A Mutation in the HFE Gene Is Associated with Altered Brain Iron Proﬁles and Increased Oxidative Stress in Mice

Biochimica et Biophysica Acta 1832 (2013) 729–741

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta

journal homepage: www.elsevier.com/locate/bbadis

A mutation in the HFE gene is associated with altered brain iron proﬁles and increased oxidative stress in mice

Wint Nandar a, Elizabeth B. Neely a, Erica Unger b, James R. Connor a,⁎ a Department of Neurosurgery, The Pennsylvania State University, M. S. Hershey Medical Center, Hershey, PA 17033, USA b Department of Biobehavioral Health, The Pennsylvania State University, University Park, PA 16802, USA article info abstract

Article history: Because of the increasing evidence that H63D HFE polymorphism appears in higher frequency in neurode- Received 22 October 2012 generative diseases, we evaluated the neurological consequences of H63D HFE in vivo using mice that carry Received in revised form 5 February 2013 H67D HFE (homologous to human H63D). Although total brain iron concentration did not change Accepted 12 February 2013 significantly in the H67D mice, brain iron management proteins expressions were altered significantly. The Available online 18 February 2013 6-month-old H67D mice had increased HFE and H-ferritin expression. At 12 months, H67D mice had increased H- and L-ferritin but decreased transferrin expression suggesting increased iron storage and de- Keywords: H63D HFE creased iron mobilization. Increased L-ferritin positive microglia in H67D mice suggests that microglia in- Iron crease iron storage to maintain brain iron homeostasis. The 6-month-old H67D mice had increased levels Oxidative stress of GFAP, increased oxidatively modified protein levels, and increased cystine/glutamate antiporter (xCT) Gliosis and hemeoxygenase-1 (HO-1) expression indicating increased metabolic and oxidative stress. By 12 months, Neurodegenerative disease there was no longer increased astrogliosis or oxidative stress. The decrease in oxidative stress at 12 months could be related to an adaptive response by nuclear factor E2-related factor 2 (Nrf2) that regulates antioxi- dant enzymes expression and is increased in the H67D mice. These findings demonstrate that the H63D HFE impacts brain iron homeostasis, and promotes an environment of oxidative stress and induction of adaptive mechanisms. These data, along with literature reports on humans with HFE mutations provide the evidence to overturn the traditional paradigm that the brain is protected from HFE mutations. The H67D knock-in mouse can be used as a model to evaluate how the H63D HFE mutation contributes to neurodegenerative diseases. © 2013 Elsevier B.V. All rights reserved.

1. Introduction [5–7]. This biochemical penetrance of the H63D allele resulted in our investigations into the relationship between the H63D HFE genotype HFE polymorphisms are common allelic variants in Caucasians, and late onset neurodegenerative diseases [8] where increased brain particularly in Northern European (1:200–400) and Irish (1:100) iron is often reported [9,10]. populations. HFE protein interacts with the transferrin receptor The HFE protein is expressed in endothelial cells, choroid plexus (TfR) and regulates transferrin-mediated iron uptake [1,2]. Two com- and the ependymal cells where it can inﬂuence brain iron content mon HFE polymorphisms, H63D and C282Y, result in loss of ability to [11]. However, based on misinterpretation of studies in the mid- limit iron uptake via TfR. The C282Y HFE, generally associated with he- 1900s, the brain is thought to be protected from iron overload associ- reditary hemochromatosis (HH), is relatively rare (1.9%) while the ated with HFE mutations. However, these studies in the mid-1900s H63D HFE (8.1%) is more common in the general population [3,4]. Al- [12,13] and recent MRI studies [14–16] all demonstrate an iron accu- though the penetrance of H63D HFE for HH is lower than the C282Y mulation in the brain of HH-patients; including those areas protected HFE, the H63D HFE variant is associated with increased serum trans- by the blood–brain-barrier. Moreover, in healthy aged individuals the ferrin saturation, increased serum ferritin level and increased serum presence of H63D HFE and transferrin C2 is associated with higher iron level particularly in elderly populations (>55 years) and in brain ferritin iron [17]. Increased hippocampal and basal ganglia some of the demographic subgroups such as Mexican-American iron is associated with poor declarative and verbal working memory [18]. However, Jahanshad et al. [19] recently reported a positive association between H63D HFE and white matter ﬁber integrity in healthy ⁎ Corresponding author at: Department of Neurosurgery, The Pennsylvania State adults. University, College of Medicine, 500 University Drive (H110), Hershey, PA 17033-0850, A relationship between iron accumulation and neurodegenera- USA. Tel.: +1 717 531 4541; fax: +1 717 531 0091. E-mail addresses: [email protected] (W. Nandar), [email protected] tive disease is established [9,10] so it was logical to consider a rela- (E.B. Neely), [email protected] (E. Unger), [email protected] (J.R. Connor). tionship between HFE genotypes and neurodegenerative diseases.

The investigations into such a relationship in Alzheimer's disease variant PCR analysis was conducted using a forward primer (5′AGG have given mix results although most studies report either a rela- ACTCACTCTCTGGCAGCAGGAGGTAACCA3′) and a reverse primer tionship or a trend for H63D HFE to impact the disease particularly (5′TTTCTTTTACAAAGCTATATCCCCAGGGT3′). PCR conditions were: in the presence of the ApoE4 mutation [8,20]. In amyotrophic lateral 94°Cfor15min,94°Cfor45s,58°Cfor45s,39cyclesof72°Cfor sclerosis (ALS), the data are more consistent that H63D HFE is a risk 90 s and 72 °C for 10 min. Amplified PCR fragments were digested factor [8] although recent reports did not find an association [21,22]. with BspHI restriction enzyme for 2 h at 37 °C to detect H67D point mu- However, in a recent study [21] control subjects were pooled from tation. DNA fragments were separated by 2% agarose gel electrophoresis. five published studies which could be problematic because frequency of HFE genotype is region dependent. Nonetheless, these studies 2.3. Measurement of iron still reported, as the others, as many as 30% incidence of H63D HFE in the ALS population [21,22]. Brain and liver samples were harvested from 6- and 12-month- Thus, to determine the specific effects of H63D HFE on phenotypes old wild-type (+/+), heterozygous (+/H67D) and homozygous we have developed cell models [23] and, in this paper, introduce an an- (H67D/H67D) H67D knock-in mice. Samples were diluted 1:10 imal model, which carries an analogous HFE mutation (H63D HFE). In a (wt:v) with 0.32 M sucrose and homogenized. Total brain and hepatic human neuroblastoma cell line expressing different HFE genotypes, the iron concentrations (μg/g of tissue; wet weight) were measured tripli- H63D cells have increased iron, oxidative stress [23] and endoplasmic cate by graphite furnace atomic absorption spectrometry (model reticulum stress [24], increased glutamate release and monocyte 5100AA, Perkin-Elmer, Norwalk, CT) according to standard protocol chemoattractant protein-1 secretion [25,26] and tau phosphorylation [29]. [27]; each of which is proposed as a contributing factor to neurodegenerative diseases. Thus, we hypothesized that H63D HFE enables a con- 2.4. Immunblotting vergence of mechanisms that promote pathogenic processes. In this study, we generated in vivo model, a H67D knock-in mouse Brain and liver tissues from 6- and 12-month-old wild-type (+/+), line (mouse homolog of the human H63D), to evaluate the neurolog- +/H67D and H67D/H67D mice (n=4–6/genotype) were homogenized ical consequences of H63D HFE in vivo under controlled environmen- in homogenization buffer: 1× PBS, 0.5% NP-40 (IGEPAL; Sigma, St. Louis, tal conditions. We demonstrated that H63D HFE alters brain iron MO) and protease inhibitor cocktail (1:100; Sigma, St. Louis, MO). The homeostasis and creates an environment of oxidative stress. In the total protein concentration was determined with Pierce BCA protein long-term H67D mice will serve as a model to explore how H63D assay kit (Thermo scientific, MA). Total brain or liver homogenates HFE impacts disease mechanisms and therapeutic interventions in (20 μg) were separated by electrophoresis in Criterion polyacrylamide neurodegenerative disorders. Tris–HCl gel (4–20%; Bio-Rad, Hercules, CA). Proteins were then trans- ferred to nitrocellulose membranes and the membranes were blocked 2. Material and methods with 5% nonfat dry milk for 1 h at room temperature. After overnight incubation at 4 °C with primary antibodies, membranes were then incu- 2.1. Generation of H67D knock-in mice bated with enhanced chemiluminescent (ECL) anti-host horseradish peroxidase-linked secondary antibodies (Amersham Bioscience, The H67D knock-in mice (mouse homologous to H63D in Piscataway, NJ) for 1 h at room temperature. The signal was visualized humans) were commercially generated (inGenious Targeting Labora- by ECL detection (Perkin Elmer, Waltham, MA) and Multigauge soft- tory, Inc, NY) as previously described by Tomatsu et al. [28]. Briefly, ware (V3.0; Fuji film system) was used to quantitate the intensity of the HFE gene isolated from 129/SvJ mouse bacterial artificial chromo- the band. Following primary antibodies were used: HFE (1:500; Sigma, some library was subcloned into the pBS vector. The H67D point mu- St. Louis, MO), H-ferritin (1:1000; Covence, Princeton, NJ), L-ferritin tation (199C to –G) was introduced into exon 2 of HFE gene by (1:500; abcam, Cambridge, MA), transferrin receptor (1:500;; Zymed site-directed mutagenesis, which destroyed a BspHI restriction site. Laboratories Inc., San Francisco, CA), divalent metal transporter-1 The HFE gene fragment containing H67D mutation was added be- (1:1000; Convence, Princeton, NJ), transferrin (1:1000; MP biomedi- tween the thymidine kinase (TK) and neor gene of a targeting vector cals, Solon, OH), T cell immunoglobulin and mucin domain-containing (pPNT–loxP2 vector). The resulting targeting vector was linearized protein-2 (Tim-2; 1:2000; abcam, Cambridge, MA), cystine/glutamate with NotI and introduced into the 129/Sv-derived embryonic stem antiporter (xCT; 1:500; abcam, Cambridge, MA), hemeoxygenase-1 (ES) cell line RW4 (Incyte Genomics Systems, St. Louis) by electropora- (HO-1; 1:500; Enzo Life Science, Farmingdale, NY), Nrf2 (1:1000; tion. ES clones that were resistant to both 200 μg/ml G418 (BIBCO/BRL) abcam, Cambridge, MA), GFAP (1:2000; Dako, Carpinteria, CA) and and 2 μM ganciclovir (Syntex Chemicals, Boulder, CO) were isolated beta-actin (1:3000; Sigma, St. Louis, MO). and used for injection into C57BL/6J blastocysts. Chimeric males were bred to C57BL/6J females for germ-line transmission. The F1 heterozy- 2.5. Histology gous mice were bred to Cre mice to remove neor gene flanked by loxP sites. The resultant neor-excised heterozygotes were interbred to gen- Six- and 12-month-old wild-type (+/+) and H67D/H67D mice erate wild-type (+/+), heterozygous (+/H67D) and homozygous (n=4/genotype) were perfused transcardially with Ringer's solution (H67D/H67D) H67D knock-in mice. followed by ice-cold 4% paraformaldehyde. The brains were paraffin- Mice were maintained under normal housing conditions. They embedded and sectioned coronally at 6-μm-thick. The sections were were given ad libitum access to rodent chow pellets and water. Both deparaffinized and then rehydrated through a series of ethanol. males and females were included in all experiments. All procedures After antigen retrieval with sodium citrate (pH 6), endogenous per- were conducted according to the NIH Guide for the Care and Use of oxidase activity was blocked with hydrogen peroxide (3.7% in meth- Laboratory Animals and were approved by the Pennsylvania State anol) for 20 min at room temperature. The sections were then University College of Medicine Institutional Animal Care and Use blocked for 1 h with 2% milk and were incubated with primary anti- Committee. bodies overnight at 4 °C followed by 1 h of incubation at room temperature with biotinylated anti-host secondary antibody (1:200; 2.2. Mice genotyping vector laboratories, Burlingame, CA). Immunoreactivity was detected using the avidin biotin complex (ABC) and 3,3′-diaminobenzidine DNA was isolated from tail biopsies according to DNeasy blood and (DAB; vector laboratories, Burlingame, CA). The sections were ana- tissue kit (QIAGEN, CA). To amplify HFE gene including the H67D lyzed with a bright-field microscopy by an investigator blinded for W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741 731 genotypes. Following primary antibodies were used for immuno- which was crude myelin protein. The pellets were kept at −80 °C staining: L-ferritin (1:250; abcam, Cambridge, MA), transferrin recep- for 20 min and then were freeze-dry using a lyophilizer overnight. tor (1:250; Zymed Laboratories Inc., San Francisco, CA), divalent The pellets were then left at room temperature for 20 min and were metal transporter-1 (1:200; convence, Princeton, NJ) and transferrin weighed. The pellets were resuspended with RIPA buffer (Sigma, St. (1:200; MP biomedicals, Solon, OH). Louis, MO) and centrifuged 45 min at 51,000 rpm at 4 °C. Superna- For immunofluorescence, after overnight incubation with rabbit tant was collected and protein concentration was determined with anti-GFAP antibody (1:1000; Dako, Carpinteria, CA) or rabbit Iba-1 Pierce BCA protein assay kit (Thermo scientific, MA). Total protein antibody (1:600; Wako, Richmond, VA), sections were probed with of 10 μg was used for immunoblot analyses to determine the expres- Alexa Flour 488 secondary antibody (Invitrogen, Grand Island, NY) sion of myelin basic protein (MBP; 1:1000; abcam, Cambridge, MA), for 1 h in the dark at room temperature. After washes, slides were proteolipid protein (PLP; 1:1000; Millipore, Billerica, MA) and CNPase mounted and the sections were analyzed with fluorescence microsco- (1:500; abcam, Cambridge, MA). py. For double immunofluorescence staining, because both L-ferritin and Iba-1 antibodies were made from the same host we fluorescently 2.7. Measurement of oxidatively modified proteins labeled L-ferritin using a DyLight 550 antibody labeling kit (Thermo fisher scientific, Waltham, MA) prior to the incubation with brain sec- As a consequence of oxidative modification to proteins, carbonyl tions. The sections were first incubated overnight with rabbit Iba-1 groups are introduced to the side chain of amino acids. These carbonyl antibody followed by overnight incubation with DyLight 550 labeled groups hallmark the oxidative status of protein [30]. An Oxyblot kit L-ferritin. The sections were then probed with Alexa Flour 488 sec- (Millipore, Billerica, MA) was used to measure protein carbonyl levels. ondary antibody for 1 h in the dark at room temperature. After Briefly, total brain homogenates (20 μg) from 6- and 12-month-old washes, the slides were mounted and the sections were analyzed wild-type, +/H67D and H67D/H67D mice (6/genotype) were reacted with fluorescence microscopy. with 2,4-dinitrophenylhydrazone (DNP-hydrazone). Samples were then treated according to the manufacturer's protocol. 2.6. Myelin isolation and analysis of myelin protein 2.8. Statistical analyses Brain samples from 6- and 12-month-old mice (5 to 6/genotype) were weighed and homogenized with 1.5 ml of 0.32 M sucrose. Data were expressed as mean±standard error. An analysis of var- After adding 2 ml of 0.85 M sucrose samples were centrifuged for iance (one-way ANOVA; GraphPad Prism 4) followed by a Tukey mul- 30 min at 41,000 rpm at 4 °C. The supernatant was discarded; the tiple comparison or Dunnett test was used to compare between middle layer was collected and resuspended with 2.5 ml iron free experimental groups. For iron measurement, two-way ANOVA was water (Sigma, St. Louis, MO). The samples were centrifuged for performed to analyze the interaction of age and genotype with iron 15 min at 41,000 rpm at 4 °C. Supernatant was discarded and the pel- concentration. Bonferroni posttest was used to compare between ex- let was resuspended with 3.0 ml iron free water. The samples were perimental parameters. A value of pb0.05 was considered significant centrifuged 10 min at 17,000 rpm at 4 °C and collected the pellet, for all experiments.

Fig. 1. Increased body weight and hepatic iron concentration in H67D knock-in mice. (A) Generation of H67D knock-in mice. PCR analysis of DNA obtained from tail biopsies was followed by digestion with BspHI restriction enzyme to detect the H67D point mutation. DNA digested with BspHI from wild-type mice (+/+) results 240 and 260 bp; DNA digested with BspHI from +/H67D mice results 500, 240 and 260 bp and DNA digested with BspHI from H67D/H67D results 500 bp. (B) Body weight was taken at 6 and 12 months of age in three groups. At both ages, body weight of H67D/H67D mice is higher compared to the wild-type mice. Bars represent mean±standard error. (*=pb0.05, **=pb0.01; n=14 to 36 per genotype for each age group). (C) Total iron concentration measured by atomic absorption spectrometry is 67% and 70% increase in the liver of 6- and 12-month-old H67D/H67D mice compared to the wild-type (+/+) mice. Hepatic iron concentration in H67D/H67D mice is 65% and 64% increase compared to +/H67D mice for both age groups. Bars represent mean±standard error. * represents a signiﬁcant difference from wild-type (pb0.05) and # represents a signiﬁcant difference from +/H67D (pb0.05). n=4 to 9 per genotype. 732 W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741

Table 1 Summary ﬁndings from neurological characterization of the H67D mice.

Proteins Total expression level in the brain (relative to wild-type)

6-month-old 12-month-old H67D mice H67D mice

Iron 22% ↑ Not different HFE ↑ Not different H-ferritin ↑↑ L-ferritin Not different ↑ Transferrin receptor Not different Not different Transferrin Not different ↓ ↓ Fig. 2. Total brain iron concentration is altered in H67D/H67D mice. Total brain iron was Divalent metal transporter-1 40% Not different ↓ measured with atomic absorption spectrometry in 6- and 12-month-old mice. Brain Tim-2 Not different iron concentration is 22% and 18.6% increase in H67D/H67D and +/H67D compared to Myelin proteins Not different Not different ↑ wild-type (+/+) mice at 6 months (p=0.26). At 12 months of age, brain iron level in Iba-1 (microglia) Not different ↑ H67D knock-in mice is not signiﬁcantly different from the wild-type mice. Analysis of GFAP Not different ﬁ ↑ brain iron level by age indicates wild-type and +/H67D mice have increased brain iron Oxidatively modi ed proteins Not different ↑ with age (32.9% and 26.5% respectively). Brain iron level is increased only 6.5% in Cystine/glutamate transporter (xCT) Not different ↑ 12-month-old H67D/H67D mice compared to 6-month-old H67D/H67D mice. Bars repre- Hemeoxygenase-1 (HO-1) Not different ↑ sent mean±standard error. (n=4 to 8 per genotype in both age groups). Nrf2 Not different

3. Results level was 22% higher in H67D/H67D (22.57±2.0 μg/g of brain) and 3.1. Generation of H67D mice 18.6% higher in +/H67D mice (21.95±1.4 μg/g of brain) compared to wild-type mice (18.5±0.7 μg/g of brain) although these differ- A H67D knock-in mouse line (mouse homolog of the human ences did not reach statistical significance (p=0.26). At 12 months H63D) was generated by site-directed mutagenesis to murine HFE of age, total brain iron concentration in H67D/H67D mice (24.04± gene. The resultant heterozygous mice were bred to generate wild- 1.1 μg/g) and +/H67D mice (27.76±3.0 μg/g) was not different com- type, heterozygous and homozygous H67D knock-in mice. Mice pared to wild-type mice (24.58±1.4 μg/g). There was a significant carrying the H67D variant were indistinguishable at birth from their interaction for age and iron concentrations indicating that regardless littermate controls. Homozygous H67D mice develop normally and of genotypes brain iron concentration increased with age (p=0.01). are reproductively viable. Genotyping of mice was performed by Compared to 6-month-old mice, by 12 months, brain iron concentra- PCR analysis of DNA obtained from tail biopsies and subsequent tion increased by 33% in the wild-type, 26.5% in the +/H67D but only digestion with BspHI restriction enzyme (Fig. 1A). Body weights of 6.5% in H67D/H67D mice (Fig. 2 and Table 1). mice were taken at 6 and 12 months of age. At both ages, H67D/H67D mice had significantly higher body weight than wild-type mice while 3.3. Alteration in expression of proteins involved in iron homeostasis in the heterozygous H67D (+/H67D) mice had similar body weight as H67D mice the wild-type (Fig. 1B). To confirm whether the allelic variant is functional we determined Although total iron levels are important, it is the response of the hepatic iron levels in 6- and 12-month-old H67D mice. Compared to regulatory proteins that are perhaps most important because they the wild-type mice, 6- and 12-month-old H67D/H67D mice had a maintain homeostasis. Thus, we evaluated the expressions of proteins 67% (266.4±27.3 vs. 159.6±31.9 μg/g of liver) and 70% (281.35± involved in brain iron homeostasis: HFE, H-ferritin, L-ferritin, trans- 50.7 vs. 165.7±22.9 μg/g of liver) increase in hepatic iron concentration ferrin receptor (TfR), transferrin (Tf), divalent metal transporter-1 while +/H67D mice had similar hepatic iron concentration as wild-type (DMT-1) and T cell immunoglobulin and mucin domain-containing mice at both ages (Fig. 1C). Six and 12-month-old H67D/H67D mice protein-2 (Tim-2). Western blot analyses of brain homogenates also had changes in iron management protein expressions in the liver. from 6- and 12-month-old mice revealed differences in the levels of Consistent with increased iron concentration iron storage proteins, iron management proteins in H67D/H67D mice compared to the H-ferritin and L-ferritin were significantly increased while iron trans- wild-type (Table 1 and Fig. 3). At 6 months, H67D/H67D mice had port protein transferrin receptor (TfR) was significantly decreased in significant increases in HFE (Fig. 3A) and H-ferritin (Fig. 3C) and a H67D/H67D mice compared to wild-type mice at both ages. Ceruloplas- 40% decrease in DMT-1 which did not reach statistical significance min, which is involved in iron export, was also significantly decreased in (p=0.07; Fig. 3I). L-ferritin, Tf, Tim-2 levels (Fig. 3E, G, K) and TfR 12-month-old H67D/H67D mice compared to the wild-type (Supple- (data not shown) in H67D/H67D mice were not different from mentary Fig. 1). Together these results indicated that the allelic variant wild-type mice. At 12 months of age, H67D/H67D mice had increases is functional in H67D mice. in H- and L-ferritin levels (Fig. 3D, F), and decreases in Tf (Fig. 3H) and Tim-2 levels (Fig. 3L) compared to wild-type mice. The relative con- 3.2. Brain iron concentration in H67D mice centrations of HFE, DMT-1 (Fig. 3B, J) and TfR (not shown) in H67D/ H67D mice were not different from wild-type mice at this age. None Total brain iron was measured in 6- and 12-month-old mice by of the iron management proteins levels in +/H67D mice were different atomic absorption spectrometry. At 6 months of age, total brain iron from wild-type at any ages (Fig. 3A–L).

Fig. 3. Altered iron management protein expressions in H67D knock-in mice. (A–L) Brain homogenates from 6- and 12-month-old wild-type (+/+), +/H67D and H67D/H67D were determined for the presence of HFE, H-ferritin, L-ferritin, transferrin, divalent metal transporter-1 and T cell immunoglobulin and mucin domain-containing protein-2 (Tim-2) by Western blot. A representative Western blot is shown for each protein and quantification of blots is shown as bar graphs. The expression level was normalized to β-actin. At 6 months of age, HFE (A) and H-ferritin expression is increased (C) while DMT-1 expression is tended to decrease (I; p=0.07) in H67D/H67D mice. L-ferritin (E), transferrin (G) and Tim-2 expressions (K) are not significantly changed in H67D knock-in mice. At 12 months of age, H-ferritin (D) and L-ferritin (F) expressions are increased while transferrin (H) and Tim-2 expressions (L) are decreased in H67D/H67D compared to +/+ mice. HFE (B) and DMT-1 expressions (J) in H67D/H67D mice do not alter significantly. Bars represent mean±standard error. * represents a significant difference from wild-type (*=pb0.05; **=pb0.01). # represents a significant difference from +/H67D (#=pb0.05; ##=pb0.01; ###=pb0.001; n=4 to 6 per genotype). W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741 733 734 W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741

We also determined the distribution and cellular localization of TfR, (Fig. 8 and Table 1). There also appeared to be an increase in number DMT-1, transferrin and L-ferritin by immunohistochemical staining in of Iba-1 positive microglia and L-ferritin immunoreactive microglia in both age groups. At the cellular level, transferrin receptor (TfR) staining 12-month-old H67D/H67D indicating the presence of microgliosis in was primarily confined to neurons with very little or no TfR staining in H67D mice (Fig. 8E, F). However, the number of microglia in H67D the white matter tracts in either group. There appeared to be regional mice at 6 months did not differ from wild-type mice (Supplementary differences in staining for TfR at 6 months; compared to wild-type Fig. 2 and Table 1). L-ferritin did not co-localize with GFAP positive mice, H67D/H67D mice had weaker neuronal staining for TfR in the cor- astrocytes (Supplementary Fig. 3). tex (Fig. 4A–B) and the cerebellum (data not shown) but stronger TfR staining in the striatum (Fig. 4C–D). Immunohistochemical analysis 3.4. Myelin proteins were not changed in H67D mice for DMT-1 revealed that similar cell types were stained for DMT-1 protein in both groups (Fig. 5). However, compared to wild-type mice Crude myelin protein was extracted by sucrose gradient and ultra- (Fig. 5A, C, E), 6-month-old H67D/H67D mice had relatively weaker centrifugation and three major myelin proteins in myelin extract neuronal staining for DMT-1 in the cortex (Fig. 5B) and the purkinje were analyzed in 6- and 12-month-old mice by immunoblotting. cells of cerebellum (Fig. 5F), and weaker staining in oligodendrocytes Myelin basic protein (MBP), proteolipid protein (PLP) and CNPase in the striatum (Fig. 5D). The DMT-1 immunostaining was not different protein were not changed significantly between any of the groups between 2 groups at 12 months (data not shown), which is consistent at either age (Supplementary Fig. 4A–F and Table 1). with immunoblot analysis. For transferrin, the same type of cells was positive for staining in both wild-type and H67D/H67D mice. Neuronal 3.5. H67D HFE is associated with astrogliosis transferrin staining was observed in the cortex (Fig. 6A, B) while transferrin staining was found predominantly in oligodendrocytes in the stri- To determine whether H67D HFE is associated with increased atum and corpus callosum (Fig. 6C–F). Staining intensity for transferrin gliosis, we evaluated GFAP staining in H67D mice at both ages was much less in H67D/H67D (Fig. 6B, D, F) compared to wild-type mice (Fig. 9 and Table 1). GFAP staining was increased in all observed in all regions examined at 12 months (Fig. 6A, C, E). Higher L-ferritin brain regions; the cortex, hippocampus and the cerebellum in staining intensity was seen only in 12-month-old H67D/H67D mice 6-month-old H67D/H67D (Fig. 9D, F, H, J) compared to wild-type compared to wild-type mice, which is consistent with immunoblot mice (Fig. 9C, E, G, I), which is consistent with the significant increase analysis. L-ferritin staining was found primarily in the glial cells, in total GFAP level in H67D knock-in mice determined by immunoblot- although there was relatively weak neuronal staining in the cortex of ting (Fig. 9A). GFAP staining and total GFAP level in 12-month-old H67D H67D/H67D (Fig. 7A–B). L-ferritin staining was primarily found in mice was not changed significantly from wild-type mice (Fig. 9B, K–R). the oligodendrocytes in the striatum and thalamus (Fig. 7C–F) in both groups; however, there was more robust L-ferritin staining in 3.6. H67D HFE is associated with oxidative stress H67D/H67D mice (Fig. 7B, D, F) compared to the wild-type mice (Fig. 7A, C, E). Because H63D HFE is associated with higher baseline stress in our To determine whether L-ferritin positive glial cells observed in the cell models [23], we determined the level of oxidatively modified pro- cortex were either astrocytes or microglia, we performed double teins (carbonyl level), and expression of xCT antiporter, which is immunofluorescence staining. The fluorescence analysis also reveals essential for maintaining intracellular glutathione level [31], and an increase L-ferritin staining in 12-month-old H67D/H67D mice hemeoxygenase-1 (HO-1; [32]) as indices of oxidative stress in and strong co-localization of L-ferritin with Iba-1 positive microglia H67D mice. The level of oxidatively modified proteins increased in

Fig. 4. Immunohistochemical localization for transferrin receptor (TfR). Neurons in the cortex of both wild-type (+/+) and H67D/H67D mice express TfR (A, B); however TfR staining is weaker in H67D/H67D mice. In striatum, TfR staining is primarily conﬁned to neurons in both groups with little or no TfR staining is observed in the white matter tract. Compared to wild-type, H67D/H67D mice have relatively higher staining intensity for TfR in the striatum (C, D). A scale bar represents 50 μm. n=4 per genotype. W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741 735

Fig. 5. Immunohistochemical localization for divalent metal transporter-1(DMT-1). Neurons in the cortex of both wild-type (+/+) and H67D/H67D mice express DMT-1 with much less DMT-1 staining is observed in H67D/H67D mice compared to wild-type mice (arrows in A, B). In striatum, DMT-1 expresses predominantly in oligodendrocytes (arrows in C, D). Blood vessels staining for DMT-1 are also observed in both wild-type and H67D/H67D mice; however, the staining intensity is relatively weaker in H67D mice (arrow head in C, D). In cerebellum, strong neuronal staining for DMT-1 is observed in Purkinje cells in wild-type mice (arrows in E). In contrast, Purkinje cells of cerebellum in H67D/H67D mice have relatively little staining for DMT-1 (arrows in F). bv=blood vessel. A scale bar represents 50 μm. n=4 per genotype. both H67D/H67D (64%) and +/H67D (50%) mice at 6 months of age the oxidatively modiﬁed proteins level, and xCT and HO-1 expression compared to the wild-type (Fig. 10A and Table 1). Moreover, xCT ex- between three groups at 12 months of age (Fig. 10B, D, F and Table 1). pression was 86% higher and HO-1 expression was 27% higher in the To examine whether an increase oxidative stress observed in brains of 6-month-old H67D/H67D mice compared to the wild-type 6-month-old H67D mice, is associated with an impaired cellular defense mice (Fig. 10C, E and Table 1). However, there was no difference in system against redox stress we measured the expression of nuclear

Fig. 6. Immunohistochemical localization for transferrin. Neurons in the cortex of both wild-type (+/+) and H67D/H67D mice express transferrin (arrows in A, B). Few transferrin positive oligodendrocytes are observed in the cortex (arrow head in A, B). However, transferrin expresses predominantly in oligodendrocytes in the striatum (arrows in C, D) and corpus callosum (arrows in E, F) of both wild-type and H67D/H67D mice. Transferrin positive oligodendrocytes appear in a row in the corpus callosum (arrows in E, F) and only a few of process bearing oligodendrocytes staining for transferrin are present (arrow heads in E, F). In all observed regions, transferrin staining is much less in H67D/H67D mice compared to the wild-type mice. LV=lateral ventricle; bv=blood vessel. A scale bar represents 50 μm. n=4 per genotype. 736 W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741

Fig. 7. Immunohistochemical localization for L-ferritin. L-ferritin staining in the cortex is relatively weak in both wild-type (+/+) and H67D/H67D mice. The staining is mostly confined to glial cells (arrows in B). L-ferritin staining in the striatum (arrows in C and D) and the thalamus (E–F) is primarily confined to oligodendrocytes. L-ferritin staining in the cortex, striatum and the thalamus is relatively weak in wild-type mice (A, C, and E). In contrast, L-ferritin staining is more robust with more L-ferritin-positive oligodendrocytes in H67D/H67D mice (B, D, and F). A scale bar represents 50 μm. n=4 per genotype. factor E2-related factor 2 (Nrf2) that controls endogenous anti- 4. Discussion oxidant genes transcription. The expression of Nrf2 in 6-month-old H67D/H67D and +/H67D mice was not different from wild-type mice Because liver iron accumulation is a common histologic finding (Fig. 11AandTable 1) but was 69% higher (pb0.05) in 12-month-old and perhaps the gold standard for diagnosis of HFE associated hemo- H67D/H67D mice compared to the wild-type (Fig. 11BandTable 1). chromatosis we first determined the liver iron concentration in H67D

Fig. 8. Double immunostaining showing the co-localization of L-ferritin and Iba-1. Double ﬂuorescence analysis indicates that L-ferritin ﬂuorescence staining is present primarily in the glial cells in the cortex of both wild-type (+/+) and H67D mice (A, D); however there are increased number of L-ferritin positive glial cells in H67D mice (D). Merged images indicate the co-localization of L-ferritin with Iba-1 positive microglia to greater extent (C, F). More L-ferritin positive microglia is observed in the cortex of H67D mice (E, F) compared to the wild-type (B, C). A scale bar represents 50 μm. n=4 per genotype. W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741 737

Fig. 9. Increased GFAP in 6-month-old but not in 12-month-old H67D knock-in mice. (A, B) GFAP protein expression was determined in brain homogenates from 6- and 12-month-old mice. Quantification of blots is shown as bar graphs. The expression level was normalized to β-actin. At 6 months, the +/H67D and H67D/H67D mice have significant increase in GFAP protein expression compared to +/+ mice. Total brain GFAP expression in 12-month-old +/H67D and H67D/H67D mice did not change significantly compared to +/+ mice. Bars represent mean±standard error. (*=pb0.05; **=pb0.01; n=5 to 6 per genotype). (C–J) Immunofluorescence analyses of GFAP in brains of 6-month-old mice indicates that GFAP immunoreactivity is increased in the cortex (D), hippocampus (F and H) and cerebellum (J) of H67D/H67D compared to +/+ mice (C, E, G and I) (n=4 per genotype). (K–R) Immunofluorescence analyses of GFAP in brains of 12-month-old mice indicates that GFAP immunoreactivity in the cortex (L), hippocampus (N and P) and cerebellum (R) of H67D/H67D mice is not different compared to +/+ mice (K, M, O and Q) (n=4 per genotype). mice. Even on standard diet, total hepatic iron content was significantly mice at birth, H67D/H67D mice have increased weight gain with age. elevated in both 6- and 12-month-old H67D/H67D mice, which is con- Increased body weight together with higher hepatic iron concentration sistent with the previous report of Tomatsu et al. [28] for 10-week-old in H67D mice may be relevant to the increased prevalence of metabolic H67D mice. H67D/H67D mice also had significant alterations in expres- syndrome including obesity that is positively associated with elevated sion of liver iron management proteins such as increased storage pro- iron stores and increased serum ferritin levels [33–36]. Thus, the utility teins while decreased transport proteins. Changes in liver iron profiles of this model could extend beyond studies directly involving the ner- in H67D mice indicate that the H67D allelic variant is functional in vous system and have relevance to studies on HFE mutations in general. these mice. Although H67D mice are indistinguishable from wild-type Because HFE polymorphisms are common allelic variants in Caucasians, 738 W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741

Fig. 10. Increased oxidative stress in H67D knock-in mice. An oxyblot assay and slotblot analysis was used to measure total oxidatively modified protein levels in 6-month-old and 12-month-old mice. (A and B). Total oxidatively modified protein levels is significantly higher in 6-month-old +/H67D (50%) and H67D/H67D (64%) compared to wild-type (+/+) mice (A). By 12 months, total oxidatively modified protein levels in H67D mice do not change significantly compared to +/+ mice (B). Brain homogenates from 6- and 12-month-old wild-type (+/+), +/H67D and H67D/H67D were determined for the expression of cystine/glutamate antiporter (xCT) that is essential for maintaining intracellular glutathione level and hemeoxygenase-1 (HO-1). A representative Western blot is shown and quantification of blots is shown as bar graphs. The expression level was normalized to β-actin. The expression of xCT and HO-1 in 6-month-old H67D/H67D is increased by 86% and 27% respectively compared to the wild-type (+/+) mice (C, E). Brain xCT and HO-1 expression level in H67D/H67D and +/H67D mice is not significantly different compared to the wild-type (+/+) mice at 12 months (D, F). Bars represent mean±standard error. (*=pb0.05; **=pb0.01; ***=pb0.001; n=5 to 6 per genotype). the H67D mouse line presented here is a meaningful model for human multiple changes in cells and animal models, including ER stress aging and diseases. [24] and cholesterol disruption [40] which suggest the HFE mutant This model differs from previous investigations that used HFE protein may impact the cell phenotype beyond iron uptake. knockout mice into the association between HFE and brain iron accu- Our study evaluated brain iron profiles in H67D knock-in mice at 6 mulation. Although both our model and the knockout model accumu- and 12 months of age. Brain iron was increased by 22% in H67D mice, late iron in the liver [28,37], only our H67D knock-in model showed but this was not statistically significant. However, there was in- brain iron accumulation. However, the HFE knockout mice were ex- creased expression of iron storage protein H-ferritin at both ages as amined at an earlier age than ours [38,39]. Our model with an analo- well as an increase in L-ferritin at 12 months in the H67D mice. gous HFE mutation (H67D HFE) is more similar to the human These findings are strong indication that the increased amount of condition and MRI studies [14–16] and early histological studies brain iron in H67D mice was biologically meaningful and suggest [12,13] that report increased iron in the brain in association with brain iron metabolism is altered in these mice. Perhaps the most im- HFE mutations. The presence of the HFE mutation is associated with pressive evidence for altered brain iron homeostasis in H67D mice is W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741 739

Transferrin, the major iron mobilization protein, is 39% decreased in H67D mice. Because transferrin is synthesized primarily by the oligodendrocytes [49] reduced transferrin may suggest decreased metabolic activity by oligodendrocytes. However, transferrin is also taken up by the brain [50,51] and iron overload lowers transferrin uptake by the brain [50]. Decreased transferrin levels are also associated with aging and brain disease [52]. Together these data suggest lower transferrin levels in H67D mice would decrease iron mobilization and limit iron delivery particularly to neurons. The other iron delivery protein in the brain, Tim-2 is decreased in 12-month-old H67D mice. Tim-2 is a receptor for H-ferritin on oligodendrocytes and its expression is inversely related to iron status [53]. Therefore, decreased Tim-2 expression in H67D mice is an additional response to decrease iron availability. Despite the decrease in transferrin and Tim-2, myelin proteins expression is normal but total brain cholesterol is decreased [40]. Cholesterol is expressed by neurons as well as found in myelin, thus further analysis of myelin in the presence of the HFE gene variants is warranted particularly in light of the diffu- sion weighted imaging (DWI) analysis by Jahanshad et al. [19] suggesting that H63D HFE is associated with increased myelin integrity. An additional compensatory response indicating increased iron availability in the brain is the 40% decrease in DMT-1 levels in 6-month-old H67D mice. DMT-1 transports iron out of the endosome to the cytosol of the endothelial cell and is down-regulated with increased iron availability. DMT-1 is found in brain endothelial and ependymal cells, and a mutation in DMT-1 led to less detectable Fig. 11. H67D HFE increases Nrf2 expression. Brain homogenates from 6- and iron in both neurons and glia [54,55]. In H67D mice, DMT-1 staining 12-month-old wild-type (+/+), +/H67D and H67D/H67D were determined for the is lower in the cortex, striatum and cerebellum suggesting that cells expression of nuclear factor E2-related factor 2 (Nrf2) that controls the endogenous are exposed to increased iron. Further evidence for altered brain anti-oxidant genes transcription in response to redox stress. A representative Western blot is shown and quantification of blots is shown as bar graphs. The expression level iron homeostasis in 12-month-old H67D mice is a 2-fold increase in was normalized to β-actin. (A) The expression of Nrf2 in 6-month-old H67D/H67D L-ferritin, which involves in long-term iron storage [56]. Increased and +/H67D mice is not different significantly from wild-type (+/+) mice. (B) Brain L-ferritin staining is found in microglia and neurons; the latter Nrf2 expression level is increased in 12-month-old H67D/H67D mice compared to being visible but weak. Although L-ferritin is primarily found in glial b the wild-type mice. Bars represent mean±standard error. (*=p 0.05; n=5 to 6 cells [57], neurons have capacity to express L-ferritin when chal- per genotype in both age group). lenged with iron [58]. Therefore, the presence of L-ferritin positive microglia and neurons in H67D mice suggests the initiation of adap- the gliosis and increased oxidative stress indicated by increased oxi- tive responses and that microglia increases iron storage as an attempt datively modified proteins, and increased expression of xCT and to effectively manage the iron that has accumulated in the brain. HO-1. Of note, is that the consequences of loss of iron homeostasis An additional change in glia in the H67D mice is the increased GFAP (increased oxidative stress and astrogliosis) are manifested in the expression throughout the brain at 6 months indicating astrogliosis. Re- brains of the 6-month-old mice but not at 12 months. The lack of ox- active gliosis is a rapid response to CNS injury and metabolic stress [59]; idative stress in 12 months of age could be the result of an apparent thus, increased GFAP expression indicates that cellular metabolic adaptive response to the oxidative stress mediated by Nrf2 which stress occurs in the brains of 6-month-old H67D mice. However, at was elevated in the 12-month-old H67D mice. 12 months, there is no longer increased cellular metabolic stress and in- In addition to the increase in Nrf2 as an adaptive response, there are dicates that the adaptive mechanisms to protect against iron-induced multiple adaptive responses by the iron management proteins. At toxicity were successful. However, the metabolic disruptions as conse- 6 months, H67D mice have increased H-ferritin which is involved in quences of the altered iron status were not completely restored given rapid iron uptake and iron detoxification [41,42], and a regional de- the finding of persistent alterations in cholesterol metabolism and crease in TfR, which delivers iron to neurons [43,44].Theexpression behaviors [40] and increased ER stress [24] in the H67D mice. of ferritin and TfR are regulated post-transcriptionally according to In summary, there are two salient findings in this study. Firstly, we iron status. Iron overload increases ferritin protein synthesis while provide the direct in vivo evidence that H63D HFE impacts brain iron decreases TfR protein synthesis [10]. Thus, increased H-ferritin is con- homeostasis and creates environment for oxidative stress. Our find- sistent with increased iron concentration in H67D mice. Although we ings together with recent MRI studies [14–17] shift the existing clas- expected a decrease in TfR expression, total TfR expression in H67D sical paradigm that brain is protected from iron overload associated mice was not different from wild-type mice. At cellular level however, with HFE mutations. Secondly, we demonstrated that as they age, we found regional differences in TfR staining in H67D mice with rela- H67D mice appear to develop adaptive mechanisms such as elevated tively weaker in the cortex and cerebellum but increased TfR staining Nrf2, decreased iron mobilization via Tf, and increased iron storage in the striatum compared to the wild-type. Regional differences in TfR within L-ferritin that limits the amount of iron available to induce oxi- expression have been reported by Dornelles et al. [45] who demonstrat- dative stress. Although there are compensatory mechanisms at younger ed that iron loading decreased TfR mRNA in the cortex and hippocam- ages, they are not sufficient to protect the brain because 6-month-old pus while it increased TfR mRNA in the striatum. Regional differences H67D mice have increased oxidative stress and astrogliosis. Moreover, in TfR expression may be associated with heterogeneity of iron distribu- our findings suggest that H67D mice may be more susceptible to envi- tion in the brain [46,47]. In all brain regions examined, we found that ronmental challenges and/or genetic modifiers at younger ages when TfR staining was primarily confined to neurons in both groups which there is a stress milieu and gliotic responses trying to adapt to the met- are consistent with previous studies [43,44,48]. abolic stress. The presence of oxidative and cellular stress in brains of 740 W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741

H67D mice support our hypothesis that H63D HFE establishes an envi- [16] M.P. Rutgers, A. Pielen, M. Gille, Chronic cerebellar ataxia and hereditary hemochromatosis: causal or coincidental association? J. Neurol. 254 (2007) ronment for pathogenic factors that promote cellular damage and 1296–1297. neurodegeneration. For example, a double transgenic mouse line that [17] G. Bartzokis, P.H. Lu, T.A. Tishler, D.G. Peters, A. Kosenko, K.A. Barrall, J.P. Finn, P. carries both SOD1(G93A) mutation and the H67D gene variant have ac- Villablanca, G. Laub, L.L. Altshuler, D.H. Geschwind, J. Mintz, E. Neely, J.R. Connor, Prevalent iron metabolism gene variants associated with increased brain ferritin celerated disease progression and shorter survival than SOD1(G93A) iron in healthy older men, J. Alzheimers Dis. 20 (2010) 333–341. ALS mouse model [60]. Thus, these data strongly indicate that the [18] G. Bartzokis, P.H. Lu, K. Tingus, D.G. Peters, C.P. Amar, T.A. Tishler, J.P. Finn, P. H67D mouse line presented here can be used as a model to evaluate Villablanca, L.L. Altshuler, J. Mintz, E. Neely, J.R. Connor, Gender and iron genes how H63D HFE contributes to disease mechanisms and its impacts on may modify associations between brain iron and memory in healthy aging, Neuropsychopharmacology 36 (2011) 1375–1384. the treatment strategies in neurodegenerative diseases. [19] N. Jahanshad, O. Kohannim, D.P. Hibar, J.L. Stein, K.L. McMahon, G.I. de Zubicaray, Supplementary data to this article can be found online at http:// S.E. Medland, G.W. Montgomery, J.B. Whitfield, N.G. Martin, M.J. Wright, A.W. dx.doi.org/10.1016/j.bbadis.2013.02.009. Toga, P.M. Thompson, Brain structure in healthy adults is related to serum transferrin and the H63D polymorphism in the HFE gene, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) E851–E859. [20] J.R. Connor, S.Y. Lee, HFE mutations and Alzheimer's disease, J. Alzheimers Dis. 10 Abbreviations (2006) 267–276. DMT-1 divalent metal transporter-1 [21] J. Praline, H. Blasco, P. Vourc'h, V. Rat, C. Gendrot, W. Camu, C.R. Andres, Study of the HFE gene common polymorphisms in French patients with sporadic HO-1 hemeoxygenase-1 amyotrophic lateral sclerosis, J. Neurol. Sci. 317 (2012) 58–61. MBP myelin basic protein [22] W. van Rheenen, F.P. Diekstra, P.T. van Doormaal, M. Seelen, K. Kenna, R. McLaughlin, Nrf2 nuclear factor E2-related factor 2 A.Shatunov,D.Czell,M.A.vanEs,P.W.vanVught,P.vanDamme,B.N.Smith, S. Waibel, H.J. Schelhaas, A.J. van der Kooi, M. de Visser, M. Weber, W. Robberecht, PLP proteolipid protein O.Hardiman,P.J.Shaw,C.E.Shaw,K.E.Morrison,A.Al-Chalabi,P.M.Andersen, Tf transferrin A.C. Ludolph, J.H. Veldink, L.H. van den Berg, H63D polymorphism in HFE is TfR transferrin receptor not associated with amyotrophic lateral sclerosis, Neurobiol. Aging 34 (2013) – Tim-2 T cell immunoglobulin and mucin domain-containing 1517.e5 1517.e7. [23] S.Y. Lee, S.M. Patton, R.J. Henderson, J.R. Connor, Consequences of expressing mu- protein-2 tants of the hemochromatosis gene (HFE) into a human neuronal cell line lacking xCT cystine/glutamate antiporter endogenous HFE, FASEB J. 21 (2007) 564–576. [24] Y. Liu, S.Y. Lee, E. Neely, W. Nandar, M. Moyo, Z. Simmons, J.R. Connor, Mutant HFE H63D protein is associated with prolonged endoplasmic reticulum stress and increased neuronal vulnerability, J. Biol. Chem. 286 (2011) 13161–13170. [25] R.M. Mitchell, S.Y. Lee, W.T. Randazzo, Z. Simmons, J.R. Connor, Influence of HFE var- Acknowledgements iants and cellular iron on monocyte chemoattractant protein-1, J. Neuroinflammation 6(2009)6. [26] R.M. Mitchell, S.Y. Lee, Z. Simmons, J.R. Connor, HFE polymorphisms affect cellular This work is supported by the Judith and Jean Pape Adams Charitable glutamate regulation, Neurobiol. Aging 32 (2011) 1114–1123. Foundation and the George M. Leader Laboratory for Alzheimer's [27] E.C. Hall II, S.Y. Lee, N. Mairuae, Z. Simmons, J.R. Connor, Expression of the HFE disease research. allelic variant H63D in SH-SY5Y cells affects tau phosphorylation at serine resi- dues, Neurobiol. Aging 32 (2011) 1409–1419. [28] S. Tomatsu, K.O. Orii, R.E. Fleming, C.C. Holden, A. Waheed, R.S. Britton, M.A. Gutierrez, S. Velez-Castrillon, B.R. Bacon, W.S. Sly, Contribution of the H63D References mutation in HFE to murine hereditary hemochromatosis, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 15788–15793. [1] J.N. Feder, D.M. Penny, A. Irrinki, V.K. Lee, J.A. Lebron, N. Watson, Z. Tsuchihashi, E. [29] K.M. Erikson, D.J. Pinero, J.R. Connor, J.L. Beard, Regional brain iron, ferritin and Sigal, P.J. Bjorkman, R.C. Schatzman, The hemochromatosis gene product com- transferrin concentrations during iron deficiency and iron repletion in developing plexes with the transferrin receptor and lowers its affinity for ligand binding, rats, J. Nutr. 127 (1997) 2030–2038. Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 1472–1477. [30] E.R. Stadtman, R.L. Levine, Protein oxidation, Ann. N. Y. Acad. Sci. 899 (2000) [2] J.A. Lebron, A.P. West Jr., P.J. Bjorkman, The hemochromatosis protein HFE com- 191–208. petes with transferrin for binding to the transferrin receptor, J. Mol. Biol. 294 [31] M. Conrad, H. Sato, The oxidative stress-inducible cystine/glutamate antiporter, (1999) 239–245. system x (c) (-): cystine supplier and beyond, Amino Acids 42 (2012) 231–246. [3] A.T. Merryweather-Clarke, J.J. Pointon, J.D. Shearman, K.J. Robson, Global prevalence [32] A. Grochot-Przeczek, J. Dulak, A. Jozkowicz, Haem oxygenase-1: non-canonical of putative haemochromatosis mutations, J. Med. Genet. 34 (1997) 275–278. roles in physiology and pathology, Clin. Sci. (Lond.) 122 (2012) 93–103. [4] A.T. Merryweather-Clarke, J.J. Pointon, A.M. Jouanolle, J. Rochette, K.J. Robson, [33] N. Freixenet, A. Remacha, E. Berlanga, A. Caixas, O. Gimenez-Palop, F. Blanco-Vaca, Geography of HFE C282Y and H63D mutations, Genet. Test. 4 (2000) 183–198. V. Bach, M. Baiget, Y. Sanchez, J. Felez, J.M. Gonzalez-Clemente, Serum soluble [5] P.A. Gochee, L.W. Powell, D.J. Cullen, D.Du. Sart, E. Rossi, J.K. Olynyk, A transferrin receptor concentrations are increased in central obesity. Results population-based study of the biochemical and clinical expression of the H63D from a screening programme for hereditary hemochromatosis in men with hemochromatosis mutation, Gastroenterology 122 (2002) 646–651. hyperferritinemia, Clin. Chim. Acta 400 (2009) 111–116. [6] M.E. Cogswell, M.L. Gallagher, K.K. Steinberg, D.S. Caudill Ph, A.C. Looker, B.A. [34] M. Jehn, J.M. Clark, E. Guallar, Serum ferritin and risk of the metabolic syndrome Bowman, E.W. Gunter, A.L. Franks, G.A. Satten, M.J. Khoury, L.M. Grummer- in U.S. adults, Diabetes Care 27 (2004) 2422–2428. Strawn, HFE genotype and transferrin saturation in the United States, Genet. [35] E. Rossi, M.K. Bulsara, J.K. Olynyk, D.J. Cullen, L. Summerville, L.W. Powell, Effect of Med. 5 (2003) 304–310. hemochromatosis genotype and lifestyle factors on iron and red cell indices in a [7]O.T.Njajou,J.J.Houwing-Duistermaat,R.H.Osborne,N.Vaessen,J.Vergeer, community population, Clin. Chem. 47 (2001) 202–208. J. Heeringa, H.A. Pols, A. Hofman, C.M. van Duijn, A population-based study of the [36] S.H. Lee, J.W. Kim, S.H. Shin, K.P. Kang, H.C. Choi, S.H. Choi, K.U. Park, H.Y. Kim, W. effect of the HFE C282Y and H63D mutations on iron metabolism, Eur. J. Hum. Kang, S.H. Jeong, HFE gene mutations, serum ferritin level, transferrin saturation, Genet. 11 (2003) 225–231. and their clinical correlates in a Korean population, Dig. Dis. Sci. 54 (2009) 879–886. [8] W. Nandar, J.R. Connor, HFE gene variants affect iron in the brain, J. Nutr. 141 [37] X.Y. Zhou, S. Tomatsu, R.E. Fleming, S. Parkkila, A. Waheed, J. Jiang, Y. Fei, E.M. (2011) 729S–739S. Brunt, D.A. Ruddy, C.E. Prass, R.C. Schatzman, R. O'Neill, R.S. Britton, B.R. Bacon, [9] L. Batista-Nascimento, C. Pimentel, R.A. Menezes, C. Rodrigues-Pousada, Iron and W.S. Sly, HFE gene knockout produces mouse model of hereditary hemochroma- neurodegeneration: from cellular homeostasis to disease, Oxid. Med. Cell. Longev. tosis, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 2492–2497. 2012 (2012) 128647. [38] M.S. Golub, S.L. Germann, R.S. Araiza, J.R. Reader, S.M. Griffey, K.C. Lloyd, Movement [10] L. Zecca, M.B. Youdim, P. Riederer, J.R. Connor, R.R. Crichton, Iron, brain ageing disorders in the Hfe knockout mouse, Nutr. Neurosci. 8 (2005) 239–244. and neurodegenerative disorders, Nat. Rev. Neurosci. 5 (2004) 863–873. [39] D. Johnstone, R.M. Graham, D. Trinder, R.D. Delima, C. Riveros, J.K. Olynyk, R.J. [11] J.R. Connor, E.A. Milward, S. Moalem, M. Sampietro, P. Boyer, M.E. Percy, C. Scott, P. Moscato, E.A. Milward, Brain transcriptome perturbations in the Vergani, R.J. Scott, M. Chorney, Is hemochromatosis a risk factor for Alzheimer's Hfe(−/−) mouse model of genetic iron loading, Brain Res. 1448 (2012) 144–152. disease? J. Alzheimers Dis. 3 (2001) 471–477. [40] F. Ali-Rahmani, P. Grigson, S. Lee, E. Neely, B. Kinsman, J.R. Connor, C.-L. [12] J.H. Sheldon, Hemochromatosis, Oxford University Press, London, 1935, pp. 155–159. Schengrund, Effect of H63D-HFE on cholesterol metabolism, brain atrophy, and [13] J. Cammermyer, Deposition of iron in paraventricular areas of the human brain in cognitive impairment: implications for Alzheimer's Disease, J. Neurol. Sci. hemochromatosis, J. Neuropathol. Exp. Neurol. 6 (1947) 111–127. (under review). [14] J.E. Nielsen, L.N. Jensen, K. Krabbe, Hereditary haemochromatosis: a case of iron [41] S. Levi, A. Luzzago, G. Cesareni, A. Cozzi, F. Franceschinelli, A. Albertini, P. Arosio, accumulation in the basal ganglia associated with a Parkinsonian syndrome, Mechanism of ferritin iron uptake: activity of the H-chain and deletion mapping J. Neurol. Neurosurg. Psychiatry 59 (1995) 318–321. of the ferro-oxidase site. A study of iron uptake and ferro-oxidase activity of [15] D. Berg, U. Hoggenmuller, E. Hofmann, R. Fischer, M. Kraus, M. Scheurlen, G. human liver, recombinant H-chain ferritins, and of two H-chain deletion mutants, Becker, The basal ganglia in haemochromatosis, Neuroradiology 42 (2000) 9–13. J. Biol. Chem. 263 (1988) 18086–18092. W. Nandar et al. / Biochimica et Biophysica Acta 1832 (2013) 729–741 741

[42] P. Rucker, F.M. Torti, S.V. Torti, Role of H and L subunits in mouse ferritin, J. Biol. [52] J.R. Connor, B.S. Snyder, J.L. Beard, R.E. Fine, E.J. Mufson, Regional distribution of Chem. 271 (1996) 33352–33357. iron and iron-regulatory proteins in the brain in aging and Alzheimer's disease, [43] T. Moos, Immunohistochemical localization of intraneuronal transferrin receptor J. Neurosci. Res. 31 (1992) 327–335. immunoreactivity in the adult mouse central nervous system, J. Comp. Neurol. [53] B. Todorich, X. Zhang, B. Slagle-Webb, W.E. Seaman, J.R. Connor, Tim-2 is the 375 (1996) 675–692. receptor for H-ferritin on oligodendrocytes, J. Neurochem. 107 (2008) 1495–1505. [44] T.K. Dickinson, J.R. Connor, Immunohistochemical analysis of transferrin recep- [54] J.R. Burdo, J. Martin, S.L. Menzies, K.G. Dolan, M.A. Romano, R.J. Fletcher, M.D. tor: regional and cellular distribution in the hypotransferrinemic (hpx) mouse Garrick, L.M. Garrick, J.R. Connor, Cellular distribution of iron in the brain of the brain, Brain Res. 801 (1998) 171–181. Belgrade rat, Neuroscience 93 (1999) 1189–1196. [45] A.S. Dornelles, V.A. Garcia, M.N. de Lima, G. Vedana, L.A. Alcalde, M.R. Bogo, [55] J.R. Burdo, S.L. Menzies, I.A. Simpson, L.M. Garrick, M.D. Garrick, K.G. Dolan, D.J. N. Schroder, mRNA expression of proteins involved in iron homeostasis in brain re- Haile, J.L. Beard, J.R. Connor, Distribution of divalent metal transporter 1 and gions is altered by age and by iron overloading in the neonatal period, Neurochem. metal transport protein 1 in the normal and Belgrade rat, J. Neurosci. Res. 66 Res. 35 (2010) 564–571. (2001) 1198–1207. [46] B. Hallgren, P. Sourander, The effect of age on the non-haemin iron in the human [56] S. Levi, P. Santambrogio, A. Cozzi, E. Rovida, B. Corsi, E. Tamborini, S. Spada, A. brain, J. Neurochem. 3 (1958) 41–51. Albertini, P. Arosio, The role of the L-chain in ferritin iron incorporation. Studies [47] J.M. Hill, R.C. Switzer III, The regional distribution and cellular localization of iron of homo and heteropolymers, J. Mol. Biol. 238 (1994) 649–654. in the rat brain, Neuroscience 11 (1984) 595–603. [57] J.R. Connor, K.L. Boeshore, S.A. Benkovic, S.L. Menzies, Isoforms of ferritin have a [48] T. Moos, P.S. Oates, E.H. Morgan, Expression of the neuronal transferrin receptor is age speciﬁc cellular distribution in the brain, J. Neurosci. Res. 37 (1994) 461–465. dependent and susceptible to iron deﬁciency, J. Comp. Neurol. 398 (1998) 420–430. [58] E.A. Malecki, E.E. Cable, H.C. Isom, J.R. Connor, The lipophilic iron compound [49] D.F. Leitner, J.R. Connor, Functional roles of transferrin in the brain, Biochim. TMH-ferrocene [(3,5,5-trimethylhexanoyl)ferrocene] increases iron concentra- Biophys. Acta 1820 (2012) 393–402. tions, neuronal L-ferritin, and heme oxygenase in brains of BALB/c mice, Biol. [50] E.M. Taylor, A. Crowe, E.H. Morgan, Transferrin and iron uptake by the brain: Trace Elem. Res. 86 (2002) 73–84. effects of altered iron status, J. Neurochem. 57 (1991) 1584–1592. [59] J. Middeldorp, E.M. Hol, GFAP in health and disease, Prog. Neurobiol. 93 (2011) [51] J.R. Burdo, D.A. Antonetti, E.B. Wolpert, J.R. Connor, Mechanisms and regulation of 421–443. transferrin and iron transport in a model blood–brain barrier system, Neurosci- [60] W. Nandar, E. Neely, Z. Simmons, J.R. Connor, The 21st International Symposium ence 121 (2003) 883–890. on ALS/MND, 2010.