DOCSLIB.ORG

Sequence Alignment and Comparison

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sequence Alignment and Comparison 10/10/2016 Sequence Comparison Abhishek Niroula Protein Structure and Bioinformatics Department of Experimental Medical Science Lund University 2016-10-11 1 Learning goals • What is a sequence alignment? • What approaches are used for aligning sequences? • How to choose the best alignment? • What are substitution matrices? • Which tools are available for aligning two or more sequences? • How to use the alignment tools? • How to interpret results obtained from the tools? 2016- 10-11 2 1 10/10/2016 What is sequence alignment? • A way of arranging two or more sequences to identify regions of similarity • Shows locations of similarities and differences between the sequences • The aligned residues correspond to original residue in their common ancestor • Insertions and deletions are represented by gaps in the alignment • An 'optimal' alignment exhibits the most similarities and the least differences • Examples Protein sequence alignment MSTGAVLIY--TSILIKECHAMPAGNE----- ---GGILLFHRTHELIKESHAMANDEGGSNNS * * * **** *** Nucleotide sequence alignment attcgttggcaaatcgcccctatccggccttaa att---tggcggatcg-cctctacgggcc---- *** **** **** ** ****** 2016-10-11 3 Why align sequences? • Reveal structural, functional and evolutionary relationship between biological sequences • Similar sequences may have similar structure and function • Similar sequences are likely to have common ancestral sequence • Annotation of new sequences • Modelling of protein structures 2016-10-11 4 2 10/10/2016 Sequence alignment: Types • Global alignment – Aligns each residue in each sequence by introducing gaps – Example: Needleman-Wunsch algorithm L G P S S K Q T G K G S - S R I W D N L N - I T K S A G K G A I M R L G D A 2016-10-11 5 Sequence alignment: Types • Local alignment – Finds regions with the highest density of matches locally – Example: Smith-Waterman algorithm F T F T A L I L L - A V A V - - F T A L - L L A A V - - - - - - - - - T G K G H R R K S P R S D E L K A A G K G - - - - - - 2016-10-11 6 3 10/10/2016 How to find the best alignment? • Seq1: TACGGGCAG • Seq2: ACGGCG T A C G G G C A G T A C G G G C A G T A C G G G C A G - A C - G G C - G - A C G G - C - G - A C G - G C - G Option 1 Option 2 Option 3 Find the alignment score!!! 2016-10-11 7 How to find the alignment score? • Scoring matrices are used to assign scores to each comparison of a pair of characters • Identities and substitutions by similar amino acids are assigned positive scores • Mismatches, or matches that are unlikely to have been a result of evolution, are given negative scores A C D E F G H I K Matches +5 A C Y E F G R I K Mismatches -5 +5 +5 -5 +5 +5 +5 -5 +5 +5 2016-10-11 8 4 10/10/2016 PAM-1 substitution matrix 2016-10-11 9 What is a PAM matrix? • PAM matrices – PAM - Percent Accepted Mutations – PAM gives the probability that a given amino acid will be replaced by any other amino acid – An accepted point mutation in a protein is a replacement of one amino acid by another, accepted by natural selection – Derived from global alignments of closely related sequences – The numbers with the matrix (PAM40, PAM100) refer to the evolutionary distance (greater numbers mean greater distances) – 1-PAM matrix refers to the amount evolution that would change 1% of the residues/bases (on average) – 2-PAM matrix does NOT refer to change in 2% of residues • Refers 1-PAM twice • Some variations may change back to original residue 2016-10-11 10 5 10/10/2016 BLOSUM62 2016-10-11 11 What is BLOSUM? • BLOSUM matrices – BLOSUM - Blocks Substitution Matrix – Score for each position refers to obtained frequencies of substitutions in blocks of local alignments of protein sequences. – For example BLOSUM62 is derived from sequence alignments with no more than 62% identity. 2016-10-11 12 6 10/10/2016 Which scoring matrix to use? For global alignments use PAM matrices. • Lower PAM matrices tend to find short alignments of highly similar regions • Higher PAM matrices will find weaker, longer alignments For local alignments use BLOSUM matrices • BLOSUM matrices with HIGH number, are better for similar sequences • BLOSUM matrices with LOW number, are better for distant sequences 2016-10-11 13 Sequence alignment: Methods • Pairwise alignment – Finding best alignment of two sequences – Often used for searching sequences with highest similarity in the sequence databases • Dot Matrix Analysis • Dynamic Programming (DP) • Short word matching • Multiple Sequence Alignment (MSA) – Alignment of more than two sequences – Often used to find conserved domains, regions or sites among many sequences • Dynamic programming • Progressive methods • Iterative methods • Structural alignments – Alignments based on structure 2016-10-11 14 7 10/10/2016 Sequence alignment: Methods • Pairwise alignment – Finding best alignment of two sequences – Often used for searching best similar sequences in the sequence databases • Dot Matrix Analysis • Dynamic Programming (DP) • Short word matching • Multiple Sequence Alignment (MSA) – Alignment of more than two sequences – Often used to find conserved domains, regions or sites among many sequences • Dynamic programming • Progressive methods • Iterative methods • Structural alignments – Alignments based on structure 2016-10-11 15 What is a Dot Matrix? • Method for comparing two sequences (amino acid or nucleotide) Sequence A A G C T A G G A • Lets align two sequences using G A dot matrix C A: A G C T A G G A T B: G A C T A G G C A Sequence Sequence B G – Sequence A is organized in X-axis G and sequence B in Y-axis C 2016-10 -11 16 8 10/10/2016 Find the matching nucleotides – Starting from the first nucleotide in B, Sequence A move along the first row placing a dot in columns with matching nucleotide A G C T A G G A G ● ● ● A C T A Sequence Sequence B G G C 2016-10-11 17 Continue to fill the table – Starting from the first nucleotide in B, Sequence A move along the first row placing a dot in columns with matching nucleotide A G C T A G G A G ● ● ● – Repeat the procedure for all the A ● ● ● nucleotides in B C T A Sequence Sequence B G G C 2016-10-11 18 9 10/10/2016 Why are some cells empty in a dot matrix? – Starting from the first nucleotide in B, Sequence A move along the first row placing a dot in columns with matching nucleotide A G C T A G G A G ● ● ● – Repeat the procedure for all the A ● ● ● nucleotides in B C ● T ● A ● ● ● Cells corresponding to Sequence B mismatching nucleotides G ● ● ● are empty G ● ● ● C ● 2016-10-11 19 Is there something interesting in the matrix? – Starting from the first nucleotide in B, Sequence A move along the first row placing a dot in columns with matching nucleotide A G C T A G G A G ● ● ● – Repeat the procedure for all the A ● ● ● nucleotides in B C ● – Region of similarity is revealed by a T ● diagonal row of dots A ● ● ● Sequence B G ● ● ● – Other isolated dots represent random matches G ● ● ● C ● 2016-10-11 20 10 10/10/2016 How to interpret dot plots? Two similar, but not identical, An insertion or deletion A tandem duplication sequences 2016-10-11 21 How to interpret dot plots? An inversion Joining sequences 2016-10-11 22 11 10/10/2016 Limitations of dot matrix • Sequences with low-complexity regions give false diagonals – Sequence regions with little diversity • Noisy and space inefficient • Limited to 2 sequences 2016-10-11 23 Dotplot exercise • Use the following three tools to generate dot plots for two sequences • YASS:: genomic similarity search tool – http://bioinfo.lifl.fr/yass/yass.php • Lalign/Palign – http://fasta.bioch.virginia.edu/fasta_www2/fasta_www.cgi?rm=lalign • multi-zPicture – http://zpicture.dcode.org/ 2016-10-11 24 12 10/10/2016 Sequence alignment: Methods • Pairwise alignment – Finding best alignment of two sequences – Often used for searching best similar sequences in the sequence databases • Dot Matrix Analysis • Dynamic Programming (DP) • Short word matching • Multiple Sequence Alignment (MSA) – Alignment of more than two sequences – Often used to find conserved domains, regions or sites among many sequences • Dynamic programming • Progressive methods • Iterative methods • Structural alignments – Alignments based on structure 2016-10-11 25 Dynamic programming • Breaks down the alignment problem into smaller problems • Example – Needleman-Wunsch algorithm: global alignment – Smith-Waterman algorithm: local alignment • Three steps – Initialization – Scoring – Traceback 2016-10-11 26 13 10/10/2016 Where to place gaps in the alignment? • Insertion of gaps in the alignment • Gaps should be penalized • Gap opening should be penalized higher than gap extension (or at least equal) • In BLOSUM62 – Gap opening score = -11 – Gap extension score = -1 A A A G A G A A A A A A G A G A A A A A A G A G A A A - A A A - A - A A A A A A - - A A A A A A A - - - A A A A Gap extention Gap extention Gap initiation 2016-10-11 27 Local and global pairwise alignment • Needleman-Wunsch (global) • Smith-Waterman (local) – Match =+2 – Match =+2 – Mismatch =-1 – Mismatch =-1 – Gap =-1 – Gap =-1 • All negative values are replaced by 0 • Traceback starts at the highest value and ends at 0 - A G T T A - A G T T A - 0 -1 -2 -3 -4 -5 - 0 0 0 0 0 0 A -1 2 A 0 2 G -2 G 0 T -3 T 0 G -4 G 0 C -5 C 0 A -6 A 0 2016-10-11 28 14 10/10/2016 Needleman-Wunsch vs Smith-Waterman Sequence alignment teacher (http://melolab.org/websoftware/web/?sid=3) 2016-10-11 29 Dynamic programming: example • http://www.avatar.se/molbioinfo2001/dynprog/dynamic.html • Scoring – Match = +2 – Mismatch = -2 – Gap = -1 2016-10-11 30 15 10/10/2016 Dynamic programming exercise • Generate a scoring matrix
Load more

Recommended publications
  • Bioinformatics Study of Lectins: New Classification and Prediction In
    Bioinformatics study of lectins : new classification and prediction in genomes François Bonnardel To cite this version: François Bonnardel. Bioinformatics study of lectins : new classification and prediction in genomes. Structural Biology [q-bio.BM]. Université Grenoble Alpes [2020-..]; Université de Genève, 2021. En- glish. NNT : 2021GRALV010. tel-03331649 HAL Id: tel-03331649 https://tel.archives-ouvertes.fr/tel-03331649 Submitted on 2 Sep 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE L’UNIVERSITE GRENOBLE ALPES préparée dans le cadre d’une cotutelle entre la Communauté Université Grenoble Alpes et l’Université de Genève Spécialités: Chimie Biologie Arrêté ministériel : le 6 janvier 2005 – 25 mai 2016 Présentée par François Bonnardel Thèse dirigée par la Dr. Anne Imberty codirigée par la Dr/Prof. Frédérique Lisacek préparée au sein du laboratoire CERMAV, CNRS et du Computer Science Department, UNIGE et de l’équipe PIG, SIB Dans les Écoles Doctorales EDCSV et UNIGE Etude bioinformatique des lectines: nouvelle classification et prédiction dans les génomes Thèse soutenue publiquement le 8 Février 2021, devant le jury composé de : Dr. Alexandre de Brevern UMR S1134, Inserm, Université Paris Diderot, Paris, France, Rapporteur Dr.
    [Show full text]
  • Trichoderma Reesei Complete Genome Sequence, Repeat-Induced Point
    Li et al. Biotechnol Biofuels (2017) 10:170 DOI 10.1186/s13068-017-0825-x Biotechnology for Biofuels RESEARCH Open Access Trichoderma reesei complete genome sequence, repeat‑induced point mutation, and partitioning of CAZyme gene clusters Wan‑Chen Li1,2,3†, Chien‑Hao Huang3,4†, Chia‑Ling Chen3, Yu‑Chien Chuang3, Shu‑Yun Tung3 and Ting‑Fang Wang1,3* Abstract Background: Trichoderma reesei (Ascomycota, Pezizomycotina) QM6a is a model fungus for a broad spectrum of physiological phenomena, including plant cell wall degradation, industrial production of enzymes, light responses, conidiation, sexual development, polyketide biosynthesis, and plant–fungal interactions. The genomes of QM6a and its high enzyme-producing mutants have been sequenced by second-generation-sequencing methods and are pub‑ licly available from the Joint Genome Institute. While these genome sequences have ofered useful information for genomic and transcriptomic studies, their limitations and especially their short read lengths make them poorly suited for some particular biological problems, including assembly, genome-wide determination of chromosome architec‑ ture, and genetic modifcation or engineering. Results: We integrated Pacifc Biosciences and Illumina sequencing platforms for the highest-quality genome assem‑ bly yet achieved, revealing seven telomere-to-telomere chromosomes (34,922,528 bp; 10877 genes) with 1630 newly predicted genes and >1.5 Mb of new sequences. Most new sequences are located on AT-rich blocks, including 7 centromeres, 14 subtelomeres, and 2329 interspersed AT-rich blocks. The seven QM6a centromeres separately consist of 24 conserved repeats and 37 putative centromere-encoded genes. These fndings open up a new perspective for future centromere and chromosome architecture studies.
    [Show full text]
  • Introduction to Bioinformatics (Elective) – SBB1609
    SCHOOL OF BIO AND CHEMICAL ENGINEERING DEPARTMENT OF BIOTECHNOLOGY Unit 1 – Introduction to Bioinformatics (Elective) – SBB1609 1 I HISTORY OF BIOINFORMATICS Bioinformatics is an interdisciplinary field that develops methods and software tools for understanding biologicaldata. As an interdisciplinary field of science, bioinformatics combines computer science, statistics, mathematics, and engineering to analyze and interpret biological data. Bioinformatics has been used for in silico analyses of biological queries using mathematical and statistical techniques. Bioinformatics derives knowledge from computer analysis of biological data. These can consist of the information stored in the genetic code, but also experimental results from various sources, patient statistics, and scientific literature. Research in bioinformatics includes method development for storage, retrieval, and analysis of the data. Bioinformatics is a rapidly developing branch of biology and is highly interdisciplinary, using techniques and concepts from informatics, statistics, mathematics, chemistry, biochemistry, physics, and linguistics. It has many practical applications in different areas of biology and medicine. Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological, medical, behavioral or health data, including those to acquire, store, organize, archive, analyze, or visualize such data. Computational Biology: The development and application of data-analytical and theoretical methods, mathematical modeling and computational simulation techniques to the study of biological, behavioral, and social systems. "Classical" bioinformatics: "The mathematical, statistical and computing methods that aim to solve biological problems using DNA and amino acid sequences and related information.” The National Center for Biotechnology Information (NCBI 2001) defines bioinformatics as: "Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline.
    [Show full text]
  • A Comprehensive Review and Performance Evaluation of Sequence Alignment Algorithms for DNA Sequences
    International Journal of Advanced Science and Technology Vol. 29, No. 3, (2020), pp. 11251 - 11265 A Comprehensive Review and Performance Evaluation of Sequence Alignment Algorithms for DNA Sequences Neelofar Sohi1 and Amardeep Singh2 1Assistant Professor, Department of Computer Science & Engineering, Punjabi University Patiala, Punjab, India 2Professor, Department of Computer Science & Engineering, Punjabi University Patiala, Punjab, India [email protected],[email protected] Abstract Background: Sequence alignment is very important step for high level sequence analysis applications in the area of biocomputing. Alignment of DNA sequences helps in finding origin of sequences, homology between sequences, constructing phylogenetic trees depicting evolutionary relationships and other tasks. It helps in identifying genetic variations in DNA sequences which might lead to diseases. Objectives: This paper presents a comprehensive review on sequence alignment approaches, methods and various state-of-the-art algorithms. Performance evaluation and comparison of few algorithms and tools is performed. Methods and Results: In this study, various tools and algorithms are studied, implemented and their performance is evaluated and compared using Identity Percentage is used as the main metric. Conclusion: It is observed that for pairwise sequence alignment, Clustal Omega Emboss Matcher outperforms other tools & algorithms followed by Clustal Omega Emboss Water further followed by Blast (Needleman-Wunsch algorithm for global alignment). Keywords: sequence alignment; DNA sequences; progressive alignment; iterative alignment; natural computing approach; identity percentage. 1. Brief History Sequence alignment is very important area in the field of Biocomputing and Bioinformatics. Sequence alignment aims to identify the regions of similarity between two or more sequences. Alignment is also termed as ‘mapping’ that is done to identify and compare the nucleotide bases i.e.
    [Show full text]
  • GPS@: Bioinformatics Grid Portal for Protein Sequence Analysis on EGEE Grid
    Enabling Grids for E-sciencE GPS@: Bioinformatics grid portal for protein sequence analysis on EGEE grid Blanchet, C., Combet, C., Lefort, V. and Deleage, G. Pôle BioInformatique de Lyon – PBIL Institut de Biologie et Chimie des Protéines IBCP – CNRS UMR 5086 Lyon-Gerland, France [email protected] www.eu-egee.org INFSO-RI-508833 TOC Enabling Grids for E-sciencE • NPS@ Web portal – Online since 1998 – Production mode • Gridification of NPS@ • Bioinformatics description with XML-based Framework • Legacy mode for application file access • GPS@ Web portal for Bioinformatics on Grid INFSO-RI-508833 GPS@ Bioinformatics Grid Portal, EGEE User Forum, March 1st, 2006, Cern 2 Institute of Biology and Enabling Grids for E-sciencE Chemistry of Proteins • French CNRS Institute, associated to Univ. Lyon1 – Life Science – About 160 people – http://www.ibcp.fr – Located in Lyon, France • Study of proteins in their biological context ♣ Approaches used include integrative cellular (cell culture, various types of microscopies) and molecular techniques, both experimental (including biocrystallography and nuclear magnetic resonance) and theoretical (structural bioinformatics). • Three main departments, bringing together 13 groups ♣ topics such as cancer, extracellular matrix, tissue engineering, membranes, cell transport and signalling, bioinformatics and structural biology INFSO-RI-508833 GPS@ Bioinformatics Grid Portal, EGEE User Forum, March 1st, 2006, Cern 3 EGEE Biomedical Activity Enabling Grids for E-sciencE • Chair: ♣ Johan Montagnat ♣ Christophe
    [Show full text]
  • Software List for Biology, Bioinformatics and Biostatistics CCT
    Software List for biology, bioinformatics and biostatistics v CCT - Delta Software Version Application short read assembler and it works on both small and large (mammalian size) ALLPATHS-LG 52488 genomes provides a fast, flexible C++ API & toolkit for reading, writing, and manipulating BAMtools 2.4.0 BAM files a high level of alignment fidelity and is comparable to other mainstream Barracuda 0.7.107b alignment programs allows one to intersect, merge, count, complement, and shuffle genomic bedtools 2.25.0 intervals from multiple files Bfast 0.7.0a universal DNA sequence aligner tool analysis and comprehension of high-throughput genomic data using the R Bioconductor 3.2 statistical programming BioPython 1.66 tools for biological computation written in Python a fast approach to detecting gene-gene interactions in genome-wide case- Boost 1.54.0 control studies short read aligner geared toward quickly aligning large sets of short DNA Bowtie 1.1.2 sequences to large genomes Bowtie2 2.2.6 Bowtie + fully supports gapped alignment with affine gap penalties BWA 0.7.12 mapping low-divergent sequences against a large reference genome ClustalW 2.1 multiple sequence alignment program to align DNA and protein sequences assembles transcripts, estimates their abundances for differential expression Cufflinks 2.2.1 and regulation in RNA-Seq samples EBSEQ (R) 1.10.0 identifying genes and isoforms differentially expressed EMBOSS 6.5.7 a comprehensive set of sequence analysis programs FASTA 36.3.8b a DNA and protein sequence alignment software package FastQC
    [Show full text]
  • A New Graphical User Interface to EMBOSS
    Comparative and Functional Genomics Comp Funct Genom 2002; 3: 75–78. DOI: 10.1002/cfg.136 Feature Website Update: A new graphical user interface to EMBOSS Tim J. Carver* and Lisa J. Mullan MRC UK HGMP Resource Centre, Genome Campus, Hinxton, Cambridge, Cambridgeshire, CB10 1SB, UK *Correspondence to: MRC UK HGMP Resource Centre, Genome Campus, Hinxton, Cambridge, Keywords: EMBOSS; Bioinformatics; HGMP; graphical interface; Java Cambridgeshire, CB10 1SB, UK. E-mail: [email protected] Received: 1 December 2001 Accepted: 4 December 2001 Published online: 17 January 2002 EMBOSS, the European Molecular Biology Open A server for the new interface, accessible to Software Suite is a collection of over 150 bioinfor- registered HGMP users, has been set up at the matics programs. It provides individual applications EMBOSS web site [5]. It is also linked from the for retrieval, editing, and analysis of nucleotide and ‘Bioinformatics Applications’ menu on the HGMP peptide sequences. It also includes software for site. Jemboss will function in client-server mode analysing protein structure. Distributed under the allowing many users to run their analyses remotely. GNU General Public License software agreements The Jemboss interface window (the client) is [6], all programs are available, free of charge, to all launched on the users’ workstations. Analyses are academic or commercial users. EMBOSS brings then run on the HGMP machines and the results together programs from various sources including returned to the local screen. This has been achieved the EMBOSS development team, individuals and using the Simple Object Access Protocol (SOAP) members of the EMBnet community. [1], a new advance in Internet Communication To mark the fifth anniversary of EMBOSS, an Technology designed specifically to circumvent fire- exciting new graphical user interface (GUI), ‘Jem- wall restrictions.
    [Show full text]
  • EBI, Expasy, EMBOSS, DTU)
    EBI web resources III: Web-based tools in Europe (EBI, ExPASy, EMBOSS, DTU) Yanbin Yin Fall 2015 1 Homework assignment 4 1. Download h<p://cys.bios.niu.edu/yyin/teach/PBB/purdue.cellwall.list.lignin.fa to your computer 2. Select a C3H protein and a F5H protein from the above file and calculate the sequence idenLty between them using the Water server at EBI. 3. Perform a mulLple sequence alignment using MAFFT with all FASTA sequences in the file 4. Built a phylogeny with the alignment using the "A la Carte" mode at hp://www.phylogeny.fr/ 5. Build another phylogeny starLng from the unaligned sequences using the “one-click” mode at hp://www.phylogeny.fr/; if you encounter any error reports, try to figure out why and how to solve it (hint: skip the Gblocks step). Write a report (in word or ppt) to include all the operaons, screen shots and the final phylogenies from step 3 and 4. Office hour: Due on 10/13 (send by email) Tue, Thu and Fri 2-4pm, MO325A Or email: [email protected] 2 Outline • Hands on exercises! 3 Pairwise alignment (including database search) tools Slower SSEARCH FASTA BLAST BWA Faster More matches PSI-BLAST BLAT Bowe Less matches PSI-Search HMMER3 RPS-BLAST 4 h<p://www.ebi.ac.uk/ To the bo<om of the page Click by names (A-Z) 5 We are gonna try FASTA tool This is a very long list of tools Scroll down to find FASTA Or Ctrl+F and type fasta Click on FASTA [nucleode] 6 Click Genomes We’re gonna search Arabidopsis genome 7 Click on this li<le arrow Choose Arabidopsis Change here to protein Go to h<p://cys.bios.niu.edu/yyin/teach/PBB/cesa-pr.fa
    [Show full text]
  • Web & Grid Technologies in Bioinformatics, Computational And
    Current Bioinformatics, 2008, 3, 000-000 1 Web & Grid Technologies in Bioinformatics, Computational and Systems Biology: A Review Azhar A. Shah1, Daniel Barthel1, Piotr Lukasiak2,3, Jacek Blazewicz2,3 and Natalio Krasnogor*,1 1School of Computer Science, University of Nottingham, Jubilee Campus, NG81BB, Nottingham, UK 2Institute of Computing Science, Poznan University of Technology, Piotrowo 2, 60-965 Poznan, Poland 3Institute of Bioorganic Chemistry, Laboratory of Bioinformatics, Polish Academy of Sciences, Noskowskiego 12/14, 61- 704 Poznan, Poland Abstract: The acquisition of biological data, ranging from molecular characterization and simulations (e.g. protein fold- ing dynamics), to systems biology endeavors (e.g. whole organ simulations) all the way up to ecological observations (e.g. as to ascertain climate change’s impact on the biota) is growing at unprecedented speed. The use of computational and networking resources is thus unavoidable. As the datasets become bigger and the acquisition technology more refined, the biologist is empowered to ask deeper and more complex questions. These, in turn, drive a runoff effect where large re- search consortia emerge that span beyond organizations and national boundaries. Thus the need for reliable, robust, certi- fied, curated, accessible, secure and timely data processing and management becomes entrenched within, and crucial to, 21st century biology. Furthermore, the proliferation of biotechnologies and advances in biological sciences has produced a strong drive for new informatics solutions, both at the basic science and technological levels. The previously unknown situation of dealing with, on one hand, (potentially) exabytes of data, much of which is noisy, has large experimental er- rors or theoretical uncertainties associated with it, or on the other hand, large quantities of data that require automated computationally intense analysis and processing, have produced important innovations in web and grid technology.
    [Show full text]
  • Annual Scientific Report 2011 Annual Scientific Report 2011 Designed and Produced by Pickeringhutchins Ltd
    European Bioinformatics Institute EMBL-EBI Annual Scientific Report 2011 Annual Scientific Report 2011 Designed and Produced by PickeringHutchins Ltd www.pickeringhutchins.com EMBL member states: Austria, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands, Norway, Portugal, Spain, Sweden, Switzerland, United Kingdom. Associate member state: Australia EMBL-EBI is a part of the European Molecular Biology Laboratory (EMBL) EMBL-EBI EMBL-EBI EMBL-EBI EMBL-European Bioinformatics Institute Wellcome Trust Genome Campus, Hinxton Cambridge CB10 1SD United Kingdom Tel. +44 (0)1223 494 444, Fax +44 (0)1223 494 468 www.ebi.ac.uk EMBL Heidelberg Meyerhofstraße 1 69117 Heidelberg Germany Tel. +49 (0)6221 3870, Fax +49 (0)6221 387 8306 www.embl.org [email protected] EMBL Grenoble 6, rue Jules Horowitz, BP181 38042 Grenoble, Cedex 9 France Tel. +33 (0)476 20 7269, Fax +33 (0)476 20 2199 EMBL Hamburg c/o DESY Notkestraße 85 22603 Hamburg Germany Tel. +49 (0)4089 902 110, Fax +49 (0)4089 902 149 EMBL Monterotondo Adriano Buzzati-Traverso Campus Via Ramarini, 32 00015 Monterotondo (Rome) Italy Tel. +39 (0)6900 91402, Fax +39 (0)6900 91406 © 2012 EMBL-European Bioinformatics Institute All texts written by EBI-EMBL Group and Team Leaders. This publication was produced by the EBI’s Outreach and Training Programme. Contents Introduction Foreword 2 Major Achievements 2011 4 Services Rolf Apweiler and Ewan Birney: Protein and nucleotide data 10 Guy Cochrane: The European Nucleotide Archive 14 Paul Flicek:
    [Show full text]
  • A Converter Facilitating Genome Annotation Submission to European Nucleotide Archive Martin Norling1,2, Niclas Jareborg1,3 and Jacques Dainat1,2*
    Norling et al. BMC Res Notes (2018) 11:584 https://doi.org/10.1186/s13104-018-3686-x BMC Research Notes RESEARCH NOTE Open Access EMBLmyGFF3: a converter facilitating genome annotation submission to European Nucleotide Archive Martin Norling1,2, Niclas Jareborg1,3 and Jacques Dainat1,2* Abstract Objective: The state-of-the-art genome annotation tools output GFF3 format fles, while this format is not accepted as submission format by the International Nucleotide Sequence Database Collaboration (INSDC) databases. Convert- ing the GFF3 format to a format accepted by one of the three INSDC databases is a key step in the achievement of genome annotation projects. However, the fexibility existing in the GFF3 format makes this conversion task difcult to perform. Until now, no converter is able to handle any GFF3 favour regardless of source. Results: Here we present EMBLmyGFF3, a robust universal converter from GFF3 format to EMBL format compatible with genome annotation submission to the European Nucleotide Archive. The tool uses json parameter fles, which can be easily tuned by the user, allowing the mapping of corresponding vocabulary between the GFF3 format and the EMBL format. We demonstrate the conversion of GFF3 annotation fles from four diferent commonly used anno- tation tools: Maker, Prokka, Augustus and Eugene. EMBLmyGFF3 is freely available at https​://githu​b.com/NBISw​eden/EMBLm​yGFF3​. Keywords: Annotation, Converter, Submission, EMBL, GFF3 Introduction the GFF3 format has become the de facto reference for- Over the last 20 years, many sequence annotation tools mat for annotations. Despite well-defned specifcations, have been developed, facilitating the production of rela- the format allows great fexibility allowing holding wide tively accurate annotation of a wide range of organisms variety of information.
    [Show full text]
  • Bioinformatics Approaches for Functional Predictions in Diverse Informatics Environments. Paula Maria Moolhuijzen, Bsc This Thes
    Bioinformatics approaches for functional predictions in diverse informatics environments. Paula Maria Moolhuijzen, BSc This thesis is presented for the degree of Doctor of Philosophy of Murdoch University 2011 i Declaration I declare that this thesis is my own account of my research and contains as its main content work, which has not previously been submitted for a degree at any tertiary education institution. Signature: Name: Paula Moolhuijzen Date: 4th October 2011 ii Abstract Bioinformatics is the scientific discipline that collates, integrates and analyses data and information sets for the life sciences. Critically important in agricultural and biomedical fields, there is a pressing need to integrate large and diverse data sets into biologically significant information. This places major challenges on research strategies and resources (data repositories, computer infrastructure and software) required to integrate relevant data and analysis workflows. These challenges include: ! The construction of processes to integrate data from disparate and diverse resources and legacy systems that have variable data formats, qualities, availability and accessibility constraints. ! Substantially contributing to hypothesis driven research for biologically significant information. The hypothesis proposed in this thesis is that in organisms from divergent origins, with differing data availability and analysis resources, in silico approaches can identify genomic targets in a range of disease systems. The particular aims were to: 1. Overcome data constraints that impact analysis of different organisms. 2. Make functional genomic predictions in diverse biological systems. 3. Identify specific genomic targets for diagnostics and therapeutics in diverse disease mechanisms. iii In order to test the hypothesis three case studies in human cancer, pathogenic bacteria, and parasitic arthropod were selected, the results are as follows.
    [Show full text]