examined the prostate cancer cent inactive condensed chromatin or against the activating cell line LNCaP. Treatment of cells with the synthetic andro- infl uence of distal enhancers associated with other genes (9). gen R1881 resulted in an increased level of the SLC45A3- Insulator activity is controlled mainly by CTCF. Chromatin ELK4 chimera, similar to wild-type SLC45A3 (Supplementary immunoprecipitation (ChIP) combined with high-throughput Fig. S2A). The increase was dependent on the androgen recep- sequencing has identifi ed 2 insulator sequences existing in tor in LNCaP cells (Supplementary Fig. S2B), as knocking between the SLC45A3 and ELK4 genes (10). Using ChIP, we down androgen receptor by siRNA abolished induction of validated CTCF binding to these 2 insulators (Supplemen- the chimeric RNA in the presence of R1881. The androgen tary Fig. S3). If the chimeric RNA is generated by a cis-SAGe induction and androgen receptor dependence of the chimeric mechanism, an inverse correlation between CTCF binding RNA resembles that of SLC45A3. To rule out a possible arti- to the insulators and fusion RNA expression is anticipated. fact caused by RT-PCR, we tested the existence of the chimeric While SLC45A4-ELK4 RNA level was induced by R1881 in RNA by RNAse protection using a hybridization probe, span- LNCaP cells, qPCR indeed detected signifi cantly less bind- ning the junction of the SLC45A3 and ELK4 RNA. Using this ing of CTCF to insulator 1 (INSUL_ZHAO01741), shown in method, chimeric RNA was easily detected in LNCaP cells Fig. 2B. Similarly, a signifi cant reduction in binding of CTCF and at increased levels after treatment with R1881. Essen- to insulator 2 (INSUL_ZHAO01740) was also observed. tially, very little chimeric RNA was detected in RWPE-1. No To confi rm this effect on SLC45A3-ELK4 expression, we signal of the chimera was detected in its derivative cell line used siRNA to silence CTCF expression. Chimeric SLC45A3- WPE1-NB26, or in normal placenta control (Fig. 1A). ELK4 expression was signifi cantly upregulated by siCTCF in To determine whether genomic DNA rearrangements androgen-deprived LNCaP cells (Fig. 2C), consistent with might be responsible for the chimeric RNA, we scanned the the hypothesis that the binding of CTCF to insulators pre- entire 60-kb region between exon 1 of SLC45A3 and exon 2 of vents basal levels of transcription through the boundary ELK4 by Southern blot analysis (Fig. 1B). Three representa- of the SLC45A3 and ELK4 genes. This effect was specifi c to tive Southern blot analyses are shown in Fig. 1B. No evidence the SLC45A3-ELK4 transcript because wild-type SLC45A3 and of abnormal DNA rearrangement was observed, even after ELK4 transcripts were slightly downregulated by siCTCF induction by androgen treatment (Fig. 1B). (Supplementary Fig. S4), arguing against the possibility of a Recently, we showed that JAZF1-JJAZ1 fusion RNA in general effect on cis-splicing caused by hormone deprivation. endometrial stromal cells is generated through a mecha- In the presence of androgen, knocking down CTCF had no nism involving RNA trans-splicing (6, 7). The presence of obvious effect on the expression of the chimera (Fig. 2C), pre- the chimeric RNA and absence of DNA level rearrangement sumably because the binding of CTCF to the insulators was suggested that SLC45A3-ELK4 might be generated by trans- reduced (Fig. 2B). CTCF was found to mediate interchromo- splicing. This possibility was also suggested by Rickman and somal interactions between the Igf2/H19 imprinting control

OF2 | CANCER DISCOVERYJULY 2012 www.aacrjournals.org

SLC45A3-ELK4 Controls Prostate Cancer Cell Proliferation RESEARCH BRIEF

A Figure 1. A, SLC45A3-ELK4 chimeric RNA in LNCaP cells detected by RNAse protection assay (RPA). RNAs from LNCaP cells, LNCaP cells treated with R1881, RWPE-1WPE1-NB26PlacentaLNCaPLNCaPLNCaP + R1881 + R1881 RWPE-1, WPE1-NB26, and a normal SLC45A3-ELK placenta were extracted and hybridized to an antisense probe spanning the fusion ELK4 junction. Besides the wild-type SLC45A3 and ELK4 bands, an additional band around HindIII T7 150 bp was detected in LNCaP cells. The SLC45A3 ELK4 signal was stronger in LNCaP cells treated with R1881. In contrast, only wild-type 49 bp 104 bp transcripts were detected in RWPE-1 and WPE1-NB26 cells. No band was detected RNase protection assay in normal placenta control because of the absence of both SLC45A3 and ELK4 transcription in placenta. B, lack of DNA rearrangement at SLC45A3 and ELK4 loci shown by Southern blot analysis. Genomic SLC45A3 DNAs from a normal placenta control, LNCaP cells, and LNCaP cells treated with R1881 were extracted. Representative B Probe 1 Probe 10 Probe 4 results for probes 1, 4, and 10 are shown. Without DNA rearrangement, these probes should hybridize to DNA fragments of 6 kb (probe 1), 7.5 kb (probe 10), and 0.5 PlacentaLNCaPLNCaP + R1881 Placenta LNCaP LNCaP + R1881 PlacentaLNCaP LNCaP + R1881 and 0.8 kb (probe 4). C, SLC45A3-ELK4 6 kb is not a product of RNA trans-splicing. The underlined codes represent nucle- 10 kb 3 kb otide polymorphisms between human and 6 kb monkey on ELK4. In the in vitro trans- 4 kb 1 kb splicing assay, if trans-splicing occurred, a 3 kb chimera containing monkey ELK4 would be 0.5 kb detected with the common forward primer SLC45A3-181F and the monkey-specifi c ELK4 reverse primer. Human-specifi c Southern blot analysis reverse primer paired with SLC45A3-181F SLC45A3 ELK4 gave a stronger signal in the presence of 6 kb 0.5 kb 0.8 kb 7.5 kb ATP, as did the ELK4 forward and monkey- specifi c reverse primer pair, suggesting that the nuclear extracts from LNCaP and Probe 1Probe 4 Probe 10 CV-1 were both active.

C 181F Reverse primer LNCaP SLC45A3 ELK4 polymorphism CV-1

LNCaP CV-1

+ATP LNCaP-LNCaP LNCaP-CV-1 ELK4-1201F + Human 181F + human reverse primer Human 181F + monkey reverse primer monkey reverse primer Treatment + + – – H O LNCaP monkey + + – – H O LNCaP monkey + + Monkey LNCaP H O R1881 M 2 2 2 + – + – cDNA cDNA + – + – cDNA cDNA + – cDNA cDNA ATP

In vitro trans-splicing assay

region on chromosome 7 and the Wsb1/Nf1 gene complex on experiments with siRNA designed to specifi cally reduce chromosome 11 (11). CTCF has also been found to play a role expression of the chimeric transcript. siRNA against the in bringing distal intrachromosomal and interchromosomal luciferase gene transcript was used as a negative control regions into proximity (8, 11), which prompted us to speculate (12). Two siRNAs against SLC45A3-ELK4 RNA, siSE1 and on its role in facilitating trans-splicing events. Indeed, when we siSE2 (Supplementary Fig. S5), were very effective in silenc- silenced CTCF in endometrial stromal cells, the JAZF1-JJAZ1 ing the chimeric RNA, with minimal, if any, effects on the chimeric RNA level went down, unlike SLC45A3-ELK4 expres- wild-type, parental transcripts of either SLC45A3 or ELK4 sion, further indicating that SLC45A3-ELK4 is generated by a (Fig. 3A). LNCaP cells transfected with each of these 2 siRNAs mechanism different from trans-splicing (Fig. 2D). had signifi cantly less cell proliferation as refl ected by MTT To determine whether SLC45A3-ELK4 RNA has a biologic assay (Fig. 3B) and cell counting (Fig. 3C). Inhibition of cell function in prostate cancer cells, we carried out knockdown proliferation did not occur when the LNCaP cells were in

JULY 2012CANCER DISCOVERY | OF3

RESEARCH BRIEF Zhang et al.

A LNCaP H2O C R1881 – + – + Placenta AMV – – + + DNA SLC45A3-ELK4 12 10 RNA extract 4 8 probes exons ** 2 2 4 3 DNase treatment 5 5 4 SLC45A3 1

6 5 0 +AMV –AMV 6 CTCF 1.2 0.8 Transcription 7 Normalized transcript amount 0.4 7 0 si- siCTCF si- siCTCF + R1881 + R1881 + EtOH + EtOH PCR PCR 8 8

1 9 9 ELK4

B D

CTCF CTCF JAZF1-JJAZ1 1.5 SLC45A3 ELK4 1 INSUL_ZHAO01741 INSUL_ZHAO01740 0.5 SLC45A3-ELK4 ChIP 8 0 12 * 7 LNCaP + R1881 LNCaP + EtOH 1.2 CTCF 9 6 5 0.9 6 4 0.6 3 * CTCF affinity 0.3

3 2 Normalized transcript amount 1 0 0 0 si- siCTCF

Normalized transcript amount LNCaP LNCaP INSUL_ZHAO01741 INSUL_ZHAO01740 + R1881 + EtOH

Figure 2. Chimeric SLC45A3-ELK4 is generated by cis-SAGe. A, RT-PCR demonstrated that intergenic pre-mRNA between SLC45A3 and ELK4 was present and induced by androgen. The location of the primers is shown on the right. Pairs of primer 4, 5, 6, and 9 are located on exons or introns of SLC45A3 and ELK4. Pairs of primer 7 and 8 are located between SLC45A3 and ELK4. Left, the experimental design. Placental DNA was used as positive control. The electrophoresis images are the representative results of more than 3 replicates. B, ChIP assay to investigate CTCF binding on insulators between SLC45A3 and ELK4. Two insulators are located 3′ of SLC45A3 and 5′ of ELK4. Insulator1: chr1: 203893201-203895199; Insulator 2: chr1: 203866801-203869599. The right graph shows comparison of the ChIP amount of the insulator DNA between R1881-treated (red) and ethanol-treated LNCaP cells (green). The left graph shows the chimeric SLC45A3-ELK4 RNA expression in samples harvested parallel with the samples for ChIP assay. *, P < 0.05 (Student t test). C, SLC45A3-ELK4 upregulation by CTCF silencing. CTCF knockdown by siRNA was conducted in LNCaP cells. After 24 hours, the medium was changed to androgen-deprived medium for another 48 hours. RNA was harvested after 6 hours of R1881 or ethanol treatment. Bottom. signifi cant knockdown of CTCF expression. Top, SLC45A3-ELK4 expression. **, P < 0.005 (Student t tests). D, JAZF1-JJAZ1 downregulation by CTCF silencing. Fold change describes the gene regulation compared with si- control. androgen-depleted medium (Fig. 3B and C), indicating that the wild-type ELK4 transcript. The growth inhibition could the chimeric SLC45A3-ELK4 is required only for androgen be rescued in both LNCaP and PC3 cells (Fig. 3D). However, receptor–dependent proliferation and not basal growth in ELK4 overexpression (Supplementary Fig. S5) could not res- LNCaP. This is consistent with the observation that the cue the phenotype (Fig. 3D). chimeric product is androgen-regulated in LNCaP cells. To determine whether SLC45A3-ELK4 transcript had any These 2 siRNAs also specifi cally silenced the chimeric tran- relevance to clinical human prostate cancer, we quantifi ed script in the androgen-independent prostate cancer line PC3 the level of chimeric RNA in 10 normal prostate samples (Fig. 3A). Silencing SLC45A3-ELK4 RNA in PC3 cells slowed and 29 prostate cancer specimens (Fig. 3E). Notably, the down cell proliferation under regular growth conditions as median values of prostate cancer samples were much higher well as under androgen-deprived conditions (Fig. 3B and than those of the normal samples. Overall, the chimeric RNA C). These results are consistent with SLC45A3-ELK4 acting levels correlated with the important measure of biologic on cell growth in the signaling pathway downstream of the behavior, Gleason score. Prostate cancers with Gleason score androgen receptor. To make sure that the growth inhibition 7 and higher had signifi cantly higher median SLC45A3- was not due to siRNA off-target effects, we transfected an ELK4 expression values than in those with Gleason score 6. SLC45A3-ELK4 overexpression plasmid (Supplementary Prostate cancer metastases had the highest median values, Fig. S4) into siSE1-treated cells, which had a lesser effect on suggesting the possibility that the chimeric RNA could be

OF4 | CANCER DISCOVERYJULY 2012 www.aacrjournals.org

SLC45A3-ELK4 Controls Prostate Cancer Cell Proliferation RESEARCH BRIEF

AESLC45A3-ELK4 SLC45A3 ELK4 SLC45A3-ELK4 1.2 1.2 1.2 ** 0.9 0.9 0.9 10–1 ** 0.6 0.6 0.6 10–2 ** amount LNCaP 0.3 0.3 0.3 10–3 0 0 0 –4

Normalized transcript 10 si- siSE1 siSE2 si- siSE1 siSE2 si- siSE1 siSE2 10–5 SLC45A3-ELK4 SLC45A3 ELK4 1.2 1.2 1.2 10–6

0.9 0.9 0.9 amount Transcript 10–7 0.6 0.6 0.6 10–8 PC3 amount 0.3 0.3 0.3

0 0 0 –0 SLC45A3 Normalized transcript F 10 si- siSE1 siSE2 si- siSE1 siSE2 si- siSE1 siSE2 10–1 B LNCaP MTT PC3 MTT –2 0.5 0.5 10 –3 0.4 0.4 10

nm –4 0.3 0.3 10

570 0.2 0.2 10–5 –6 OD 0.1 0.1 10

0 0 amount Transcript 10–7 si- siSE1 siSE2 si- siSE1 siSE2 si- siSE1 siSE2 si- siSE1 siSE2 –8 Regular media Androgen-deprived Regular media Androgen-deprived 10 –9 C LNCaP cell counting PC3 cell counting 10 100 40 G 1 10 ELK4 80 30 100 60 –1 20 10

cells/mL 40 –2 4 10 10 20 10–3 × 10 0 0 –4 si- siSE1 siSE2 si- siSE1 siSE2 si- siSE1 siSE2 si- siSE1 siSE2 10 Regular media Androgen-deprived Regular media Androgen-deprived 10–5 10–6 D amount Transcript 10–7 40 LNCaP cell counting PC3 cell counting 15 ELK4 10–8 –9 30 12 SLC45A3-ELK4 10 9 20

6 Gleason 6 Gleason 7 Metastasis Cell number Cell number 10 3 Normal prostate

0 0 si- siSE1 si- siSE1 Gleason 8–10 (primary)

Figure 3. Silencing of SLC45A3-ELK4 RNA inhibits cell growth. A, LNCaP and PC3 cells were transfected with siRNA targeting luciferase gene transcript Gl2 (si-) or 2 siRNAs targeting the chimeric RNA (siSE1 and siSE2). RNA was harvested 48 hours later. The chimeric and parental transcripts were monitored by real-time PCR. Transcript amount was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Compared with the negative control, both siSE1 and siSE2 effectively knocked down the chimera with minimum effect on wild-type SLC45A3 and ELK4. B, MTT assay to monitor cell growth. LNCaP and PC3 cells were transfected with si-, siSE1, and siSE2. For the regular media group, an MTT assay was conducted 4 days after transfection. In both LNCaP and PC3 cells, silencing of the chimeric RNA slowed cell proliferation. For the androgen-deprived group, 24 hours after transfection, culture media were changed to media containing charcoal-stripped serum instead of regular serum for an additional 3 days. No effect was observed in LNCaP cells, but obvious growth inhibition was still present in PC3 cells. C, cell counting to monitor cell growth. Cells grown on 6-well plates were transfected with the same set of siRNAs and grown in the same culture conditions as above. Cells were trypsinized, and viable cells were counted with trypan blue staining using a hemocytometer. D, growth inhibition can be rescued by infecting the virus encoding SLC45A3-ELK4, but not by the virus encoding ELK4. E, median value of SLC45A3-ELK4 chimeric RNA correlates with prostate cancer Gleason score. Real-time PCR assay by using TaqMan probe to detect the expression of SLC45A3-ELK4 in 10 normal prostate tissues and 29 prostate cancer samples (5 with Gleason score 6, 5 with Gleason score 7, 11 with Gleason score 8 to 10, and 8 with metastasis). F and G, SYBR mix was used to detect the parental SLC45A3 and ELK4. Expression level was normalized against 18S RNA.

used as a diagnostic/prognostic marker. No similar cor- mentary Fig. S6), did not induce the same cell-cycle arrest relation of wild-type SLC45A3 or ELK4 expression with the (Fig. 4A). As high levels of CDKN1A (p21) have been known to Gleason score was observed (Fig. 3F and G), indicating that cause G1–S arrest, we used real-time PCR to monitor p21 RNA the chimeric RNA is not a speciﬁ c splicing product of excess levels in these cells. p21 was indeed upregulated in LNCaP wild-type transcripts. cells transfected with siSE1 and siSE2, but not with siELK4 To gain insight into the nature of SLC45A3-ELK4–mediated (Fig. 4B). cell growth regulation, we conducted cell-cycle analysis fol- We then conducted microarray analysis using RNA extracted lowing SLC45A3-ELK4 knockdown. LNCaP cells transfected from LNCaP cells transfected with si-, siSE1 and siSE2. A

with siSE1 had a signifi cantly higher percentage of G1 phase cluster of 35 genes including p21 was found to be up or down- and lower percentage of S-phase cells (Fig. 4A). Increased cell regulated by SLC45A3-ELK4 knockdown (Fig. 4C). Ten of death was not obvious by propidium iodide staining. Inter- 12 genes/transcripts were subsequently confi rmed by real- estingly, an siRNA targeting ELK4, which effectively silenced time qPCR to be signifi cantly affected by siRNA against wild-type ELK4 without affecting SLC45A3-ELK4 (Supple- SLC45A3-ELK4 (Fig. 4D). Among these genes, the expression

JULY 2012CANCER DISCOVERY | OF5

RESEARCH BRIEF Zhang et al.

A B LNCaP p21 expression 3

Sample LNCaP si- LNCaP siSE1 2 LNCaP siELK4

Normalized transcript amount 0 0 200 400 600 800 1,000 si- siSE1 siSE2 siELK4 CD si- siSE1 siSE2 7920123; S100A10 7957962; SPIC 7905088; HIST2H2AC 7933855; RTKN2 3 si- 8124518; HIST1H2AJ 7984380; IQCH siSE1 7955441; METTL7A 8056250; GCG 8109194; SLC26A2 siSE2 8151101; MYBL1 7965873; IGF1 8058591; ACADL 2 8000799; GDPD3 8146130; GINS4 7919055; HMGCS2 7899187; HMGN2 7982204; HMGN2 8000409; HMGN2 7930870; TOMM22 8008598; PCTP 1 8073032; TOMM22 7937952; OR51E1 7919067; REG4 8151890; TP53INP1 8026954; PIK3R2 Normalized transcript amount 8133688; SNORA14A 8134091; CLDN12 8119088; CDKN1A 0 7958051; ASCL1 7999419; DEXI 7982185; DEXI DEXI PCTP REG4 7986685; MYBL1 PIK3R2 ATOH1 CLDN12 CDKN1A HMGN2 8096461; HMGCS2 TP53INP1 S100A10 8130003; SF3B5 LOC390007SNORA14A 8066493; SLPI

Figure 4. A, cell-cycle analysis. LNCaP cells were transfected with si-, siSE1, and siELK4. Five days after transfection, cells were harvested, fi xed, and stained by propidium iodide for cell-cycle analysis. B, p21 was upregulated with the silencing of SLC45A3-ELK4, not by ELK4 silencing. C, microarray analysis on si-, siSE1, and siSE2 in LNCaP cells. Human Genome 1.0 ST Array (Affymetrix) was used for microarray analysis. Hierarchical clustering of a list of genes compiled using the criteria of at least 2-fold change compared with control (si-). D, genes with high expression differences were chosen to be reexamined by real-time PCR. Fold change is described by the gene expression relative to si- control. Gene expression was normalized to glyceraldehyde- 3-phosphate dehydrogenase (GAPDH). of p21 and S100A10 was not affected by siELK4 (Fig. 4B and involving 2 adjacent genes (14, 15). No functional role of data not shown). these chimeras has yet been identifi ed and the underlying In addition to prostate cancer cells, SLC45A3-ELK4 could mechanism remains elusive (13, 15). The terms “gene read- also be detected in HCT116, 293T, and HeLa cells but not in through” and “co-transcription and intergenic splicing” have the lung cancer cell lines H520 and A549 (Fig. 5A). Similar been used to describe these chimeric RNAs that join neigh- to LNCaP and PC3 cells, silencing SLC45A3-ELK4 with siSE1 boring gene fragments. However, “gene read-through” was slowed down cell growth in 293T cells as shown by cell counting originally used to describe protein translation processes that and MTT (Fig. 5B). In contrast, no effect on cell proliferation skip the stop codon. “Co-transcription and intergenic splic- was observed with siSE1 in HCT116 cells (Fig. 5C), suggesting ing” does not differentiate trans-splicing events from events cell-type–specifi c effects of silencing the chimeric transcript. involving transcription through gene boundaries that result in splicing of exons from different genes. To differentiate the latter type of event from trans-splicing, we use the term “cis- DISCUSSION splicing of adjacent genes” in this communication. Judging Chimeric RNAs containing exons of neighboring genes by sequence alone, it is impossible to discern these 2 types have been considered rare in mammalian cells, with only a of events. In fact, RNA trans-splicing may also have a higher handful of examples experimentally identifi ed (13). Recent incidence rate among genes that are close to each other (15). studies incorporating systematic in silico analysis and paired- SLC45A3 and ELK4 are found in the same chromosomal end RNA sequencing have identifi ed many chimeric RNAs region, 1q32, with about 60 kb separating SLC45A3 exon

OF6 | CANCER DISCOVERYJULY 2012 www.aacrjournals.org

SLC45A3-ELK4 Controls Prostate Cancer Cell Proliferation RESEARCH BRIEF

A SLC45A3-ELK4 5

Normalized transcript amount 0 LNCaP HCT116 293T HeLa H520 A549

B SLC45A3-ELK4 Cell counting MTT 80 1.2 0.25 60 0.2 0.8 nm 0.15 40 570 293T 0.1

0.4 OD

Cell number 20 0.05

0 0 0

Normalized transcript amount si- siSE1 si- siSE1 si- siSE1

C SLC45A3-ELK4 Cell counting MTT 80 1.6 1.5 1.2 1.2 60 nm

0.9 0.8 40 570 0.6 HCT116 OD

0.4 Cell number 20 0.3

0 0 0

Normalized transcript amount si- siSE1 si- siSE1 si- siSE1

Figure 5. A, real-time PCR assay using TaqMan probe to detect the expression of SLC45A3-ELK4 in LNCaP, HCT116, 293T, HeLa, H520, and A549 cell lines. Transcript amount was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The level of SLC45A3-ELK4 in LNCaP was set to 1. B, in 293T cells, siSE1 silenced SLC45A3-ELK4 and slowed down cell growth as measured by cell counting and MTT. C, in HCT116 cells, siSE1 silenced SLC45A3-ELK4, but resulted in no obvious growth inhibition as measured by cell counting and MTT.

1 and ELK4 exon 2. One possible mechanism to gener- detect chimeric RNAs fusing human and monkey SLC45A3 ate the fusion is through chromosomal deletion, as in the and ELK4 transcripts, (ii) RNAs were transcribed from inter- case of TMPRSS2-ERG (16). Two groups that identifi ed the genic regions, (iii) CTCF binds to the insulators between SLC45A3-ELK4 fusion failed to fi nd such a deletion (4, 5). the 2 genes and the binding was reduced in the presence However, the approaches used previously were not suffi - of androgen, and (iv) knocking down CTCF induced the cient to detect reciprocal chromosomal translocations. In expression of the chimeric SLC45A3-ELK4 RNA. It is also addition, the detection of the fusion transcript was solely interesting to note that knockdown of CTCF caused the based on RT-PCR, which is known to cause artifacts. In fact, opposite effect on the level of trans-spliced JAZF1-JJAZ1. recent studies have attributed many chimeras to template On the basis of these data, we conclude that the chimeric switching by reverse transcriptase during cDNA preparation transcript is a product of cis-SAGe/gene read-through as in vitro (17, 18). Here, with extensive Southern blot analysis, suggested previously (4), but not trans-splicing as suggested we confi rmed the absence of DNA rearrangement in LNCaP by a later study (5). cells. We also confi rmed the presence of the fusion transcript Chimeric SLC45A3-ELK4 RNA is translated into wild-type by RNAse protection. We then carried out a series of experi- ELK4 protein. The 5′-untranslated region of SLC45A3 in ments to study the mechanism of SLC45A3-ELK4 chimeric the chimera relates to the induced control of SLC45A3 by RNA generation: (i) An in vitro trans-splicing assay did not androgen. In addition, SLC45A3-ELK4 expression seems to

JULY 2012CANCER DISCOVERY | OF7

RESEARCH BRIEF Zhang et al. have unique consequences different from wild-type ELK4: (i) METHODS proliferation was inhibited by SLC45A3-ELK4 silencing, but Cell Culture and Infection not by ELK4 silencing; (ii) the growth-inhibitory effect could be rescued by transfection of an SLC45A3-ELK4–expressing Prostate cancer cell lines, LNCaP, PC3, RWPE-1, and WPE1- construct, but not an ELK4 construct; (iii) cell-cycle arrest NB26, cells were acquired from Dr. Anindya Dutta (University of Virginia). PrEC cells were obtained from Dr. William Hahn was only observed with SLC45A3-ELK4 silencing; (iv) p21 and (Harvard University). 293T, CV-1 and HCT116 cells were purchased S100A1 levels were affected by silencing of SLC45A3-ELK4, but from American Type Culture Collection. The cell lines have not not ELK4, and (v) SLC45A3-ELK4, not ELK4, RNA level corre- been further tested and authenticated. They were maintained in lates with clinical prostate cancer progression. RPMI-1640 medium containing 10% FBS, 1% pen/strep, and 1% Currently, the mechanism of SLC45A3-ELK4 overexpres- L-glutamine. Monkey kidney CV-1 cell line was maintained in sion in malignant prostate cancer is not known. Poly(A) Dulbecco’s Modifi ed Eagle’s Medium (DMEM) containing 10% signal mutation has been reported to disrupt the normal FBS, 1% pen/strep, and 1% L-glutamine. When androgen-deprived, site of transcriptional termination and block mRNA polya- cells were cultured in phenol-free RPMI medium supplied with 5% denylation (19). In mild thalassemia, a point mutation in charcoal-stripped serum (Invitrogen). For androgen treatment, cells the canonical poly(A) signal (AAUAAA) of the HBB gene were androgen-deprived for 2 days before treatment with 1 nmol/L R1881. Controls were treated with the same volume of ethanol. caused a larger transcript to be produced (20). To investi- Cells were transfected with Lipofectamine RNAiMAX (Invitrogen) gate whether any point mutation in the poly(A) site could according to manufacturer’s protocol. Infection was conducted by explain the continuation of the SLC45A3 transcript, we using 8 μg/mL polybrene and 293T cell packaged SLC45A3-ELK4 or sequenced the last exon of the gene in LNCaP, RWPE, and ELK4 expressing retrovirus. PC3 cells and a normal placenta control. No mutation was found at the predicted poly(A) signal, in this case AUUAAA, Clinical Samples or the G/U-rich region downstream (data not shown). We Zinc formalin-fi xed, paraffi n-embedded samples of normal pros- also sequenced the insulators in LNCaP cells and found tate and prostate cancer were selected for analysis. Care was taken to no abnormality (data not shown). As CTCF is a ubiquitous ensure that the specimens consisted predominantly of normal pros- factor, its effect on the chimeric RNA is unlikely to be tate epithelium or, alternatively, prostate cancer epithelium. due to differential expression. Indeed, we did not observe any changes of CTCF expression level when LNCaP cells PCR and Real-time PCR were treated with androgen (Fig. 2C and data not shown). RNA was extracted using TRIzol reagent (Invitrogen) and quanti- SLC45A3-ELK4 is also expressed in PC3 cells, which have fi ed with Nanodrop (Thermo). cDNA was generated by AMV-RT no androgen receptor, indicating that a downstream target kit (NEB) and random hexamer primer. Real-time qPCR was car- of androgen receptor or an androgen receptor–independ- ried out on StepOne Plus system from Applied Biosystems. All the ent pathway might regulate the chimera overexpression other gene expression levels were detected by SYBR mix (Thermo). in these cells. This is likely to be the case in other cancer Primers and the annealing temperature used in our study are listed types (Fig. 5A). It has been shown that growth factors can in Supplementary Table S1. To detect the combination of human facilitate translocation of CK2 into the nucleus (21), which and monkey chimera in the in vitro trans-splicing assay, Platinum then phosphorylates CTCF and facilitates a switch of CTCF Taq from Invitrogen with primers SLC45A3-181F, human reverse primer: GTGGTGGCAAAAGCAGTCA and monkey reverse primer: from a transcriptional repressor to an activator (22, 23). TGTGGGGGCAAAAACAGTTG were used. ELK4-1201F was applied Silencing the chimeric transcript reduced cell proliferation with monkey reverse primer to test the existence of the monkey ELK4 in both LNCaP and PC3 cells, suggesting a more immediate transcript. To improve specifi city and sensitivity, the above amplifi - role of the chimera in controlling cell growth than androgen cations were conducted with a touchdown protocol consisting of 2 receptor. cycles with annealing temperature of 66°C, 6 cycles with 64°C, and 8 Other fusion products involving ETS family members cycles of 62°C, followed by 24 cycles of 60°C annealing amplifi cation. have been shown to promote cell migration, with no obvi- Pairs of primers 4 to 9 used to investigate pre-precursor mRNA are ous effect on cell proliferation (24, 25). In SLC45A3-ELK4 the same as the primers used for probe synthesis in Southern blot gain- and loss-of-function systems, we did not observe analysis and are listed in Supplementary Table S1. Statistical analysis signifi cant difference of cell migration ability, at least in was conducted with Excel (Microsoft) and P values were calculated with the Student t test or nonparametric test (Mann–Whitney U test). LNCaP cells (data not shown). Interestingly, we found that SLC45A3-ELK4 was also present in a few cell lines of other RNase Protection Assay cancer types, but not in lung cancer cell lines (Fig. 5A). Silencing the chimeric transcript yielded a similar result to To generate the probe, the RT-PCR product of SLC45A3-ELK4 RNA was amplifi ed by primer SLC45A3-181F and ELK4-exon2-R1 LNCaP cells in 293T cells, but not in HCT116 cells (Fig. 5B and cloned into the pBlueScript vector. The antisense RNA probe for and C), suggesting that the chimeric transcript may be more SLC45A3-ELK4 RNA was transcribed in vitro by the MAXIscript T7 Kit general and may regulate cell proliferation at least in some (Ambion). The ribonuclease protection assay was conducted by the non-prostate cancer cells. Ambion RPA III Kit and 10 μg of cellular RNA. In conclusion, our results suggest that cis-SAGe could be an alternative pathway to generate gene fusions in the Southern Blot Hybridization absence of DNA rearrangement. Given that most chimeric Procedures for Southern blot hybridization have been described gene fusions play causal roles in tumorigenesis, it is conceiv- (6, 26). In Southern blot analysis, genomic DNA was digested with BamHI able that abnormal cis-SAGe might be a novel epigenetic way or BamH1 + KpnI (for probes 6 and 7). Pairs of primers 1 to 10 designed to drive cancer. for synthesizing probe 1 to 10 are listed in Supplementary Table S1.

OF8 | CANCER DISCOVERYJULY 2012 www.aacrjournals.org

SLC45A3-ELK4 Controls Prostate Cancer Cell Proliferation RESEARCH BRIEF

Nuclear Extraction and In Vitro Trans-Splicing Administrative, technical, or material support (i.e., reporting Methods of nuclear extract and in vitro trans-splicing were reported or organizing data, constructing databases): Y. Zhang, M. Gong, in our previous work (8). H. Li Study supervision: H. Li Chromatin Immunoprecipitation Acknowledgments ChIP was conducted according to supplier protocol (Millipore). The authors thank Dan Gioeli and John DaSilva for donating CTCF rabbit antibody (Cell Signaling), rabbit IgG, protein G aga- siRNA against AR and real-time qPCR primers for AR; Anna Lee rose beads were used. HS5 CTCF-binding site was used as posi- for technical assistance; and Drs. Jeffrey Sklar, Michael Weber, Sally tive control. MLH1 exon 19 was used as reference. Binding of the Parsons, Dennis Templeton, Ann Beyer, and Benjamin Purow for CTCF with insulators was detected by real-time PCR with SYBR reviewing the manuscript. mix. Pulling down of insulator 1, insulator 2, HS5, and MLH1 ° were detected by 64 C annealing temperature. Primers designed to Grant Support detect the amount of insulator1 (INSUL_ZHAO01741), insulator 2 (INSUL_ZHAO01740), MLH1, and HS5 are listed in Supplemen- H. Li was supported by a Stand Up To Cancer Innovative Research tary Table S1. Grant, a Program of the Entertainment Industry Foundation (SU2C- AACR-IRG0409); V Scholarship; American Cancer Society Institu- RNA Interference tional grant, and Funds for Excellence in Science and Technology. Targets of GL2, siSE1, siSE2, siELK4, androgen receptor (AR), and Received February 10, 2012; revised April 25, 2012; accepted April 26, CTCF are listed in Supplementary Table S1; siRNAs for androgen 2012; published OnlineFirst June 19, 2012. receptor and CTCF have been published before (27, 28).

MTT REFERENCES LNCaP and PC3 cells were plated on 96-well plates with 1,000 cells per well and silenced by si-, siSE1, and siSE2 or siELK4. 1. Rabbitts TH. Chromosomal translocations in human cancer. Nature 1994;372:143–9. For the androgen-deprived group of cells, medium was changed 2. Rowley JD. The role of chromosome translocations in leukemogen- to androgen-deprived medium 24 hours after siRNA transfection. esis. Semin Hematol 1999;36:59–72. Seventy-two hours after transfection, cell viability was measured by 3. Heim S, Mitelman F. Molecular screening for new fusion genes in MTT (Sigma). cancer. Nat Genet 2008;40:685–6. 4. Maher CA, Kumar-Sinha C, Cao X, Kalyana-Sundaram S, Han B, Jing Flow Cytometry X, et al. Transcriptome sequencing to detect gene fusions in cancer. LNCaP and PC3 cells were plated on 6-well plates and silenced by Nature 2009;458:97–101. si-, siSE1, and siSE2 or siELK4 1 day later. Seventy-two hours after 5. Rickman DS, Pfl ueger D, Moss B, VanDoren VE, Chen CX, de la siRNA transfection, cells were harvested, washed by PBS, and fi xed Taille A, et al. SLC45A3-ELK4 is a novel and frequent erythroblast by cold 80% ethanol (prepared by PBS) overnight in −20°C. Cell-cycle transformation-specifi c fusion transcript in prostate cancer. Cancer analysis was conducted by propidium iodide staining to evaluate Res 2009;69:2734–8. DNA content in cell cycle. 6. Li H, Wang J, Mor G, Sklar J. A neoplastic gene fusion mimics trans- splicing of RNAs in normal human cells. Science 2008;321:1357–61. 7. Li H, Wang J, Ma X, Sklar J. Gene fusions and RNA trans-splicing in Microarray Analysis normal and neoplastic human cells. Cell Cycle 2009;8:218–22. Oligonucleotide microarray analysis was conducted using the 8. Williams A, Flavell RA. The role of CTCF in regulating nuclear Affymetrix Human Gene 1.0 ST Arrays by the University of Virginia organization. J Exp Med 2008;205:747–50. (Charlottesville, VA) Microarray Core Facility. A list of genes of 9. Burgess-Beusse B, Farrell C, Gaszner M, Litt M, Mutskov V, Recillas- interest was compiled using the criteria of at least 2-fold change Targa F, et al. The insulation of genes from external enhancers and compared with control siRNA. Hierarchical clustering was con- silencing chromatin. Proc Natl Acad Sci U S A 2002;99 Suppl 4:16433–7. ducted using the BRB ArrayTools developed by Dr. Richard Simon 10. Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, et al. (National Cancer Institute) and BRB-ArrayTools Development High-resolution profi ling of histone methylations in the human Team. Primers used for validating by real-time PCR are listed in Sup- genome. Cell 2007;129:823–37. plementary Table S1. Raw and processed data have been deposited 11. Ling JQ, Li T, Hu JF, Vu TH, Chen HL, Qiu XW, et al. CTCF mediates / / into GEO with accession number GSE37410. interchromosomal colocalization between Igf2 H19 and Wsb1 Nf1. Science 2006;312:269–72. 12. Machida YJ, Chen Y, Machida Y, Malhotra A, Sarkar S, Dutta A. Disclosure of Potential Confl icts of Interest Targeted comparative RNA interference analysis reveals differential No potential confl icts of interests were disclosed. requirement of genes essential for cell proliferation. Mol Biol Cell 2006;17:4837–45. Authors’ Contributions 13. Wang K, Ubriaco G, Sutherland LC. RBM6-RBM5 transcription- induced chimeras are differentially expressed in tumours. BMC Conception and design: Y. Zhang, M. Gong, H. Li Genomics 2007;8:348. Development of methodology: Y. Zhang, M. Gong, H. Yuan, H. Li 14. Parra G, Reymond A, Dabbouseh N, Dermitzakis ET, Castelo R, Acquisition of data (provided animals, acquired and managed Thomson TM, et al. Tandem chimerism as a means to increase pro- patients, provided facilities, etc.): Y. Zhang, H.O. Park, H.F. Frierson, tein complexity in the human genome. Genome Res 2006;16:37–44. H. Li 15. Kannan K, Wang L, Wang J, Ittmann MM, Li W, Yen L. Recurrent Analysis and interpretation of data (e.g., statistical analysis, chimeric RNAs enriched in human prostate cancer identifi ed by deep biostatistics, computational analysis): Y. Zhang, M. Gong, H. sequencing. Proc Natl Acad Sci U S A 2011;108:9172–7. Yuan, H. Li 16. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun Writing, review, and/or revision of the manuscript: Y. Zhang, H.F. XW, et al. Recurrent fusion of TMPRSS2 and ETS transcription fac- Frierson, H. Li tor genes in prostate cancer. Science 2005;310:644–8.

JULY 2012CANCER DISCOVERY | OF9

RESEARCH BRIEF Zhang et al.

17. Houseley J, Tollervey D. Apparent non-canonical trans-splicing is region of the multivalent multifunctional transcriptional factor generated by reverse transcriptase in vitro. PLoS One 2010;5:e12271. CTCF. Mol Cell Biol 2001;21:2221–34. 18. McManus CJ, Duff MO, Eipper-Mains J, Graveley BR. Global analy- 24. Hahne JC, Okuducu AF, Kaminski A, Florin A, Soncin F, Wernert N. sis of trans-splicing in Drosophila. Proc Natl Acad Sci U S A 2010; Ets-1 expression promotes epithelial cell transformation by inducing 107:12975–9. migration, invasion and anchorage-independent growth. Oncogene 19. Proudfoot NJ, Furger A, Dye MJ. Integrating mRNA processing with 2005;24:5384–8. transcription. Cell 2002;108:501–12. 25. Carver BS, Tran J, Gopalan A, Chen Z, Shaikh S, Carracedo A, et al. 20. Orkin SH, Cheng TC, Antonarakis SE, Kazazian HH, Jr. Thalassemia Aberrant ERG expression cooperates with loss of PTEN to promote due to a mutation in the cleavage-polyadenylation signal of the cancer progression in the prostate. Nat Genet 2009;41:619–24. human beta-globin gene. EMBO J 1985;4:453–6. 26. Li H, Ma X, Wang J, Koontz J, Nucci M, Sklar J. Effects of rearrange- 21. Guo C, Yu S, Davis AT, Ahmed K. Nuclear matrix targeting of the ment and allelic exclusion of JJAZ1/SUZ12 on cell proliferation and protein kinase CK2 signal as a common downstream response to survival. Proc Natl Acad Sci U S A 2007;104:20001–6. androgen or growth factor stimulation of prostate cancer cells. Can- 27. Gioeli D, Black BE, Gordon V, Spencer A, Kesler CT, Eblen ST, cer Res 1999;59:1146–51. et al. Stress kinase signaling regulates androgen receptor phospho- 22. El-Kady A, Klenova E. Regulation of the transcription factor, CTCF, rylation, transcription, and localization. Mol Endocrinol 2006;20: by phosphorylation with protein kinase CK2. FEBS Lett 2005; 503–15. 579:1424–34. 28. Renaud S, Loukinov D, Bosman FT, Lobanenkov V, Benhattar J. 23. Klenova EM, Chernukhin IV, El-Kady A, Lee RE, Pugacheva EM, CTCF binds the proximal exonic region of hTERT and inhibits its Loukinov DI, et al. Functional phosphorylation sites in the C-terminal transcription. Nucleic Acids Res 2005;33:6850–60.

OF10 | CANCER DISCOVERYJULY 2012 www.aacrjournals.org

Chimeric Transcript Generated by cis-Splicing of Adjacent Genes Regulates Prostate Cancer Cell Proliferation

Yanmei Zhang, Mei Gong, Huiling Yuan, et al.

Cancer Discovery Published OnlineFirst June 19, 2012.

Updated version Access the most recent version of this article at: doi:10.1158/2159-8290.CD-12-0042

Supplementary Access the most recent supplemental material at: Material http://cancerdiscovery.aacrjournals.org/content/suppl/2012/07/02/2159-8290.CD-12-0042.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerdiscovery.aacrjournals.org/content/early/2012/06/14/2159-8290.CD-12-0042. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.